During skeletal muscle development, a family of transcription factors of the bHLH ()class plays a pivotal role in inducing and maintaining the differentiated character of skeletal muscle (Olson, 1990; Weintraub et al., 1991; Sassoon, 1993). These transcription factors, MyoD, myf-5, myogenin, myf-6/MRF-4/herculin (Davis et al., 1987; Braun et al., 1989; Edmondson and Olson, 1989; Olson, 1990; Rhodes and Konieczny, 1989; Wright et al., 1989; Braun et al., 1990; Miner and Wold, 1990) activate the transcription of many muscle-specific genes by binding to DNA at E box sites (CANNTG) within their promoters (Lassar et al., 1989).

The active forms of these transcription factors are thought to be heterodimers comprised of a myogenic bHLH protein and a ubiquitous E type bHLH protein (Lassar et al., 1991). The latter proteins are derived from alternatively spliced transcripts from two genes, one called E12 (also called E2A, E2-5, or ITF1) (Murre et al., 1989a; Henthorn et al., 1990b; Nourse et al., 1990) and the other called ITF-2 (also called E2-2, SEF2, or TFE) (Henthorn et al., 1990a; Corneliussen et al., 1991; Javaux et al., 1991). The basic region of these transcription factors is responsible for binding to the E box sequence in DNA, while the HLH domain mediates dimerization. Homodimers of E12 are able to transactivate some E box-containing promoters, while homodimers of ITF-2 cannot (Henthorn et al., 1990a). Although homodimers of MyoD are inactive, heterodimers of MyoD and E12 or MyoD and ITF-2 can activate promoters containing E box sequences (Lassar et al., 1991). Thus, MyoD requires heterodimerization with ubiquitous E type proteins for activity. All of the E type bHLH proteins contain a conserved motif, designated the loop-helix (LH) motif, which is responsible for most of the transcriptional activation activity of these proteins (Quong et al., 1993).

Lineage-specific bHLH proteins exist in tissues other than muscle. MASH1 and MASH2 are bHLH proteins that are restricted to neuronal lineages (Johnson et al., 1990). They are mammalian homologues of the Drosophila achaete-scute genes. Tal-1, tal-2, and lyl-1 are bHLH proteins that are restricted to hematopoietic tissues (Chen et al., 1990; Xia et al., 1991; Mellentin et al., 1989). These three proteins have been implicated in the development of human lymphoid malignancies. The neurogenic and the hematopoietic bHLH proteins heterodimerize with E12 protein (Murre et al., 1989b; Hsu et al., 1991; Voronova and Lee, 1994).

The protein Id has an HLH motif, but it lacks the basic domain. Id is believed to act as a negative regulator of other bHLH proteins through the formation of heterodimeric complexes that fail to bind DNA (Benezra et al., 1990). Id mRNA levels decrease upon terminal differentiation of several cell lines, including myoblasts, consistent with the idea that transcription from E box containing promoters is regulated by both activating and inhibitory transcription factors. Because no correlation is evident between the order of expression of the myogenic bHLH proteins and the appearance of specific contractile proteins (Ontell et al., 1993), it is possible that the presence of E type bHLH and inhibitory HLH proteins may participate in regulating myogenesis.

We have examined the effects of bHLH proteins on the activity of the muscle-specific cardiac -actin promoter. The first 440 bp of the human cardiac -actin promoter contains one E box, which is essential for cardiac -actin expression in skeletal muscle (Skerjanc and McBurney, 1994). MyoD transactivates the cardiac -actin promoter in transient transfection experiments (Pari et al., 1991; Sartorelli et al., 1990; Skerjanc and McBurney, 1994). We cloned cDNAs derived from mRNAs of two alternatively spliced forms of mouse ITF-2, termed MITF-2A and -2B. Neither MITF-2A nor -2B transactivated the cardiac -actin promoter. However, MITF-2B inhibited the transactivation of the cardiac -actin promoter by MyoD while MITF-2A did not.

MATERIALS AND METHODS

Polymerase Chain Reaction Amplification of ITF-2

Fragments of several bHLH cDNAs were amplified, subcloned, and sequenced, as described previously (Skerjanc and McBurney, 1994). The amplified cDNA fragment encoding ITF-2 encompasses the conserved bHLH domain and has the following sequence: AACACCGCCCGGGAGCGCCTGAGGGTCCGAGATATCAACGAGGCTTTCAAGGAGCTTGGCCGTATGGTGCAGCTCCACCTGAAGAGCGACAAGCCCCAGACCAAGCTCCTGATCCTCCACAACGCCGT.

