|
|
|
|||||||
|
|||||||||
(Received for publication, August 5, 1995; and in revised form, November 5, 1995 ) From the
The function of many of the pre-mRNA-binding proteins in mRNA
biogenesis is unclear. We have analyzed the biochemical function of the
hnRNP K protein by using a mouse cDNA clone. A previous study indicated
that the expression of hnRNP K activates c-myc promoter in
transient transfection assays. We show that the expression of hnRNP K
results in a trans-activation of a variety of RNA polymerase
II promoters. The trans-activation function depends on the
sequences of hnRNP K that are also necessary for RNA binding. However,
the RNA binding motifs are not sufficient for trans-activation. We could identify a mutant that bound RNA in vitro but was impaired in its ability to trans-activate the reporter genes. The trans-activation was not a result of the stabilization of the
reporter mRNA, because hnRNP K increased the steady-state level of the
reporter mRNA without altering its decay rate. By doing nuclear run-on
assays, we provide evidence that the hnRNP K protein trans-activates the reporter genes by increasing the level of
transcription. In eukaryotic cells, elongating precursors of mRNA are packaged
with pre-mRNA-binding proteins to form the heterogeneous nuclear
ribonucleoprotein complexes called hnRNPs. The pre-mRNA-binding
proteins are believed to be involved in the maturation of the precursor
mRNA. At least 20 premRNA-binding proteins or hnRNP proteins (A through
U) have been identified (Barnett et al., 1989; Burd and
Dreyfuss, 1994a; Conway et al., 1988; Dreyfuss et
al., 1993). However, the precise function performed by each of
these hnRNP proteins in mRNA biogenesis has remained elusive. The hnRNP
A1 protein has been studied in greater detail. It was shown that hnRNP
A1 preferentially bound to sequences that resemble the sequences found
in the splice sites (Burd and Dreyfuss, 1994b). Moreover, the purified
hnRNP A1 protein has been shown to be involved in selecting the 5`
splice site (Ge and Manley, 1990; Mayeda and Krainer, 1992). The A1
protein also shuttles between nucleus and cytoplasm; thus, a role in
the export of mRNA is not unlikely (Pinol-Roma and Dreyfuss, 1992).
hnRNP C has also been implicated in splicing. Antibodies raised against
hnRNP C were shown to inhibit splicing in vitro (Choi et
al., 1986). The hnRNP K protein has drawn attention because of
its KH motif, which is also found in the protein encoded by the FMR1
gene (which is involved in fragile X syndrome) (Ashly et al.,
1993; Siomi et al., 1993b, 1994). The KH motif is an
evolutionarily conserved RNA binding motif found in several other
RNA-binding proteins, including the archeabacterial ribosomal S3
protein and the meiosis-specific splicing factor MER1 (Siomi et
al., 1993a). More recently, it has been shown that a
sequence-specific single-stranded DNA-binding protein FBP, which
stimulates transcription of the c-myc gene, possesses KH
motifs within a region that is important for the DNA binding (Duncan et al., 1994). Besides the KH motif, the hnRNP K protein
contains an arginine/glycine-rich region with several copies of the RGG
box, which is found in other RNA-binding proteins (Burd and Dreyfuss,
1994a; Dreyfuss et al., 1993). In vitro, the hnRNP
K protein binds with an unusually high affinity to poly(rC) or poly(dC)
(Matunis et al., 1992). Although the significance of this high
affinity binding to poly (rC) and poly(dC) is not quite clear, it has
been shown that the hnRNP K protein can bind to a C-rich sequence (the
CT element) in the c-myc promoter and stimulate transcription
from that promoter (Takimoto et al., 1993; Tomonaga and
Levens, 1995). Besides an effect on the c-myc promoter, hnRNP
K has also been implicated in transformation. Dejgaard et
al.(1994) identified four splice variants of hnRNP K and showed
that the levels of these polypeptides were up-regulated in
SV40-transformed cells. We investigated the RNA binding properties
of hnRNP K using natural RNA sequences as substrate. (
Figure 1:
Activation of the
CAT gene expression by the hnRNP K protein. Schematic diagrams of the
plasmids containing reporter CAT gene with various promoter sequences
are shown in the upper panel (also see ``Materials and
Methods''). NIH 3T3 cells were cotransfected with the reporter CAT
gene constructs (5 µg) and the indicated amounts of the hnRNP K
expressing plasmid (CMV-K). The transfections and the CAT assays were
carried out as described under ``Materials and Methods.'' The
percentage of conversion (% acetylation) is shown. The number above each bar represents the actual percentage of
acetylation.
The hnRNP K-mediated stimulation of
the CAT activity was dependent on the structure of the promoter. For
example, we observed that the adenovirus E2 promoter and the SV40 early
promoter elicited an opposite response by the coexpression of hnRNP K.
The adenovirus E2 promoter consistently expressed the reporter CAT gene
at a level similar to what was observed from the SV40 early promoter in
NIH 3T3 cells (Fig. 2). Expression of the K protein resulted in
a modest repression of CAT activity from the E2 promoter (Fig. 2, A and B). The repression was also
detected in the presence of E1A, which is known to activate this
promoter (Fig. 2B). The SV40 early promoter, on the
other hand, exhibited a high level of stimulation by the cotransfection
of the K-expressing plasmid (Fig. 2A).
Figure 2:
trans-Activation by hnRNP K
depends upon promoter structure. A, CAT gene reporter
constructs containing adenovirus E2 promoter (E2 CAT) or SV40 early
promoter were transfected into NIH 3T3 cells along with the indicated
amounts of the hnRNP K-expressing plasmid. The transfection and CAT
gene assays were performed as described before (Arroyo and
Raychaudhuri, 1992). The number above each bar represents the actual percentage of acetylation. B,
adenovirus E2 promoter construct (E2 CAT) was transfected into NIH 3T3
cells along with the E1A (12S)-expressing plasmid in the presence or
the absence of the indicated amount of the hnRNP K-expressing plasmid.
The CAT gene activities are shown.
So far we
have not been able to identify a promoter-reporter construct whose
activity is not altered by the coexpression of the hnRNP K protein.
Majority of the promoters tested were trans-activated by the
coexpression of hnRNP K. Because of this promiscuity of hnRNP K effect,
we were not able to use an internal control for transfection
efficiencies. However, all of the transfection experiments presented
above and below were repeated several times, and they very accurately
reflect the average.
Figure 3:
hnRNP K binds to the reporter mRNA
depending upon the KH motifs and the RGG box. 30 ng of GST-hnRNP K or
the indicated mutants were incubated with
To analyze the mutants in trans-activation assays, an
eukaryotic expression vector containing the CMV promoter was employed.
The mutants were subcloned into this vector in-frame with a flu virus
epitope (HA tag) in the N terminus. The HA tag allowed us to detect the
proteins expressed from the transfected genes without interference from
the endogenous hnRNP K protein. To look at the expression and
localization of the mutants, nuclear extracts of the transfected cells
were analyzed in Western blot assays. The blots were probed with a
monoclonal antibody against the HA tag. As shown in Fig. 4, the
mutants produced expected size polypeptides, and they were detected in
the nuclear extracts of the transfected cells. We were consistently
unable to detect the polypeptide corresponding to the mutant N100 in
the nuclear extracts of the transfected cells.
Figure 4:
Expression of the hnRNP K mutants in the
transfected cells. The hnRNP K or its mutants were cloned into CMV-HA
tag-poly(A) plasmid as described under ``Materials and
Methods.'' 5 µg of HA tag-hnRNP K or the mutants (see Fig. 5) was transfected into NIH 3T3 cells. Nuclear extract was
prepared from the transfected cells. 30 µg of nuclear extracts was
separated by SDS-polyacrylamide gels and transferred to the
nitrocellulose membrane. The nitrocellulose blot was probed with a
monoclonal antibody against HA tag (12CA5; Boehringer Mannheim). The
blot was developed by ECL.
Figure 5:
trans-Activation of the reporter
genes depends upon sequences that are also necessary for RNA binding. A
schematic diagram of the HA tag hnRNP K or its mutants is shown in the left panel. The plasmid pFC(-58)/CRE-CAT (5 µg) was
used as a reporter construct. 5 µg of the plasmid that expressed
the wild type hnRNP K or the indicated mutants was transfected into NIH
3T3 cells along with the reporter gene. The CAT assays were performed
as described under ``Materials and Methods.'' The percentage
of activation of wild type is shown. An average of at least six
independent experiments is shown.
To identify the
region of hnRNP K protein involved in the trans-activation
function, the mutants described in Fig. 4were analyzed in
cotransfection assays. The mutants were transfected into NIH 3T3 cells
along with the CRE sites containing reporter construct. The results of
these transfection experiments are summarized in Fig. 5. An
average of six independent experiments is shown. A mutant that lacked
the N-terminal amino acid residues up to 41 (N41) was active in trans-activation of the reporter gene. However, a complete
deletion of the first KH domain(N100) or a small internal deletions
within the core consensus region of the first KH domain
(
Figure 6:
RNA binding is not sufficient for trans-activation. A, increasing amounts of the HA
tag-C331- or the HA tag-C299-expressing plasmid were transfected into
NIH 3T3 cells along with pFC(-58)/CRE-CAT as a reporter
construct. Each bar represents fold activation compared with
the control plasmid (CMV-HA tag-poly(A)). B, increasing
amounts of the HA tag-C331- or the HA tag-C299-expressing plasmid were
transfected into NIH 3T3 cells. Nuclear extracts from the transfected
cells were analyzed for the hnRNP K and the mutants. The Western blot
was probed with a polyclonal antibody raised against a peptide of hnRNP
K (see ``Materials and Methods'' for details) because 12CA5,
monoclonal antibody against HA tag, gives a nonspecific band around 44
kDa that partly overlaps the band of HA tag-C331 (see Fig. 4). *
indicates the endogenous hnRNP K,** indicates the HA tag-C331, and***
indicates HA tag-C299.