The MITF-2 probes were prepared by replacing cold dCTP with 50 µCi of [-P]dCTP during a PCR amplification with 10 ng of the amplified MITF-2 cDNA fragment.

cDNA Library Construction and Screening

Standard procedures (Sambrook et al., 1989) were used to plate 500,000 plaques onto 10 150-mm plates. Plaques were transferred to Hybond-N and denatured by autoclaving for 2 min at 100 °C. DNA was cross-linked by UV irradiation, and the filters were hybridized for 16 h at 42 °C with the radiolabeled ITF-2 PCR product. Washing was performed for 30 min at room temperature in 2 SCC, 0.2% SDS and for 15 min at 65 °C in 0.2 SCC, 0.2% SDS. Hybridization was visualized by autoradiography. Ten positive plaques were identified from the 500,000 plaques screened, and six were isolated after three rounds of plaque purification.

ITF-2 Sequence Analysis

DNA sequence alignment was performed using DNASTAR software (DNASTAR Inc., Computer systems for molecular biology and genetics, Madison, WI). The two DNA sequences were aligned (Wilbur and Lipman, 1983) with k-tuple size of 3, range of 20, and gap penalty of 3. The similarity index is reported in Fig. 2.

Figure 2: Summary of the homologies between various E type bHLH cDNAs. The cDNAs are named in the left-hand column, while their sources are named in the right-hand column. Untranslated regions are indicated as gray boxes, the LH domain as a striped box, and the bHLH domain as a black box. Initiator methionine sequences and stop codons are shown as ATG and TGA, respectively. The nucleotide identity between the clone and MITF-2B is indicated in percent by the series of numbers in the boxes. The top seven cDNAs derive from the ITF-2 gene, while HEB and E12 are from different genes.

Plasmid Constructs

Cell Culture and Transfections

-Galactosidase and CAT assays were performed as described previously (Norton and Coffin, 1985; Sleigh, 1986). Each -galactosidase activity was normalized for transfection efficiency with the CAT activity from that transfected culture.

The P19[MyoD] cell line stably expresses MyoD and has been described previously (Skerjanc et al., 1994). Differentiation was induced by plating 5 10 P19 or P19[MyoD] cells into 60-mm bacterial dishes containing either 1 µM retinoic acid or 0.8% MeSO. Cells were cultured as aggregates for 5 days and then plated in tissue culture dishes and harvested for RNA on day 6. MeSO treatment under these conditions induces cardiac muscle in P19 cells and skeletal muscle in P19[MyoD] cells. Retinoic acid treatment induces neuroectoderm in P19 cells and a mixture of neuroectoderm and skeletal muscle in P19[MyoD] cells (Skerjanc et al., 1994).

RNase Protection

The RNase protection was performed as described in the RPA II kit (Ambion Inc.) by hybridizing 2.2 fmol of riboprobe with 5 µg of total sample RNA or 10 µg of torulla yeast RNA. Total RNA was isolated (Auffray and Rougeon, 1980) from P19 and P19[MyoD] cells on day 0 and on day 6 after treatment with MeSO and retinoic acid as well as from mouse brain, liver, heart, and leg muscle. After RNase digestion of the hybridized probe and sample RNAs, protected fragments were separated on a 5% polyacrylamide, 8 M urea gel and visualized by autoradiography.

To estimate the size of the bands protected from RNase digestion, the 1-kb ladder was labeled with [-P]ATP using the exchange reaction with bacteriophage T4 polynucleotide kinase, as described previously (Sambrook et al., 1989). The labeled 1-kb ladder was subjected to electrophoresis alongside the RNase protection samples. A graph of log molecular weight versus distance from the origin was used to determine the sizes of the RNase-resistant fragments. The calculated molecular weights agreed with the predicted molecular weights within an error of 10%.

RESULTS

Cloning Mouse ITF-2

Figure 1: Panel A, schematic outline of the relationship between the three cloned cDNAs and MITF-2A and MITF-2B. Untranslated regions are indicated as gray boxes, the LH domain as a striped box, and the bHLH domain as a black box. The RSRS domain is shown as a triangle in clone 1. The unique 5` sequence of MITF-2A is shown as a wavy line in clone 3 and as a boldface box in MITF-2A. Restriction sites used in subcloning are indicated. Panel B, the nucleotide and amino acid sequences of MITF-2B. The LH, RSRS, and bHLH domains are indicated by shaded areas between nucleotides 1532 and1741, 2160 and 2172, and 2222 and 2401. The position at which MITF-2A becomes identical to MITF-2B is shaded at nucleotide 1072. Amino acid residues are presented in capital letters using the single-letter code, and nucleotides are in small letters. Panel C, the unique 5` nucleotide and amino acid sequence of MITF-2A. The sequence of MITF-2A that is identical to MITF-2B is shaded, starting at nucleotide 60.