Figure 7:
The hnRNP K protein increases the
steady-state level of CAT mRNA. The plasmid pFC(-58/CRE)-CAT was
used as a responsive reporter, and the plasmid pFC(-58/E2F)-CAT
was used as a nonresponsive reporter. The reporter plasmid (5 µg)
was transfected into NIH 3T3 cells along with the indicated amounts of
the CMV-K plasmid. After transfection, total cellular RNA was isolated,
and 25 µg of the RNA, after a 10-min treatment with DNaseI, was
analyzed for CAT specific transcript as described under
``Materials and Methods.'' The arrow indicates
correctly initiated CAT mRNA (210 nucleotides), and the band indicated by the asterisk most likely represents CAT mRNA
from a secondary start site. The lower panel shows assays for
the GAPDH RNA (see ``Materials and Methods'' for details).
The two panels represent two independent
experiments.
The hnRNP K
protein did not alter the half-life of the reporter RNA. We measured
the decay rate of the CAT mRNA in the presence of the wild type or a
mutant hnRNP K protein. Because the pFC(-58)/CRE construct had a
very low basal level of expression, we sought to use a reporter
construct that produces the same reporter mRNA at a high basal level.
The plasmid pFC700 was used as reporter because it expressed the same
CAT mRNA from a relatively stronger promoter. pFC700 construct
exhibited only a marginal increase in the CAT activity by coexpression
of the hnRNP K protein (not shown). Nevertheless, the high basal level
expression allowed us to investigate the decay rate of the CAT mRNA.
Before harvesting, the cells were incubated with 5 µg/ml of
actinomycin D for various time periods. The total cellular RNA was
purified and digested with DNase I, and CAT mRNA was assayed by an
RNase protection assay as described under ``Materials and
Methods.'' The upper panel in Fig. 8shows the
decay rate of CAT mRNA in cells cotransfected with wild type or a
nonfunctional mutant hnRNP K-expressing plasmid. The band intensities
were quantified by densitometric scanning. The lower panel of Fig. 8shows a plot of log (percentage of mRNA remaining) versus time of treatment with actinomycin D. This experiment
was reproduced several times, and we did not detect any significant
difference in the decay rate of CAT mRNA in the presence of wild type
or mutant hnRNP K protein. Taken together, these results suggest that
hnRNP K increases the level of RNA synthesis from the reporter genes.
Figure 8:
hnRNP K does not alter the decay rate of
the CAT mRNA. NIH 3T3 cells were cotransfected with the plasmid pFC700
(a CAT gene construct containing the human c-FOS promoter
sequences from -700 to +40) and the wild type or a mutant
(
To investigate a role of the hnRNP K protein in altering the level
of RNA synthesis, we carried out nuclear run-on assays using isolated
nuclei from transfected NIH 3T3 cells. The transfection experiments
were carried out using the E2F or the CRE sites containing constructs
with and without hnRNP K-expressing plasmid. The nuclei from the
transfected cells were isolated and labeled with
[
Figure 9:
The hnRNP K protein increases the rate of
transcription from a responsive target. Four plates (10 cm) were used
for each set of transfections. For blots 1 and 2, cells were
transfected with pFC(-58/E2F)-CAT (5 µg) in the presence (lane 1) or in the absence (lane 2) of the CMV-K
plasmid (5 µg). For blots 3 and 4, approximately equal number of
cells were transfected with pFC(-58/CRE)-CAT in the presence (lane 4) or in the absence (lane 3) of the CMV-K
plasmid (5 µg). The cells from each set of transfections were
pooled and nuclei were isolated. The nuclear run-on assays were
performed as described under ``Materials and Methods.'' The
labeled RNA was hybridized with specific probes that were immobilized
on nitrocellulose blots as described under ``Materials and
Methods.'' The specific probes contained a 250-nucleotide cDNA
fragment (0.5 µg) corresponding to the 5` end of the CAT gene (lower lanes) or a 800-nucleotide cDNA fragment (0.5 µg)
corresponding to the 18 S rRNA gene (upper lanes). The blots
did not contain any plasmid sequences.
The hnRNP K protein was shown to stimulate expression of the
CAT gene from a c-myc promoter construct (Takimoto et
al., 1993). To investigate the cellular function of the hnRNP K
protein, we carried out transient transfection experiments and analyzed
the effects of an expression of hnRNP K on a variety of reporter genes.
NIH 3T3 cells were used for these studies, because the endogenous level
of hnRNP K in these cells is lower than that in several other cell
lines (not shown). We observed that an expression of hnRNP K altered
expression of reporter genes from a variety of promoters. Curiously,
the adenovirus E2 gene promoter exhibited a reduction of activity. The
majority of the promoter constructs, on the other hand, exhibited an
increase in expression by the coexpression of the hnRNP K protein.
Therefore, in this study we analyzed the trans-activation in
greater detail. To investigate a link between the RNA binding and
the trans-activation functions, we analyzed the hnRNP K
mutants in transient transfection assays. A CRE site-containing
construct was used as a reporter gene. The results of these studies
indicated that the mutants that are deficient in RNA binding are also
impaired in the trans-activation function. However, RNA
binding alone did not account for the trans-activation
function. Because a C-terminal deletion mutant (C299) bound RNA
efficiently but exhibited a much reduced trans-activation
function. We do not think that this was due to a lack of expression or
improper localization of C299. This mutant can be detected in the
nuclear extracts of the transfected cells. Thus, we believe that in
addition to RNA binding, there are other interactions that are involved
in the trans-activation by the hnRNP K protein. The
increase in CAT enzyme activity from this construct correlated with an
increase in the level of steady-state CAT mRNA, indicating that the
effect, at least partly, is at the level of RNA accumulation. We did
not detect any significant alteration of the decay rate of CAT mRNA by
a coexpression of the hnRNP K protein. These results suggested that
coexpression of hnRNP K increases RNA synthesis from the reporter gene.
To obtain further evidence for an increased rate of RNA synthesis, we
performed nuclear run-on assays. Results of these assays confirmed the
notion that the hnRNP K protein trans-activates reporter genes
by increasing the level of transcription. The molecular mechanism by
which the hnRNP K protein increases the level of RNA synthesis is
unclear. We can imagine three scenarios. First, it is possible that it
activates transcription indirectly by increasing the availability of
the transcription factors. Second, because hnRNP K binds
single-stranded DNA, it might perform a function in transcription that
is similar to what is carried out by single-stranded binding protein in
DNA replication. Third, it is possible that hnRNP K enhances RNA
synthesis by binding to the newly synthesized chain of mRNA. An
increase in the availability of transcription factors by hnRNP K can be
accomplished in several ways. For example, it is possible that the
hnRNP K protein alters the decay rate of the mRNAs of the transcription
factors, resulting in an increase in the levels of the transcription
factors. Because we consistently observed a large induction through the
ATF/CRE site, we compared the levels of the transcription factors CREB,
ATF1, ATF2, ATF3, and ATF4 in hnRNP K-transfected and untransfected
cells by immunoblot assays. No alteration in the levels of these
factors was observed (data not shown). Additionally, we did not detect
any alteration of the decay rate of the CAT mRNA, implying that the
hnRNP K protein does not alter the half-life of mRNA. It is also
possible that the transcription factors remain sequestered in an
RNA-bound form, and the overexpression of an RNA-binding protein
releases these transcription factors, making them available to activate
promoters. Such a possibility is unlikely because in that case any
RNA-binding protein would stimulate RNA synthesis. We did not detect
any trans-activation by coexpressing hnRNP A1 (not shown).
Also, the mutant C299, which bound RNA, was impaired in its ability to trans-activate a reporter gene (Fig. 6). It is
noteworthy that in two different instances this RNA-binding protein was
shown to associate with promoter-elements (Ostrowski et al.,
1994; Takimoto et al., 1993). Although we have not detected a
sequence-specific stable interaction with the promoters used in this
study, it is possible that hnRNP K interacts with promoter complexes
after a melting has occurred during the initiation complex formation.
The single-stranded DNA binding function may have a role in stabilizing
an open complex configuration during transcription. Such a possibility
can not be ruled out; however, requirement for a single-stranded
binding protein in transcription is yet to be shown. An attractive
model is that this pre-mRNA-binding protein binds to the newly
synthesized RNA and enhances the rate of synthesis. There is precedence
for RNA-binding protein involved in transcription. For example, the HIV
encoded Tat protein is an RNA-binding protein that stimulates
transcription from the HIV LTR (see Cullen(1991) for a review). We
speculate that the hnRNP K protein, after binding near the 5` end of
the synthesizing chain of pre-mRNA, interacts with the transcription
machinery and enhances the rate of RNA synthesis. Nuclear matrix has
been shown to play a role in RNA transcription. The actively
transcribing genes have been shown to associate with the nuclear matrix
(Hutchinson and Weintraub, 1985; Stief et al., 1989). Because
hnRNP binding to pre-mRNA is coupled to transcription, it is possible
that the nuclear matrix play a role in loading the pre-mRNA-binding
proteins onto the nascent chain of mRNA. We envision that the hnRNP K
binds mRNA as soon as hnRNP K-recognition motif is synthesized and that
this interaction then allows other interactions with the transcription
machinery leading to an increased level of transcription. A clear
definition of the RNA element recognized by the hnRNP K protein, as
well as determination of the role of the RNA element, will provide an
insight into the mechanism by which hnRNP K protein increases RNA
synthesis.