Clone 1 contains both upstream and downstream stop codons along with an open reading frame predicting a 670-amino acid protein. It has a truncated 3`-untranslated region, probably because the oligo(dT) cDNA primer initiated reverse transcription at an internal A-rich sequence. Clone 2 contains a partial coding region and an extended 3`-untranslated region. The nucleotide and amino acid sequence for clones 1 and 2 were designated MITF-2B and are shown in Fig. 1B.

Clone 3 also contains both upstream and downstream stop codons and an open reading frame identical to that of clone 1 except in two regions. The first 159 bp of clone 3 is different from that of clone 1 and predicts a protein with a different N terminus that we designated MITF-2A (Fig. 1C). In addition, clone 1 contained 12 nucleotides inserted 50 bp upstream of the bHLH domain that were absent from clones 2 and 3. These 12 nucleotides encode the four amino acids, RSRS, indicated in Fig. 1, A and B. Clones 1 and 3 contain an LH motif, which is the presumptive transcriptional activation domain (Quong et al., 1993).

Comparison of MITF-2 with Other E Type bHLH cDNAs

The RSRS sequence is found in three of the seven cDNAs from the ITF-2 gene and appears to derive from a mini-exon that may or may not be included.

The 3`-untranslated region of MITF-2A/B is about 1 kb longer than the sequences cloned previously. A remarkable sequence identity (93-95%) was found in the 3`-untranslated regions of ITF-2 from the different species. The 5` sequences are the least conserved with only 39-45% homology for SEF2-1A, B, and D with MITF-2B.

The extent of nucleic acid homology between the related but distinct gene products, HEB (Hu et al., 1992) and E12 (Nourse et al., 1990), with MITF-2B is also shown in Fig. 2. These cDNAs show less homology in the coding region (61-80%), with the greatest similarity in the bHLH domain. The 5`- and 3`-untranslated regions have very low homology (39-48%) with MITF-2B. Neither cDNA contains the RSRS domain.

Activity of MITF-2

Figure 3: MITF-2B inhibits MyoD activity. Panel A, MITF-2B, MITF-2B, and Id inhibit MyoD activity, while MITF-2A does not. P19 cells were transfected with 5 µg of the reporter construct CA-LacZ and 1 µg of the standardization reporter PGK-CAT, along with expression constructs encoding bHLH proteins. MyoD indicates the presence or absence of 1.5 µg of PGK-MyoD. The expression constructs for MITF-2A, MITF-2B, MITF-2B, and Id were present at concentrations of 1.5, 3, and 6 µg/transfection. Panel B, the inhibition of MyoD activity requires the N-terminal 83 amino acids of MITF-2B. P19 cells were co-transfected as in panel A with CA-LacZ, PGK-CAT, and PGK-MyoD along with 6 µg of plasmid containing the pgk-1 promoter driving the indicated construct. -Galactosidase activities were assayed and normalized for transfection efficiency against CAT activity and to the activity of the positive control (MyoD alone). Error bars represent standard error calculated from between three and 10 different experiments.

MITF-2A and -2B encode proteins identical but for two regions. The N termini are different, and MITF-2B contains the 4 amino acids, RSRS, just upstream of the bHLH domain. In order to determine which of these two regions is responsible for the MITF-2B inhibition of MyoD activity, the 12 bp encoding the RSRS sequence were removed from MITF-2B, in a construct called MITF-2B. MITF-2B, like MITF-2B, inhibited MyoD activity (Fig. 3A). Since MITF-2B is identical to MITF-2A in all regions except the first 182 amino acids, the inhibitory activity of MITF-2B must require the amino-terminal domain.

To further define the inhibitory domain, the first 83 amino acids of MITF-2B were deleted and replaced with six copies of the 11-amino acid c-myc epitope (Evan et al., 1985) creating Myc-MITF-2BN. As a control, this c-myc tag was fused to the N terminus of intact MITF-2B creating Myc-MITF-2B. The MyoD activation of the cardiac -actin promoter was reduced to 17% by MITF-2B but to only 78% by Myc-MITF-2BN (Fig. 3B). This suggests that the inhibitory domain resides in the first 83 amino acids of MITF-2B. The Myc-MITF-2B reduced promoter expression by an intermediate amount (47%), suggesting that the c-myc tag may interfere with the region near the N terminus that mediates transcriptional inhibition.