Volume 271,
Number 7,
Issue of February 16, 1996 pp. 3420-3427
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
)Results of these studies indicated that the hnRNP K
protein possesses selective RNA binding activities. This RNA binding
activity depends upon the KH domains as well as the
arginine/glycine-rich regions. Here, we show that the
expression of the hnRNP K protein trans-activates expression
from reporter genes with a variety of RNA polymerase II promoters. The trans-activation is not specific for the CT element found in
the c-myc promoter. The stimulation of the reporter gene
expression depends on the sequences that are also necessary for RNA
binding by the hnRNP K protein. However, RNA binding alone does not
account for the trans-activation function of the hnRNP K
protein. Finally, the trans-activation by the hnRNP K protein
involves an increase in RNA synthesis from the reporter gene. The hnRNP
K protein increases the steady-state level of the reporter mRNA without
altering its decay rate.
Expression Plasmids and Mutants
The pGEX clones
of hnRNP K and its mutants will be described elsewhere. Eukaryotic expression plasmids of hnRNP K protein and its mutants
were constructed by cloning the polymerase chain reaction fragments
into EcoRI/SalI sites of CMVHA-poly(A) vector.
CMVHA-poly(A) was constructed by introducing nucleotide sequences
corresponding to HA tag downstream of the CMV promoter (Pani et
al., 1992). The hnRNP K cDNA clones were introduced in frame with
HA.RNA Binding and Gel Retardation Assay
In vitro transcribed and polyacrylamide-urea gel purified
-P-labeled RNAs were heated to 95 °C for 5 min
and subsequently incubated in ice for 5 min. RNA probes (20,000
cpm/0.5-1.0 ng) were incubated with 20-30 ng of GST-hnRNP K
or the mutants in a total volume of 30 µl containing 20 mM HEPES, pH 7.9, 2 mM MgCl
, 10 uM ZnCl, 0.02% Nonidet P-40, 70 mM NH
Cl, and 1 µg of yeast tRNA for 20 min at room
temperature. Equal aliquots of the incubation mixtures were analyzed by
gel retardation assays (Scherly et al., 1989; Ray et
al., 1992).RNA Probe
The pGEM clone of +8 fos-CAT ()was constructed by cloning the PstI/PvuII fragment of pFC(-58)fos-CAT into PstI and HincII sites of pGEM3Zf(+). BamHI-linearized pGEM clone of +8 fos-CAT was used to
generate an RNA probe of 202 nucleotides. This probe contains 32
nucleotides from the human c-FOS mRNA (between +8 and
+40) and 170 nucleotides from the CAT mRNA (+1 to +170).
The RNA probe was synthesized by in vitro transcription using
SP6 RNA polymerase in the presence of NTPs and
[-P]UTP. The full-length RNA was purified
by polyacrylamide-urea gel.
Antibodies
A synthetic peptide corresponding to
the sequence between residues 218 and 232 was used to raise rabbit
antiserum. The peptide was coupled to keyhole limpet hemacyanin by
using an additional cysteine residue at the C terminus. The peptide
antibody was purified by peptide affinity chromatography. The antibody
specifically recognizes hnRNP K protein in Western blot assays of crude
extracts. The antibody purification and Western blots were performed
following procedures described by Harlow and Lane(1988).Reporter CAT Gene Constructs
The CAT gene
constructs pFC(-58)/CRE, pFC(-58)/AP1,
pFC(-58)/NF-IL6, pFC(-58)/GRE, and pFC(-58)/E2F were
obtained by cloning oligonucleotides at position -58 of the human
c-FOS promoter-CAT construct. Each construct contained
c-FOS promoter sequences corresponding to -58 and
+42 upstream of the CAT gene. AGCTGTGACGTTTAGTGACGTTTAG was used
as CRE-oligo; AGCTCTGCGTCAGTGCGTCAG was used as AP1 oligo;
AGCTATTAGGACATATTAGGACAT was used as the NF-IL6 oligo;
AGCTTTAGTGTTCTATTTTCCTATGTTCTTTTGGAAT was usedas the GRE oligo; and the
sequences between -30 and -70 of the adenovirus E2 promoter
was used as the E2F oligo.Transfections and CAT Assays
DNA transfections
into NIH 3T3 cells and CAT assays were performed following previously
described procedures (Arroyo and Raychaudhuri, 1992).RNase Protection Assay
Total cellular RNA from
transfected cells was isolated following a procedure described before
(Chomczynski and Sacchi, 1987). The RNA preparations were treated with
RNase-free DNase I (final concentration, 667 units/ml; Boehringer
Mannheim) for 5 min at 37 °C. For CAT mRNA, 25 µg of RNA from
each of the samples was analyzed. To obtain an antisense CAT-specific
probe, a DNA fragment between HindIII and PvuII from
the CAT gene construct pFC(-58)/E2F was subcloned into the HindIII/SmaI sites of pGEM3zf(+). The plasmid
was linearized at the HindIII site and transcribed by using T7
RNA polymerase in the presence of ribonucleotide triphosphates and
[-P]UTP. To probe for the GAPDH RNA, a rat
GAPDH cDNA (gift of R. Costa, Department of Biochemistry, University of
Illinois at Chicago) cloned into a pGEM vector was used to generate
antisense RNA probe; and 5 µg of total RNA from each of the samples
was analyzed. The hybridization was carried out for 14-16 h at 60
°C in 10 µl of a solution containing 80% formamide, 40 mM PIPES (pH 7.6), 0.4 M NaCl, and 0.5 mM EDTA. The
reaction mixtures were then digested with 26 units/ml of RNase T2 for 1
h at 32 °C (Adami and Babiss, 1990; Hart et al., 1985).