Id is thought to inhibit MyoD activity by forming inactive heterodimers with E type bHLH proteins, sequestering them away from MyoD (Benezra et al., 1990). In agreement with this model, an excess of E12 reversed the Id inhibition (Fig. 4). An excess of MITF-2A also reversed Id inhibition (Fig. 4), suggesting that E12 and MITF-2A can heterodimerize with Id and/or MyoD. However, neither E12 nor MITF-2A was able to reverse the inhibition created by MITF-2B (Fig. 4).

Figure 4: E12 and MITF-2A reverse the inhibition of MyoD activity by Id but not by MITF-2B. P19 cells were transfected as described in the legend to Fig. 3with and without 1.5 µg of PGK-MyoD, 1.5 µg of PGK-Id or PGK-MITF-2B, and 6 µg of PGK-E12 or PGK-MITF-2A, as indicated. Error bars represent standard error calculated from between four and 10 different experiments.

Distribution of MITF-2 Splice Products

We examined RNA from several cell types and tissues. We found that MITF-2B transcripts, indicated as the labeled band 1, were present in all cell types examined, including P19 stem cells (lane 1 and 2), P19-derived cardiac muscle (lane 3), P19[MyoD]-derived skeletal muscle (lane 4), P19- (lane 5), and P19[MyoD]- (lane 6) derived neuroectoderm, mouse brain (lane 7), mouse liver (lane 8), and mouse leg muscle and heart (data not shown). Protection of a riboprobe prepared from -actin cDNA indicated that all of the samples contained equal amounts of mRNA (Fig. 5B).

Figure 5: RNase protection demonstrates that MITF-2B is widely expressed. Radiolabeled antisense riboprobes for MITF-2B (panel A) or -actin (panel B) were hybridized to 5 µg of RNA from P19 stem cells (lane 1), P19[MyoD] stem cells (lane 2), P19-derived cardiac muscle (lane 3), P19[MyoD]-derived skeletal muscle (lane 4), P19-derived neuroectoderm (lane 5), P19[MyoD]-derived neuroectoderm and skeletal muscle (lane 6), mouse brain (lane 7), mouse liver (lane 8), and torulla yeast (lane 9). All samples were digested with RNase, except lane 10, which is a control for riboprobe integrity. Samples were separated by electrophoresis on an acrylamide/urea gel and visualized by autoradiography. The sizes of the bands, determined by comparison with a radiolabeled 1-kb ladder, are indicated on the right, and the corresponding cDNAs are indicated on the left.

The level of MITF-2A mRNA was variable in the samples analyzed. MITF-2A transcripts were present in all samples containing neurons (Fig. 5A lanes 5-7, band 5). Barely detectable levels were found in liver (Fig. 5A, lane 8, band 5) and the transcript was undetectable in P19 stem cells, P19-derived cardiac muscle and P19-derived skeletal muscle (Fig. 5A, lanes 1p4, band 5). Thus, MITF-2A seems to be expressed at high levels only in cells of the neuroectoderm lineage.

Band 3 appears to derive from MITF-2 transcript spliced to yield the D isoform represented by SEF2-1D (Fig. 2). This band was detected in all cell types and was elevated about 7-fold in brain tissue (lane 7).

Two additional bands, 2 and 4, were detected in all cells, representing MITF-2 transcripts with 5`-ends derived from as yet unidentified exons.

DISCUSSION

We cloned 3 cDNAs containing sequences encoding the bHLH region of the mouse ITF-2 protein. These cDNAs were derived from two alternatively spliced transcripts called MITF-2A and MITF-2B. Neither MITF-2A nor MITF-2B encoded a protein that by itself activated expression of the cardiac -actin promoter. In fact, the MITF-2B protein inhibited MyoD-induced expression from the cardiac -actin promoter, while the MITF-2A protein did not. The inhibitory activity of MITF-2B requires the first 83 amino acids at its amino terminus. The MITF-2A protein is a transcription activator because it activated cardiac -actin promoter expression when co-expressed in cells along with MyoD and Id. Thus, the MITF-2A and MITF-2B proteins arise from the same gene by differential splicing or different promoter usage and encode transcription factors that activate and repress expression, respectively.

Both MITF-2B and Id inhibited MyoD activity, but they appear to do so by different mechanisms. While the inhibitory activity of Id was effectively lost in the presence of excess E12 or MITF-2A, these latter two proteins were unable to reverse the inhibition of MITF-2B. We interpret our results as suggesting that Id inhibits primarily by sequestering the ``active'' E type proteins from MyoD, while MITF-2B seems to inhibit by forming stable heterodimers directly with MyoD.