The protected fragments were analyzed by 4% polyacrylamide-urea gels
followed by autoradiography.
Nuclear Run-on Assays
Nuclear run-on assays with
transfected cell nuclei were carried out essentially following a
previously described protocol (Greenberg and Ziff, 1984). Briefly,
cells were harvested 36 h after transfection and washed three times
with ice-cold phosphate-buffered saline. The cell pellets were
resuspended in Nonidet P-40 lysis buffer, which contained 10 mM Tris-HCl, pH 7.4, 10 mM NaCl, 3 mM MgCl, and 0.5% (v/v) Nonidet P-40. After an incubation
on ice for 2 min, the nuclei were pelleted by centrifugation at 650
g for 5 min. The supernatants were removed, and the
nuclei were resuspended in buffer (200 µl) containing 50 mM Tris-HCl, pH 8.3, 40% (v/v) glycerol, 5 mM MgCl, and 0.1 mM EDTA. 200 µl of the
reaction buffer was added to the resuspended nuclei, and reaction was
allowed to continue for 30 min at 30 °C. The reaction buffer
contained 10 mM Tris-HCl, pH 8.0, 5 mM MgCl, 300 mM KCl, 0.5 mM each of
ATP, CTP, and GTP, and 200 µCi of
[-P]UTP. The
P-labeled RNA was
isolated following the previously described procedure (Greenberg and
Ziff(1984) and references therein). The labeled RNA was used to
hybridize with specific probes that were immobilized onto a
nitrocellulose membrane by using a slot blot apparatus (Schleicher
& Schuell). For CAT mRNA, a 250 nucleotide cDNA fragment (0.5
µg) corresponding to the 5` end of the CAT gene; and for rRNA, a
800-nucleotide cDNA fragment (0.5 µg) corresponding to the mouse 18
S rRNA was used. The blots did not contain any plasmid sequences.
Effects of hnRNP K on the Expression of Reporter
Genes
The hnRNP K protein was shown to stimulate CAT gene
expression from the c-myc promoter, and this stimulation was
correlated with the binding of the hnRNP K protein to the CT element in
the c-myc promoter (Takimoto et al., 1993; Tomonaga
and Levens, 1995). To investigate the trans-activation
function of the hnRNP K protein, we carried out transient transfection
experiments using several chimeric reporter gene constructs. We
observed that the mouse hnRNP K protein could stimulate reporter gene
expression from a variety of promoters irrespective of the CT element.
The reporter constructs containing two copies of the CRE site, the AP1
site, the NF-IL6 site, or the GRE site upstream of the basal c-FOS promoter were cotransfected into NIH 3T3 cells along with a mouse
hnRNP K-expressing plasmid. The coexpression of the hnRNP K protein
resulted in a stimulation of the CAT gene expression from the reporter
gene constructs (Fig. 1).
trans-Activation Function of the hnRNP K Protein Depends
upon the Sequences That Are Also Necessary for RNA Binding
hnRNP
K was identified as a pre-mRNA-binding protein. We did not detect a
direct interaction of hnRNP K with the promoters used in the trans-activation assays. However, we could easily detect a
specific interaction of the hnRNP K protein with a 202-nucleotide RNA
probe derived from one of the reporter genes used in this study (Fig. 3). The RNA probe (fos-CAT) contained 32 nucleotides of
the c-FOS mRNA and 170 nucleotides of CAT mRNA. The hnRNP K
protein interacted with this RNA probe depending upon the KH motifs as
well as the arginine/glycine-rich region (Fig. 3). Mutations
that altered the KH1 and KH2 domains (N100, 
57-65, and
159-167) significantly reduced the RNA binding ability of
the hnRNP K protein. In addition, mutations that altered the
arginine/glycine-rich region (256-331, 256-280,
and 296-299) also reduced in binding to the fos-CAT probe.
-P-labeled
RNA probe containing 32 nucleotides of the c-FOS mRNA and 170
nucleotides of CAT mRNA (see ``Materials and Methods'') in
the presence of 1 µg of tRNA as described under ``Materials
and Methods.'' After 20 min of incubation at room temperature,
aliquots (7 µl) were analyzed by gel retardation assay as described
under ``Materials and Methods.''