Although we found that MITF-2B inhibited MyoD activation of the cardiac -actin promoter, human ITF-2 protein cooperated with MyoD to activate promoters containing an E box in COS cells (Lassar et al., 1991). The HITF-2 used in these experiments was encoded by a cDNA that was not full-length and contained a synthetic initiation codon resulting in a protein, which lacked 49 amino acids from the N terminus when compared with MITF-2B. Since the inhibitory activity of MITF-2B resides in the N-terminal 83 amino acids, the critical inhibitory domain may be absent from the HITF-2 used in these experiments. Alternatively, P19 stem cells may contain a different complement of bHLH proteins to those in COS cells, resulting in inhibition by ITF-2 in one system and activation in the other. Evidence that the two cell types contain different bHLH proteins derives from the finding that MyoD transfected alone is not active in COS cells but is active in P19 cells (Lassar et al., 1991; Pari et al., 1991; Skerjanc and McBurney, 1994).

Other transcription factors are alternatively spliced to create one form that activates and another form that inhibits transcription. However, the splicing usually involves the removal of an activation domain, resulting in a shorter form, which is an inhibitor, and a longer form, which is an activator. For example, FosB undergoes alternative splicing to remove a C-terminal transcriptional activation domain, creating FosB, which is a transcriptional repressor (for review, see Foulkes and Sassone-Corsi(1992)). TFE3 is a bHLH leucine zipper transcription factor that binds to the intronic enhancer of the immunoglobulin heavy chain gene. Alternative splicing at the N terminus removes the first 105 nucleotides and creates an inhibitor of transcription (Roman et al., 1991). Finally, the retinoic acid receptors 1 and 2 undergo alternative splicing in which different N-terminal amino acids produce transcriptional repressors or activators (Husmann et al., 1991).

Apart from differences at their 5`-ends, cDNAs from mouse and human ITF-2 may or may not contain a 12-bp sequence in the coding region 50 bp upstream of the bHLH domain. These 12 bp encode the 4 amino acids RSRS, but the role, if any, of this tetrapeptide in MITF-2 activity remains unclear.

The transcripts encoding MITF-2A and MITF-2B appear to be present in most cell types and tissues investigated, making it difficult to deduce the roles of these transcription factors in regulating expression of E box containing genes. Given that many transcription factors are regulated post-transcriptionally, such as by phosphorylation or protein turnover, it seems possible that the inhibitory and activation effects of MITF-2 isoforms might be subject to additional means of modulation.

FOOTNOTES

*

This work was supported by grants from the Muscular Dystrophy Association of Canada (to M. W. M.) and from the Medical Research Council of Canada (to I. S. S.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank(TM)/EMBL Data Bank with accession number(s) U16321 [GenBank]and U16322[GenBank].

§

Supported by a National Cancer Institute of Canada senior postdoctoral fellowship and a Medical Research Council of Canada Scholarship (development grant). To whom correspondence should be addressed. Tel.: 519-679-2111 (ext. 6867); Fax: 519-661-3175; skerjanc{at}julian.uwo.ca.

¶

A Terry Fox Cancer Research Scientist of the National Cancer Institute of Canada.

()

The abbreviations used are: bHLH, basic helix-loop-helix; bp, base pair(s); PCR, polymerase chain reaction; PGK, phosphoglycerate kinase; CAT, chloramphenicol acetyltransferase.

ACKNOWLEDGEMENTS

REFERENCES

1. Adra, C. N., Boer, P. H., and McBurney, M. W. (1987) Gene (Amst.) 60, 65-74
2. Auffray, C., and Rougeon, F. (1980) Eur. J. Biochem. 107, 303-314 [Medline] [Order article via Infotrieve]
3. Benezra, R., Davis, R. L., Lockshon, D., Turner, D. L., and Weintraub, H. (1990) Cell 61, 49-59 [CrossRef][Medline] [Order article via Infotrieve]
4. Braun, T., Buschhausen-Denker, G., Bober, E., Tannich, E., and Arnold, H. H. (1989) EMBO J. 8, 701-709 [Medline] [Order article via Infotrieve]
5. Braun, T., Bober, E., Winter, B., Rosenthal, N., and Arnold, H. H. (1990) EMBO J. 9, 821-831 [Medline] [Order article via Infotrieve]
6. Chen, C., and Okayama, H. (1987) Mol. Cell. Biol. 7, 2745-2752 [Abstract/Free Full Text]
7. Chen, Q., Cheng, J.-T., Tsai, L., Schneider, N., Buchanan, G., Carroll, A., Crist, W., Ozanne, B., Siciliano, M. J., and Baer, R. (1990) EMBO J. 9, 415-424 [Medline] [Order article via Infotrieve]
8. Corneliussen, B., Thornell, A., Hallberg, B., and Grundstrom, T. (1991) J. Virol. 65, 6084-6093 [Abstract/Free Full Text]
9. Davis, R. L., Weintraub, H., and Lassar, A. B. (1987) Cell 51, 987-1000 [CrossRef][Medline] [Order article via Infotrieve]
10. Edmondson, D. G., and Olson, E. N. (1989) Genes & Dev. 3, 628-640
11. Evan, G. I., Lewis, G. K., Ramsay, G., and Bishop, J. M. (1985) Mol. Cell. Biol. 5, 3610-3616 [Abstract/Free Full Text]
12. Foulkes, N. S., and Sassone-Corsi, P. (1992) Cell 68, 411-444 [CrossRef][Medline] [Order article via Infotrieve]
13. Henthorn, P., Kiledjian, M., and Kadesch, T. (1990a) Science 247, 467-70 [Abstract/Free Full Text]
14. Henthorn, P., McCarrick-Walmsley, R., and Kadesch, T. (1990b) Nucleic Acids Res. 18, 677 [Free Full Text]
15. Hsu, H.-L., Cheng, J.-T., Chen, Q., and Baer, R. (1991) Mol. Cell. Biol. 11, 3037-3042 [Abstract/Free Full Text]
16. Hu, J.-S., Olson, E. N., and Kingston, R. E. (1992) Mol. Cell. Biol. 12, 1031-1042 [Abstract/Free Full Text]
17. Husmann, M., Lehmann, J., Hoffmann, B., Hermann, T., Tzukerman, M., and Pfahl, M. (1991) Mol. Cell. Biol. 11, 4097-4103 [Abstract/Free Full Text]
18. Javaux, F., Donda, A., Vassart, G., and Christophe, D. (1991) Nucleic Acids Res. 19, 1121-1127 [Abstract/Free Full Text]
19. Johnson, J. E., Birren, S. J., and Anderson, D. J. (1990) Nature 346, 858-861 [CrossRef][Medline] [Order article via Infotrieve]
20. Kraft, R., Tardiff, J., Drauter, K. S., and Leinwand, L. A. (1988) BioTechniques 6, 544-546 [Medline] [Order article via Infotrieve]
21. Lassar, A. B., Buskin, J. N., Lockshon, D., Davis, R. L., Apone, S., Hauschka, S. D., and Weintraub, H. (1989) Cell 58, 823-831 [CrossRef][Medline] [Order article via Infotrieve]
22. Lassar, A. B., Davis, R. L., Wright, W. E., Kadesch, T., Murre, C., Voronova, A., Baltimore, D., and Weintraub, H. (1991) Cell 66, 305-15 [CrossRef][Medline] [Order article via Infotrieve]
23. Mellentin, J. D., Murre, C., Donlon, T. A., McCaw, P. S., Smith, S. D., Carroll, A. J., McDonald, M. E., Baltimore, D., and Cleary, M. L. (1989) Science 246, 379-382 [Abstract/Free Full Text]
24. Miner, J. H., and Wold, B. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 1089-1093 [Abstract/Free Full Text]
25. Murre, C., McCaw, P. S., and Baltimore, D. (1989a) Cell 56, 777-783 [CrossRef][Medline] [Order article via Infotrieve]
26. Murre, C., McCaw, P. S., Vaessin, H., Caudy, M., Jan, L. Y., Jan, Y. N., Cabrera, C. V., Buskin, J. N., Hauschka, S. D., Lassar, A. B., Weintraub, H., and Baltimore, D. (1989b) Cell 58, 537-544 [CrossRef][Medline] [Order article via Infotrieve]
27. Norton, P. A., and Coffin, J. M. (1985) Mol. Cell. Biol. 5, 281-290 [Abstract/Free Full Text]
28. Nourse, J., Mellentin, J. D., Galili, N., Wilkinson, J., Stanbridge, E., Smith, S. D., and Cleary, M. L. (1990) Cell 60, 535-545 [CrossRef][Medline] [Order article via Infotrieve]
29. Olson, E. N. (1990) Genes & Dev. 4, 1454-1461
30. Ontell, M., Ontell, M. P., Sopper, M. M., Mallonga, R., Lyons, G., and Buckingham, M. (1993) Development 117, 1435-1444 [Abstract]
31. Pari, G., Jardine, K., and McBurney, M. W. (1991) Mol. Cell. Biol. 11, 4796-4803 [Abstract/Free Full Text]
32. Quong, M. W., Massari, M. E., Zwart, R., and Murre, C. (1993) Mol. Cell. Biol. 13, 792-800 [Abstract/Free Full Text]
33. Rhodes, S. J., and Konieczny, S. F. (1989) Genes & Dev. 3, 2050-2061
34. Roman, C., Cohn, L., and Calame, K. (1991) Science 254, 94-97
35. Rudnicki, M. A., and McBurney, M. W. (1987) in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach (Robertson, E. J. ed) pp. 19-49, IRL Press, Oxford, United Kingdom
36. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
37. Sartorelli, V., Webster, K. A., and Kedes, L. (1990) Genes & Dev. 4, 1811-1822
38. Sassoon, D. A. (1993) Dev. Biol. 156, 11-23 [CrossRef][Medline] [Order article via Infotrieve]
39. Skerjanc, I. S., Slack, R. S., and McBurney, M. W. (1994) Mol. Cell. Biol. 14, 8451-8459 [Abstract/Free Full Text]
40. Skerjanc, I. S., and McBurney, M. W. (1994) Dev. Biol. 163, 125-132 [CrossRef][Medline] [Order article via Infotrieve]
41. Sleigh, M. J. (1986) Anal. Biochem. 156, 251-256 [CrossRef][Medline] [Order article via Infotrieve]
42. Voronova, A. F., and Lee, F. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 5952-5956 [Abstract/Free Full Text]
43. Weintraub, H., Davis, R., Tapscott, S., Thayer, M., Krause, M., Benezra, R., Blackwell, T. K., Turner, D., Rupp, R., and Hollenberg, S., Zhuang, Y., and Lassar, A. (1991) Science 251, 761-6 [Abstract/Free Full Text]
44. Wilbur, W. J., and Lipman, D. J. (1983) Proc. Natl. Acad. Sci. U. S. A. 56, 607-617
45. Wright, W. E., Sassoon, D. A., and Lin, V. K. (1989) Cell 56, 607-617 [CrossRef][Medline] [Order article via Infotrieve]
46. Xia, Y., Brown, L., Yang, C. Y.-C., Tsan, J. T., Siciliano, M. J., Espinosa, R., III, Le Beau, M. M., and Baer, R. J. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 11416-11420 [Abstract/Free Full Text]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				V. R. Sobrado, G. Moreno-Bueno, E. Cubillo, L. J. Holt, M. A. Nieto, F. Portillo, and A. Cano The class I bHLH factors E2-2A and E2-2B regulate EMT J. Cell Sci., April 1, 2009; 122(7): 1014 - 1024. [Abstract] [Full Text] [PDF]

				K. B. Laursen, E. Mielke, P. Iannaccone, and E.-M. Fuchtbauer Mechanism of Transcriptional Activation by the Proto-oncogene Twist1 J. Biol. Chem., November 30, 2007; 282(48): 34623 - 34633. [Abstract] [Full Text] [PDF]

				G. Moreno-Bueno, E. Cubillo, D. Sarrio, H. Peinado, S. M. Rodriguez-Pinilla, S. Villa, V. Bolos, M. Jorda, A. Fabra, F. Portillo, et al. Genetic Profiling of Epithelial Cells Expressing E-Cadherin Repressors Reveals a Distinct Role for Snail, Slug, and E47 Factors in Epithelial-Mesenchymal Transition Cancer Res., October 1, 2006; 66(19): 9543 - 9556. [Abstract] [Full Text] [PDF]

				D. Wang, C. L. Claus, G. Vaccarelli, M. Braunstein, T. M. Schmitt, J. C. Zuniga-Pflucker, E. V. Rothenberg, and M. K. Anderson The Basic Helix-Loop-Helix Transcription Factor HEBAlt Is Expressed in Pro-T Cells and Enhances the Generation of T Cell Precursors J. Immunol., July 1, 2006; 177(1): 109 - 119. [Abstract] [Full Text] [PDF]

				T. Muir, I. Sadler-Riggleman, and M. K. Skinner Role of the Basic Helix-Loop-Helix Transcription Factor, Scleraxis, in the Regulation of Sertoli Cell Function and Differentiation Mol. Endocrinol., August 1, 2005; 19(8): 2164 - 2174. [Abstract] [Full Text] [PDF]

				J.-i. Hikima, C. C. Cioffi, D. L. Middleton, M. R. Wilson, N. W. Miller, L. W. Clem, and G. W. Warr Evolution of Transcriptional Control of the IgH Locus: Characterization, Expression, and Function of TF12/HEB Homologs of the Catfish J. Immunol., November 1, 2004; 173(9): 5476 - 5484. [Abstract] [Full Text] [PDF]

				J. Kaput, K. G. Klein, E. J. Reyes, W. A. Kibbe, C. A. Cooney, B. Jovanovic, W. J. Visek, and G. L. Wolff Identification of genes contributing to the obese yellow Avy phenotype: caloric restriction, genotype, diet x genotype interactions Physiol Genomics, August 11, 2004; 18(3): 316 - 324. [Abstract] [Full Text] [PDF]

				A. Pagliuca Cancer Res., March 1, 2000; 60(5): 1376 - 1382.

				F. Lin, D. L. Blake, I. Callebaut, I. S. Skerjanc, L. Holmer, M. W. McBurney, M. Paulin-Levasseur, and H. J. Worman MAN1, an Inner Nuclear Membrane Protein That Shares the LEM Domain with Lamina-associated Polypeptide 2 and Emerin J. Biol. Chem., February 18, 2000; 275(7): 4840 - 4847. [Abstract] [Full Text] [PDF]

				T. Ueba, B. Kaspar, X. Zhao, and F. H. Gage Repression of Human Fibroblast Growth Factor 2 by a Novel Transcription Factor J. Biol. Chem., April 9, 1999; 274(15): 10382 - 10387. [Abstract] [Full Text] [PDF]

				Y. Liu, S. K. Ray, X.-Q. Yang, V. Luntz-Leybman, and I.-M. Chiu A Splice Variant of E2-2 Basic Helix-Loop-Helix Protein Represses the Brain-specific Fibroblast Growth Factor 1 Promoter through the Binding to an Imperfect E-box J. Biol. Chem., July 24, 1998; 273(30): 19269 - 19276. [Abstract] [Full Text] [PDF]

				A. Pagliuca, P. Cannada-Bartoli, and L. Lania A Role for Sp and Helix-Loop-Helix Transcription Factors in the Regulation of the Human Id4 Gene Promoter Activity J. Biol. Chem., March 27, 1998; 273(13): 7668 - 7674. [Abstract] [Full Text] [PDF]

				K. Langlands, X. Yin, G. Anand, and E. V. Prochownik Differential Interactions of Id Proteins with Basic-Helix-Loop-Helix Transcription Factors J. Biol. Chem., August 8, 1997; 272(32): 19785 - 19793. [Abstract] [Full Text] [PDF]

				B. Chen and R. W. Lim Physical and Functional Interactions between the Transcriptional Inhibitors Id3 and ITF-2b. EVIDENCE TOWARD A NOVEL MECHANISM REGULATING MUSCLE-SPECIFIC GENE EXPRESSION J. Biol. Chem., January 24, 1997; 272(4): 2459 - 2463. [Abstract] [Full Text] [PDF]

				N. T. Eissa, A. J. Strauss, C. M. Haggerty, E. K. Choo, S. C. Chu, and J. Moss Alternative Splicing of Human Inducible Nitric-Oxide Synthase mRNA. TISSUE-SPECIFIC REGULATION AND INDUCTION BY CYTOKINES J. Biol. Chem., October 25, 1996; 271(43): 27184 - 27187. [Abstract] [Full Text] [PDF]

				H. Petropoulos and I. S. Skerjanc Analysis of the Inhibition of MyoD Activity by ITF-2B and Full-length E12/E47 J. Biol. Chem., August 11, 2000; 275(33): 25095 - 25101. [Abstract] [Full Text] [PDF]

				A. G. Ridgeway, H. Petropoulos, S. Wilton, and I. S. Skerjanc Wnt Signaling Regulates the Function of MyoD and Myogenin J. Biol. Chem., October 13, 2000; 275(42): 32398 - 32405. [Abstract] [Full Text] [PDF]

				M. Furumura, S. B. Potterf, K. Toyofuku, J. Matsunaga, J. Muller, and V. J. Hearing Involvement of ITF2 in the Transcriptional Regulation of Melanogenic Genes J. Biol. Chem., July 20, 2001; 276(30): 28147 - 28154. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Skerjanc, I. S. Articles by McBurney, M. W. Search for Related Content PubMed PubMed Citation Articles by Skerjanc, I. S. Articles by McBurney, M. W. Social Bookmarking                      What's this?