57-65) or a small internal deletion within the second KH
domain (159-167) resulted in a significant impairment of the trans-activation function. The mutants harboring C-terminal
deletions up to amino acids 360 and 331, which removed the third KH
domain but left the RGG clusters intact, still exhibited significant trans-activation. The mutants that lacked the RGG clusters
(255-331) or part of the RGG cluster (255-280 and
296-299) exhibited a significant reduction of the trans-activation function. Taken together, this line of
analysis shows that the first and the second KH domains and the RGG
clusters are essential for the trans-activation function of
the hnRNP K protein. Because these sequences are also important for RNA
binding, it is likely that the trans-activation function of
hnRNP K involves RNA binding.RNA Binding Is Not Sufficient for the trans-Activation of
the Reporter Genes
Furthermore, the analysis of the mutants in
transfection assays indicated that the RNA binding function may not be
sufficient for trans-activation. Two C-terminal deletion
mutants, C299 and C331, exhibited very similar RNA binding activities (Fig. 3). These two mutants were also detected in the nuclear
extracts of the transfected cells (Fig. 6B). However,
when analyzed in trans-activation assays, the mutant C299
consistently exhibited a much reduced activity compared with C331 (Fig. 6A). These results suggest the possibility that
RNA binding alone may not be sufficient for the trans-activation function of the hnRNP K protein.
Interestingly, the sequence between residues 299 and 331 is rich in
proline. Proline-rich sequences have been implicated in protein-protein
interactions. It is likely that this region of hnRNP K is involved in
interactions with other proteins, which are important for the trans-activation function.
The trans-Activation by the hnRNP K Protein Involves an
Increase in RNA Synthesis
The hnRNP K protein has been shown to
be localized in the nucleus (Matunis et al., 1992). To
investigate whether the stimulation of the CAT activity by a
coexpression of hnRNP K protein is a nuclear event, the steady-state
levels of CAT mRNA from two reporter constructs were monitored. CAT
gene construct containing CRE or E2F site were transfected into NIH 3T3
cells along with the hnRNP K-expressing plasmid. The total cellular RNA
from transfected cells was isolated and analyzed by RNase T2 protection
assay as described under ``Materials and Methods.'' The two
panels in Fig. 7represent two independent experiments. We could
detect the specifically protected band (210 nucleotides) corresponding
to the correctly initiated RNA (indicated by an arrow in Fig. 7). The band indicated by an asterisk in Fig. 7most
likely represents protected RNA from a secondary start site (at
position +15 within the FOS gene sequences and upstream
of the CAT coding region). The intensity of the correctly initiated
band from the CRE-containing construct was enhanced by the coexpression
of the hnRNP K protein in a dose-dependent manner. A densitometric
scanning indicated a 12-15-fold increase in intensity of the
correctly initiated band from the CRE reporter by the cotransfection of
5 µg of hnRNP K expression plasmid. However, the intensity of the
same mRNA band from the E2F-containing construct was not increased by
the coexpression of the hnRNP K protein. Interestingly, the CAT enzyme
activity from this construct was increased only 2-3-fold by the
coexpression of the hnRNP K protein (data not shown), which probably
reflects transcription from the secondary start site.
255-331) hnRNP K expression plasmid. The transfections were
carried out as described under ``Materials and Methods.''
Before harvesting, the transfected cells were stimulated by adding 15%
fetal bovine serum in the medium for 30 min followed by incubations
with actinomycin D (5 µg/ml) for the indicated period of time. The
total cellular RNA was isolated and treated with DNase I. The CAT mRNA
was assayed by using an antisense RNA probe (upper panel) as
described under ``Materials and Methods.'' The assays for the
GAPDH RNA in the same samples are also shown. The lower panel shows a plot of log (% of mRNA remaining) versus the time
of treatment with actinomycin D.
-P]UTP. The labeled RNAs from the four
samples were isolated and were used to hybridize with specific probes
bound to nitrocellulose membrane. Four nitrocellulose membranes, each
containing the first 250 nucleotides of the CAT cDNA (0.5 µg; Fig. 9, lower lanes) and a 800-nucleotide fragment
corresponding to the cDNA of mouse 18 S rRNA (0.5 µg; Fig. 9, upper lanes), were hybridized with the labeled
RNA from the four samples. The probe for the rRNA served as an internal
control because we did not detect any significant change in the rRNA
level by the coexpression of hnRNP K protein. Clearly, the coexpression
of the hnRNP K protein increased the level of RNA synthesis from the
CRE-containing promoter.
))
We thank A. Morozov (Department of Biochemistry,
University of Illinois at Chicago) for giving us the plasmids
pFC(-58)/CRE, pFC(-58)/NF-IL6, pFC(-58)/AP1, and
pFC(-58)/GRE. We also thank Drs. R. Costa, S. Bagchi, and G.
Adami for critically reviewing the manuscript.
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  N. K. Mukhopadhyay, J. Kim, B. Cinar, A. Ramachandran, M. H. Hager, D. Di Vizio, R. M. Adam, M. A. Rubin, P. Raychaudhuri, A. De Benedetti, et al. Heterogeneous Nuclear Ribonucleoprotein K Is a Novel Regulator of Androgen Receptor Translation Cancer Res., March 15, 2009; 69(6): 2210 - 2218. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Notari, P. Neviani, R. Santhanam, B. W. Blaser, J.-S. Chang, A. Galietta, A. E. Willis, D. C. Roy, M. A. Caligiuri, G. Marcucci, et al. A MAPK/HNRPK pathway controls BCR/ABL oncogenic potential by regulating MYC mRNA translation Blood, March 15, 2006; 107(6): 2507 - 2516. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Alex and K. A. W. Lee RGG-boxes of the EWS oncoprotein repress a range of transcriptional activation domains Nucleic Acids Res., March 2, 2005; 33(4): 1323 - 1331. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Ostrowski, Y. Kawata, D. S. Schullery, O. N. Denisenko, and K. Bomsztyk Transient recruitment of the hnRNP K protein to inducibly transcribed gene loci Nucleic Acids Res., July 15, 2003; 31(14): 3954 - 3962. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Lacroix, H. Lienard, E. Labourier, M. Djavaheri-Mergny, J. Lacoste, H. Leffers, J. Tazi, C. Helene, and J.-L. Mergny Identification of two human nuclear proteins that recognise the cytosine-rich strand of human telomeres in vitro Nucleic Acids Res., April 1, 2000; 28(7): 1564 - 1575. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Charroux, C. Angelats, L. Fasano, S. Kerridge, and C. Vola The Levels of the bancal Product, a Drosophila Homologue of Vertebrate hnRNP K Protein, Affect Cell Proliferation and Apoptosis in Imaginal Disc Cells Mol. Cell. Biol., November 1, 1999; 19(11): 7846 - 7856. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. S. Schullery, J. Ostrowski, O. N. Denisenko, L. Stempka, M. Shnyreva, H. Suzuki, M. Gschwendt, and K. Bomsztyk Regulated Interaction of Protein Kinase Cdelta with the Heterogeneous Nuclear Ribonucleoprotein K Protein J. Biol. Chem., May 21, 1999; 274(21): 15101 - 15109. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. Du, I. N. Melnikova, and P. D. Gardner Differential Effects of Heterogeneous Nuclear Ribonucleoprotein K on Sp1- and Sp3-mediated Transcriptional Activation of a Neuronal Nicotinic Acetylcholine Receptor Promoter J. Biol. Chem., July 31, 1998; 273(31): 19877 - 19883. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 U. Delling, M. Raymond, and E. Schurr Identification of Saccharomyces cerevisiae Genes Conferring Resistance to Quinoline Ring-Containing Antimalarial Drugs Antimicrob. Agents Chemother., May 1, 1998; 42(5): 1034 - 1041. [Abstract] [Full Text]
|
|
|
|
|
|
S. Hayes, P. Shiyanov, X. Chen, and P. Raychaudhuri DDB, a Putative DNA Repair Protein, Can Function as a Transcriptional Partner of E2F1 Mol. Cell. Biol., January 1, 1998; 18(1): 240 - 249. [Abstract] [Full Text]
|
|
|
|
|
|
O. N. Denisenko, B. O'Neill, J. Ostrowski, I. Van Seuningen, and K. Bomsztyk Zik1, a Transcriptional Repressor That Interacts with the Heterogeneous Nuclear Ribonucleoprotein Particle K Protein J. Biol. Chem., November 1, 1996; 271(44): 27701 - 27706. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. K. C. Li and K. A. W. Lee Transcriptional Activation by the Ewing's Sarcoma (EWS) Oncogene Can Be Cis-repressed by the EWS RNA-binding Domain J. Biol. Chem., July 21, 2000; 275(30): 23053 - 23058. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Mandal, R. Vadlamudi, D. Nguyen, R.-A. Wang, L. Costa, R. Bagheri-Yarmand, J. Mendelsohn, and R. Kumar Growth Factors Regulate Heterogeneous Nuclear Ribonucleoprotein K Expression and Function J. Biol. Chem., March 23, 2001; 276(13): 9699 - 9704. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Habelhah, K. Shah, L. Huang, A. L. Burlingame, K. M. Shokat, and Z.'e. Ronai Identification of New JNK Substrate Using ATP Pocket Mutant JNK and a Corresponding ATP Analogue J. Biol. Chem., May 18, 2001; 276(21): 18090 - 18095. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Fabini, R. Raijmakers, S. Hayer, M. A. Fouraux, G. J. M. Pruijn, and G. Steiner The Heterogeneous Nuclear Ribonucleoproteins I and K Interact with a Subset of the Ro Ribonucleoprotein-associated Y RNAs in Vitro and in Vivo J. Biol. Chem., June 1, 2001; 276(23): 20711 - 20718. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. V. Bajenova, R. Zimmer, E. Stolper, J. Salisbury-Rowswell, A. Nanji, and P. Thomas Heterogeneous RNA-binding Protein M4 Is a Receptor for Carcinoembryonic Antigen in Kupffer Cells J. Biol. Chem., August 10, 2001; 276(33): 31067 - 31073. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |