|
|
|
|||||||
|
|||||||||
(Received for publication, August 4,
1995; and in revised form, October 13, 1995) From the
Paneth cells, secretory epithelial cells of the small intestinal
crypts, are proposed to contribute to local host defense. Both mouse
and human Paneth cells express a collection of antimicrobial proteins,
including members of a family of antimicrobial peptides named
defensins. In this study, data from an anchored polymerase chain
reaction (PCR) strategy suggest that only two defensin mRNA isoforms
are expressed in the human small intestine, far fewer than the number
expressed in the mouse. The two isoforms detected by this PCR approach
were human defensin family members, HD-5 and HD-6.
The gene encoding HD-6 was cloned and characterized. HD-6 has a genomic organization similar to HD-5, and the two
genes have a striking pattern of sequence similarity localized chiefly
in their proximal 5`-flanking regions. Analysis of human fetal RNA by
reverse transcriptase-PCR detected enteric defensin HD-5 mRNA
at 13.5 weeks of gestation in the small intestine and the colon, but by
17 weeks HD-5 was restricted to the small intestine. HD-6 mRNA was detectable at 13.5-17 weeks of gestation in the
small intestine but not in the colon. This pattern of expression
coincides with the previously described appearance of Paneth cells as
determined by ultrastructural approaches. Northern analysis of total
RNA from small intestine revealed quantifiable enteric defensin mRNA in
five samples from 19-24 weeks of gestation at levels
approximately 40-250-fold less than those observed in the adult,
with HD-5 mRNA levels greater than those of HD-6 in
all samples. In situ hybridization analysis localized
expression of enteric defensin mRNA to Paneth cells at 24 weeks of
gestation, as is seen in the newborn term infant and the adult.
Consistent with earlier morphological studies, the ratio of Paneth cell
number per crypt was reduced in samples at 24 weeks of gestation
compared with the adult, and this lower cell number partially accounts
for the lower defensin mRNA levels as determined by Northern analysis.
Low levels of enteric defensin expression in the fetus may be
characteristic of an immaturity of local defense, which is thought to
predispose infants born prematurely to infection from intestinal
microorganisms.
During human fetal organogenesis the intestine undergoes a
dramatic transformation, characterized by morphological changes of
mucosal epithelial cells and the establishment of a crypt/villus axis (1) . Once the epithelium of the small intestine is mature,
there is continuous cellular renewal, with evidence of all epithelial
cell types arising from common progenitor stem cells(2) . This
dynamic epithelium has many physiological functions, including a role
in host defense. Of the epithelial cell types, Paneth cells, intensely
eosinophilic cells located at the bases of intestinal crypts, have
ultrastructural hallmarks of secretory cells and are most abundant in
the ileum(3, 4, 5, 6) . Several
lines of evidence suggest that an important physiological role of
Paneth cells is the synthesis of host defense effector molecules such
as lysozyme(7, 8, 9) , phospholipase
A2(10, 11, 12) , and antimicrobial
peptides(13, 14, 15, 16, 17, 18, 19) . Antimicrobial peptides are a prevalent mechanism of host defense
utilized by phylogenetically diverse animal species, from insects to
humans (for reviews see (20, 21, 22) ).
Defensins are a large family of antimicrobial peptides, identified
originally in leukocytes of rabbits and humans (for reviews see (23) ). These cationic peptides are 30-35 amino acids in
length and are distinguished by a conserved cysteine
motif(23) . Defensins are membrane active and have microbicidal
activity toward a wide range of microorganisms in
vitro(23) . In leukocytes, these peptides are stored in
cytoplasmic granules and are released into phagolysosomes where they
contribute to the killing of engulfed microorganisms(24) . More recently, molecular studies have identified a distinct group of
enteric defensin genes expressed in Paneth cells of the
mouse(13, 25) and humans(18, 19) .
In the mouse, there is evidence for the expression of 16 or more
defensin genes in the small intestine(26) , whereas only two
human homologues have been identified at this
site(18, 19) . Mature enteric defensin peptides have
been isolated from the murine small bowel, but the homologous human
peptides have not yet been isolated (15, 16, 17, 26) . The murine
peptides were found to have antibiotic activity comparable with the
previously isolated myeloid counterparts from other species. Activity
of two mouse enteric defensins against the intestinal parasite Giardia lamblia was also reported (27) . It has
been suggested that immaturity of local intestinal defenses may
contribute to the increased susceptibility of neonates to infections
from luminal flora and to necrotizing
enterocolitis(28, 29) . Therefore, we sought to more
clearly characterize defensin expression in Paneth cells of the human
small intestine, with a focus on fetal expression. We observed that
defensin expression coincides temporally with Paneth cell detectability
and may be a useful marker of these cells. The developmental profile
observed suggests that low level defensin expression in fetal
development may be characteristic of immature enteric mucosal defense.
This work also addresses the number of defensin isoforms expressed in
human intestine and characterizes the genomic structure of the enteric
defensin gene HD-6. Reagents and general methodology for cloning, sequencing,
probe labeling, and PCR amplification were described(18) .
Human fetal intestinal tissue from second trimester abortuses was
obtained and used in accordance with guidelines established by the
Institutional Review Board at The Children's Hospital of
Philadelphia and with permission from the Central Oxford Research
Ethics Committee. Sequence data were analyzed using MacVector software
(IBI, New Haven, CT).
Figure 3:
3` RACE analysis of defensin cDNA in human
small bowel. A, nucleotide sequences of the PCR primers DEF15s
and DEF15sI aligned with defensin sequences from human, guinea pig,
mouse, rat, and rabbit. The vertical lines indicate identity. B, anchored RT-PCR products from human intestinal RNA using
either DEF15s (15s) or DEF15sI (15sI) as an upstream PCR primer were
analyzed by agarose gel electrophoresis and ethidium bromide detection.
The molecular size standard (M) phiX174 digested with HaeIII. C, dot blot of 78 samples of plasmid DNA from
recombinant clones containing RACE-PCR products hybridized with a
The following gene-specific primers were
used: 1) for HD-5, DEF5a (CCCAGCCATGAGGACCATCG) and DEF5b
(TCTATCTAGGAAGCTCAGCG), generating a 304-bp product; 2) for HD-6, primers HD-6/102s (CCACTCCAAGCTGAGGATGATC) and HD-6/405a
(TGATGGCAATGTATGGGACACACAC), generating a 326-bp product; and 3) for
Northern analysis was performed
as described(18, 19) . For HD-6 mRNA
detection, HSIB-309a was employed, and for HD-5, HSIA-309a was
used. In parallel, nylon membranes spotted with plasmid DNA containing
inserts encoding HD-5 and HD-6 were hybridized and
washed simultaneously with the Northern blot filters to control for
stringency. The control glyceraldehyde-3-phosphate dehydrogenase probe
was hybridized using an identical hybridization solution at 42 °C,
and the conditions of the final wash were 0.1
Figure 1:
Nucleotide sequence of HD-6 gene and flanking regions. A, a partial restriction map
of HD-6 and flanking sequences. Pst, PstI; Bam, BamHI; Hin, HindIII. The thickened lines show the positions of both exons (exon 1, 211
bases; exon 2, 229 bases) that flank a 914-base intron. B, the
nucleotide sequence of HD-6 and flanking regions. Numbering
begins arbitrarily at the most 5` nucleotide of the sequence. Exon
sequences are shown in uppercase letters, and the deduced
amino acid sequence of the coding region is shown in three-letter code.
The TATA box and CAAT box are underlined. The consensus splice
junction residues are shown in bold. The polyadenylation
signal is boxed. The Genbank accession number for the HD-6 genomic sequence is U33317.
Comparison
of the genomic (Fig. 1) and the HD-6 cDNA sequences (19) indicated that the gene consists of two exons, separated
by a 914-bp intron. The nucleotide sequence of the putative exons in
the genomic clone are in complete agreement with those in the cDNA
sequence. There are consensus sequences for splice junctions (Fig. 1, bold) and polyadenylation (Fig. 1, boxed). There is a TATA box at nucleotides 1341-1347,
beginning 28 nucleotides upstream from the 5` terminus of the two most
extended cDNAs identified by RACE-PCR (see below, Fig. 1, underlined). A CAAT box is seen at position 1278-1283 (Fig. 1, underlined). In order to define the 5`
transcription start site of the HD-6 gene, small intestinal
cDNA (18) was amplified using the 5` RACE-PCR
technique(32) . The downstream primer (HSIB-309a) was chosen
from the second exon, and the upstream primer was complementary to the
anchor sequence. Amplified products were subcloned and sequenced. The
amplified cDNA sequence was identical to the corresponding region of
the genomic sequence (data not shown). Four products were found to
extend 5` to the putative initiating methionine codon. Three of these
terminated 41 nucleotides upstream of the methionine codon. This site
of transcription initiation is designated +1. The fourth RACE
product terminated at +3 and may represent a minor site of
transcription initiation or a premature termination of the reverse
transcriptase. The identical termination points of products 1-3
indicate that this is the major transcription start site. A dot
matrix analysis of nucleotide similarity of HD-5 and HD-6 is shown in Fig. 2A. Various degrees of sequence
identity were seen along a diagonal throughout the entire gene
sequences. The most striking identity was observed in the proximal 5`
region encompassing the first half of exon 1 and nucleotides of the
proximal 5`-flanking region (Fig. 2B). Several
consensus sequences corresponding to transcription factor binding sites
were identified in the flanking region, including two AP2 sites (38) (-784 and -1344) and six nuclear factor
interleukin-6 sites (39) (-244, -305, -650,
-788, -863, and -1292). Several of these sites are
found in the same location within the HD-5 flanking region,
such as AP2(-781) and nuclear factor interleukin-6 (-651
and -1284), suggesting these sites may prove to be functionally
significant. (
Figure 2:
Gene sequence analysis. A, a
Pustell analysis of human enteric defensin genes HD-5 and HD-6. Sequence similarity was analyzed using a window of 14
nucleotides and was scored positive for a match of 10 of 14 (hash value
= 1). A nearly identical pattern of nucleotide similarity was
obtained when the analysis was scored positive for a match of 9 of 14,
although the background was higher (data not shown). The axes indicate
the approximate position of the exons (solid boxes) and show
the major sites of transcription initiation (arrows). The
approximate positions of transcription initiation and the putative
translation start codons are shown on the diagonal by arrows. Regions 1, 2, and 3 highlighted by arrows are
highly conserved between HD-5 and HD-6, as shown in B. B, nucleotide similarity of 5`-flanking regions of HD-5 (top sequence) and HD-6 (bottom
sequence). The sequences were aligned for maximal sequence
identity. Regions of particularly striking identity are underlined. The major site of transcription initiation defined
by 5` RACE analysis for HD-6 and HD-5(18) is
indicated with an arrow. The TATA and CAT box sequences are boxed.
Figure 4:
RT-PCR analysis of HD-5 and HD-6 expression in fetal intestine. RT-PCR products from human
intestinal RNA samples were analyzed by agarose gel electrophoresis and
ethidium bromide detection. A, HD-5 expression
detected as a 304-bp cDNA fragment after RT-PCR using amplification of
a 572-bp cDNA fragment from
Total RNA
isolated from fetal specimens of distal small intestine ranging in
gestational age from 19 to 24 weeks and from adult small intestine was
analyzed by Northern blot hybridization (Fig. 5). The blot was
probed sequentially with antisense oligonucleotide probes specific for HD-5 (HSIA-309a) and HD-6 (HSIB-309a). To control for
possible cross-hybridization of the defensin probes under the
experimental conditions, a slot blot containing HD-5 and HD-6 clones was hybridized and washed under the same
conditions as the Northern blot. Specific hybridization was observed
with both of the defensin probes. PhosphorImager analysis of the
Northern blot indicated that approximately 40 times more HD-5 mRNA is detectable in the adult than in the 24-week fetal sample
shown in Fig. 5. 3-6-fold less mRNA is detectable in the
other specimens on this blot. RNA from a second specimen at 24 weeks of
gestation showed lower levels than those in the first sample,
comparable with the 21-week sample (data not shown). The relative ratio
of HD-5 to HD-6 was estimated to be approximately
3:1, similar to that found in the 3` RACE analysis with DEF15sI.
Defensin mRNA from specimens at earlier gestational ages was not
detectable by Northern blot analysis under these conditions (data not
shown).
Figure 5:
Northern blot analysis of small intestinal
RNA from fetal and adult specimens. Total RNA (20 µg) from the
distal half of fetal small intestine obtained at indicated gestational
ages and RNA (0.8, 4.0, and 20 µg) from adult small intestine were
fractionated by formaldehyde-agarose gel electrophoresis, blotted to a
nylon filter, and hybridized sequentially to indicated probes. Ethidium
bromide staining indicated essentially equivalent RNA in each of the
fetal samples (not shown). A, hybridization with the HD-6 probe HSIB309a. A slot blot containing plasmid DNA with HD-5 and HD-6 cDNA inserts was simultaneously hybridized and
washed to control for conditions of stringency (see ``Materials
and Methods''). Autoradiographic exposure at -70 °C with
an intensifying screen was 2 weeks for the Northern blots and 2 days
for the slot blot controls. The Northern blot was then stripped of
probe under high stringency and re-exposed prior to use in subsequent
experiments. B, hybridization of the same filter with the HD-5 probe HSIA309a under the same conditions as in A. C, hybridization of the same filter with a
glyceraldehyde-3-phosphate dehydrogenase cDNA probe under similar
conditions as above except that the hybridization temperature was 42
°C and the final wash was at in 0.1
Figure 6:
Detection of HD-5 and HD-6 mRNA in the Paneth cells of the small intestine by in situ hybridization. Paraffin-embedded sections of fetal (24-weeks
gestational age; A, D, and G), newborn (B, E, and H), and adult (C, F, and I) ileum were hybridized with HD-5 and HD-6 riboprobes labeled with
[
Comparison of the
nucleotide sequence of HD-5 and HD-6 shows an unusual
and very striking pattern of similarity, with two testable hypotheses
emerging from this observation. First, the high similarity across 850
nucleotides of flanking region suggests that cis-elements important in
tissue specific and developmentally regulated expression of these genes
might be found in this region. Transgenic studies using 6.5 kilobases
of 5`-flanking DNA from a mouse enteric defensin gene ligated to a
reporter gene showed expression largely restricted to Paneth cells in
mature intestinal crypts(47) . It is possible that the
information necessary for tissue-specific expression is located in the
proximal region where we observe high nucleotide identity. Second, the
presence of several nuclear factor interleukin-6 recognition sequences (39) throughout the 5`-flanking region offers a rationale to
test if constitutive levels of defensin gene expression in the bowel
are up-regulated in response to inflammation. Certain members of
another group of mammalian antibiotic peptides, the
Northern analysis
detected enteric defensin mRNA in the second trimester of gestation at
levels approximately 40-250-fold less than those observed in the
adult (Fig. 5). Because of the difficulty in establishing
gestational ages with precision at this stage of development, we
interpret the variability in our Northern blot analysis with some
caution. We conclude conservatively that readily quantifiable enteric
defensin mRNA accumulates in the latter part of the mid-trimester but
at levels much lower than found in adults. In situ hybridization analysis localized the expression of enteric
defensin mRNA to Paneth cells (Fig. 6) and suggests that fewer
numbers of Paneth cells in the fetal crypts, as compared with the
newborn and adult, account for part of the lower level of enteric mRNA
observed (Fig. 6, A versus B and C and D
versus E and F). Our data are consistent with anatomic
data showing lower numbers of Paneth cells in crypts of the mouse at
early gestational ages(47, 53) .
In the mouse, there is evidence for expression of 16
defensin-encoding mRNAs(26) . The six characterized murine
enteric defensin genes (25) all have very high overall
nucleotide similarity (85%), suggesting gene duplication events that
occurred relatively recently in evolution. The data reported here (Fig. 3), consistent with previous data from screening of a
phage cDNA library(18) , suggest that only two defensin genes, HD-5 and HD-6, are expressed in human small
intestine. These two genes are not as closely related (Fig. 2A) as those in the mouse(25) ,
consistent with duplication and subsequent divergence much earlier in
evolution.
An immaturity of specific and nonspecific
effectors of the immune response is thought to predispose premature
infants to infection. For example, necrotizing enterocolitis is an
illness that causes substantial morbidity and mortality among premature
infants yet is uncommon in term
newborns(28, 41, 43) . Histologically,
necrotizing enterocolitis is characterized by inflammation and necrosis
at affected sites. The etiology appears to be multifactorial, and a
likely central feature is clinical infection caused by microbes
colonizing the intestinal tract. It has been proposed that
characteristics of an immature gastrointestinal tract lead to the
development of necrotizing enterocolitis(28, 43) . Our
results demonstrate very low level expression of defensin by the fetal
intestine through 24 weeks of gestation, the lower limit of
extrauterine viability. Limited expression of intestinal defensins by
the fetus might, therefore, place a preterm infant at risk for
bacterial invasion of the intestine and possibly the development of
necrotizing enterocolitis. Future studies will be needed to define the
biological activities of the human enteric defensins, to determine if
levels of defensin expression are altered following premature birth,
and to define the possible role of enteric defensins in the
pathophysiology of necrotizing enterocolitis.
The nucleotide
sequence(s) reported in this paper has been submitted to the
GenBank(TM)/EMBL Data Bank with accession number(s)
U33317[GenBank].
Volume 271,
Number 8,
Issue of February 23, 1996 pp. 4038-4045
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
GENE STRUCTURE AND DEVELOPMENTAL EXPRESSION (*)
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
Genomic Cloning
The primary screen of a human genomic
library (FIX phage vector, 944201, Stratagene) was conducted at a
phage density of 50,000 plaques/150-mm diameter plate using 24 plates.
Nylon filter lifts (Colony/Plaque Screen, DuPont NEN) were hybridized
with
P-labeled HSIB-309a
(TCATCCCTCAGAGGCAGCAGAATCTGTGGTTAATACCCATGACAGTGC) in 25% formamide, 5
SSC (1 SSC = 0.15 M NaCl, 0.15 M sodium citrate, pH 7.0), 1 Denhardt's, 100 µg/ml
yeast RNA, and 1% SDS at 42 °C overnight. The filters were
subjected to a stringency wash in 2 SSC/0.1% SDS at 65 °C
for h. Positive clones identified by autoradiography were purified by
additional screens at lower density. Phage insert DNA from positive
clones was subcloned into the multiple cloning site of pBluescript II
SK+ plasmid for further analysis as described(18) .3` Rapid Amplification of cDNA Ends Analysis
Total
RNA from adult human small intestine (full-length) was obtained from a
commercial source (Clontech, Palo Alto, CA). Single-strand cDNA
synthesis employed a modified oligo(dT) primer
(CCTCTGAAGGTTCCAGAATCGATAGGAATTC(T)
(G/C/A)(G/C/A/T), 3`
Amplifinder, Clontech) according to the supplier's recommended
modification of published methods(30) . The cDNA product was
used as a template in a PCR (
)with an anchor primer
(CTGGTTCGGCCCACCTCTGAAGGTTCCAGAATCGATAG) and either DEF15s or DEF15sI
primers (see Fig. 3A) under standard conditions (30
cycles of 94 °C for 45 s, 60 °C for 45 s, and 72 °C for 2
min; primer concentration, 10 µM, 10 mM Tris-HCl,
pH 8.3, 50 mM KCl, and 2 mM MgCl
). The
DNA product was recovered by glass milk adsorption (GeneClean, Bio101,
La Jolla, CA). The PCR product was incubated with T4 polynucleotide
kinase and T4 DNA polymerase at room temperature for 10 min in a buffer
containing 50 mM Tris-HCl, pH 7.5, 10 mM MgCl, 1 mM dithiothreitol, 0.1 mg/ml bovine
serum albumin, 20 µM dNTP, and 500 µM ATP)
and then purified again by glass milk adsorption. The blunt-ended DNA
fragment was then ligated using T4 DNA ligase with pBluescript II
SK+ plasmid that had been digested with SmaI and
dephosphorylated. For dot blot hybridization, isolated DNA from
individual clones was applied to a nylon filter according to standard
methods(31) . The filter hybridization and wash conditions
using the common probe, SIG68a
(GAGTGGCTCAGCCTGGGCCTGCAGGGCCACCAGGAGAATGGCAGCAAG), were at reduced
stringency (hybridization with 10% formamide, 5 SSC, 1
Denhardt's, 1% SDS, and 100 µg/ml yeast RNA at 42 °C;
washing with 2 SSC/0.1% SDS at room temperature for 1 h and in
2 SSC/0.1% SDS at 42 °C for 20 min). For HD-5 (HSIA-309a, TGCTTTGGTTTCTATCTAGGAAGCTCAGCGACAGCAGAGTCTGTAGAG) and HD-6 (HSIB-309a) probe hybridizations, the formamide
concentration was increased to 50% in the hybridization solution, and
the temperature of the high stringency wash was increased to 65 °C.
The filter was stripped of residual probe after each hybridization
experiment by washing in 0.5 M NaOH/1.5 M NaCl at
room temperature for 30 min. Efficient stripping of the probe was
documented before subsequent probe hybridization.
P-labeled probe from the common region of defensin mRNA,
SIG68a (COMMON PROBE), with a defensin 5 specific
oligonucleotide probe, HSIA-309a (HD-5), and with a defensin
6-specific oligonucleotide probe, HSIB-309a (HD-6). Clones 57
and 61 show hybridization to both HD-5 and HD-6 probes. Direct sequence analysis of the plasmid inserts reveal a
tandem ligation of both HD-5 and HD-6 cDNA in each of
these clones.
5` RACE Analysis
The RACE-PCR protocol was
modified from Frohman (32) as described(18) . The
tailed small intestinal cDNA template (18) was used in a PCR
using the gene-specific primer HSIB-309a and anchor primers as
described(32) . The PCR product was isolated and subcloned as
described above. A total of six recombinant plasmids were sequenced,
and four were found to contain sequence extending 5` to the initiating
methionine codon. The other two clones were regarded as artifacts of
the reverse transcriptase reaction. Products EM178.6, 179.7, and 163.8
extend 41 bases 5` to the ATG, whereas product EM163.6 extends 39
bases.RT-PCR and Northern Blot Analysis
Total RNA from
human fetal intestinal tissue was prepared by the method of Chirgwin et al.(33) . Reverse transcriptase (RT)-PCR was
carried out in a modified version of that described
previously(34, 35) . Briefly, for each reaction, cDNA
was synthesized using an antisense primer complementary to the gene
fragment of interest, together with an equal concentration of an
antisense primer corresponding to the housekeeping gene
-glucocerebrosidase included in the same reaction. The antisense
primers were allowed to anneal to 1 µg of total RNA from each
tissue sample at 65 °C for 10 min, and then reverse transcriptase
was used to generate cDNA from each gene during a 60-min incubation at
42 °C. PCR amplification was then performed using the following
conditions: 94 °C for 5 min, then 30 cycles of 60 °C for 1 min,
72 °C for 3 min, and 94 °C for 1 min, with a final elongation
of 72 °C for 5 min.-glucocerebrosidase, GD67A (CAGATACTTTTGTGAAGTTCC) and GDMID9B
(GACTGTCGACAAAGTTACGC), generating a 572-bp product. The PCR products
were resolved by electrophoresis in 1.5% agarose gels. The specific DNA
fragments generated by each PCR reaction were verified by direct
sequence analysis. RT-PCR primer pairs will amplify a product from
genomic DNA, but the product will be substantially larger than from
cDNA, because the forward and reverse primers lie in different exons.
Controls with no reverse transcriptase in each set of reactions were
found not to amplify a product from genomic DNA that might have
contaminated the RNA preparations. SSC/0.1% SDS at
50 °C for 30 min. The washed filters were exposed to film using an
intensifying screen at -70 °C for 2 weeks. The blots were
then stripped of probe by washing in 0.1 SSC/0.1% SDS at 65
°C for 1 h. Efficient stripping of the probe was documented by
autoradiographic exposure for 2 weeks.In Situ Hybridization
The methods for in situ hybridization were as
described(18, 36, 37) . Selected control
slides were treated with RNase A (20 µg/ml at room temperature for
15 min) prior to hybridization with probe. The HD-5 probe was
generated by cutting pHSIA-18(18) , an HD-5 cDNA clone
subcloned into the EcoRI site of pBluescript II, with EagI to remove the 5` portion of the cDNA from nucleotide 249
to the multiple cloning site and then recircularizing the plasmid by
ligation. The resulting plasmid, EM184-5, yielded 0.2-kilobase
riboprobes comprised of the 3` sequence of HD-5 cDNA. The HD-6 probe was generated by cutting EM177-7, a 5` RACE
subclone, with HinDIII to remove the 5` portion of the
plasmid. The resulting plasmid DNA, EM184-1, was recircularized
and contained nucleotides 137-352 of the HD-6 cDNA
sequence.
Cloning of Enteric Defensin Gene HD-6
As a step
toward understanding the molecular details crucial to developmental
regulation and tissue-specific expression of enteric defensins, the
transcribed and flanking regions of the HD-6 gene were cloned.
Six genome equivalents of an amplified human genomic library were
screened with a HD-6 probe(19) . DNA from six isolated
clones was digested with several restriction enzymes, and restriction
fragment length patterns indicated that each clone was unique, but all
of them contained overlapping restriction fragments from the genome. A
6-kilobase EcoRI fragment from one clone (HGEM-101) was
subcloned and used for sequence analysis (Fig. 1).
)
3` RACE Analysis of Small Intestinal
cDNA
To investigate the possibility that previously
uncharacterized defensin mRNA isoforms are expressed in the human small
intestine, an anchored PCR strategy was employed, capitalizing on the
highly invariant 5` nucleotide sequences found in defensin mRNA from
all species and tissues studied to date (Fig. 2; (18) ).
PCR primers, DEF15s and DEF15sI, were selected from this region of high
nucleotide similarity (Fig. 3A). RNA from the full
length of human small intestine was reverse transcribed using a
modified oligo(dT) primer that contained a flanking anchor sequence.
The resulting cDNA template was then used in a PCR amplification using
either of the two upstream defensin primers and the downstream anchor
sequence primer. A product of approximately 450 bp was obtained from
each reaction (Fig. 3B), and Southern blot
hybridization using an internal probe from the common sequence of
defensin cDNA demonstrated strong hybridization (data not shown). The
PCR products were subcloned, and 78 individual colonies were isolated.
Plasmid DNA with inserts of about 450 bp were subjected to further
analysis. Hybridization analysis revealed the presence of the
previously identified HD-5 and HD-6 clones in a ratio
of about 13:1 from PCR using DEF15s (Fig. 3C, 1-44). A relative ratio of approximately 4:1 (Fig. 3C, 45-78), closer to the ratio
observed in Northern blot analysis, was observed for the PCR using
DEF15sI. (
)Two representative clones from each hybridization
group were sequenced in their entirety, and the nucleotide sequences
corresponded exactly to the previously published sequences of HD-5(18) and HD-6(19) . Hybridization with
two additional probes under high stringency yielded consistent results
(data not shown). In addition, several subclones contained inserts
smaller than 450 nucleotides, and sequence analysis indicated that
these clones contained variously truncated HD-5 or HD-6 clones (Fig. 3C, 53, 58, 66, 67, 69, 70, and 76).
The nine remaining subclones were found by direct sequence analysis to
be unrelated to defensins (data not shown). Thus, we conclude from
these experiments that HD-5 and HD-6 are likely to be
the only defensins expressed in the human small intestine. However, we
cannot exclude the possibility that additional defensins might also be
expressed but either are present at lower levels of expression or are
not amenable to detection using this approach.Developmental Expression
To determine the regional
localization of HD-5 and HD-6 mRNA in early
development, RNA was isolated from fetal distal small intestine and
colon tissue at gestational ages from 13.5-17 weeks. The RNA was
reverse transcribed in vitro, and the resulting cDNA was
analyzed by PCR using primers that specifically amplify sequences for
each corresponding defensin (Fig. 4). At 13.5 weeks, HD-5 mRNA was detectable by RT-PCR in small intestine and colon.
Although HD-5 mRNA remains detectable through 17 weeks in the
small intestine, the detectable levels in the colon decrease with
evidence of only trace amounts at 17 weeks. HD-6 mRNA was
detectable by RT-PCR in small intestine at 13.5-17 weeks of
development (Fig. 4A). HD-6 mRNA, unlike HD-5, was not detected in the colon within this gestational
range (Fig. 4B). As a positive control for all RT-PCR
experiments, primers specific for -glucocerebrosidase were chosen (34) (Fig. 4). As two negative controls, reactions
lacking either RNA or reverse transcriptase were included.
-glucocerebrosidase as a control. B, HD-6 expression detected as a 325-bp cDNA fragment
after RT-PCR with the same -glucocerebrosidase control. Each lane in both gels contains 20% of a RT-PCR product using 1
µg of total RNA as template from: 13.5-week gestational age small
intestine (lane 1), 13.5-week colon (lane 2),
14.5-week distal small intestine (lane 3), 15-week colon (lane 4), 16-week distal small intestine (lane 5),
16-week colon (lane 6), 17-week distal small intestine (lane 7), 17-week colon (lane 8), 6-month neonatal
jejunum (top, lane 9), no RNA (control, top, lane 10), no reverse transcriptase (control, top, lane 11), no RNA (control, bottom, lane 9),
no reverse transcriptase (control, bottom, lane 10),
Life Technologies, Inc./BRL 1-kilobase ladder size standards (top, lane 12, and bottom, lane
11).
SSC/0.1% SDS at 50
°C.
In Situ Hybridization
The cellular localization of
the defensin mRNA was determined by in situ hybridization.
Tissue sections of human distal small intestine from adult, term
newborn, and fetus at 24 weeks gestation were probed with sense and
antisense S-labeled riboprobes. Signal was observed in
Paneth cells with the antisense probes of HD-5 and HD-6 in all intestinal specimens (Fig. 6, A-F).
No signal was observed in parallel sections if the sense probe was used (Fig. 6I) or if the sections were treated with
ribonuclease prior to hybridization with the antisense probe (Fig. 6, G and H). Phloxine-tartrazine
staining of parallel sections of all of these tissues revealed Paneth
cells correspondingly located to those cells expressing HD-5 and HD-6 mRNA (data not shown). Although in situ hybridization is limited in its quantitative ability, examination
of numerous sections and fields suggested lower expression for HD-6 compared with HD-5 in all sections, consistent with the
Northern blot data. Also, lower signal was detected in fetal than in
newborn sections, which was in turn lower than in adult specimens. As
previously shown, fewer Paneth cells were observed per crypt in the
fetus(44) , probably contributing to the lower levels observed
with Northern blot analysis.
S]UTP, washed under high stringency, coated
with photographic emulsion, exposed, developed, and then stained with
hematoxylin and eosin as described
previously(18, 37) . A-C, low power
view of sections of ileum hybridized with a HD-5 antisense
riboprobe. D-F, low power view of parallel sections
hybridized with a HD-6 antisense riboprobe. G and H, low power view of parallel sections treated with 20
µg/ml of RNase A for 15 min at room temperature prior to
hybridization as in A and E, respectively. I, low power view of a parallel section hybridized with an HD-5 sense riboprobe. The dense silver grains at the base of
the intestinal crypts represent positive signal (A-F).
All sections are shown at the same magnification. The bar equals 100 microns. The arrows indicate the locations of
representative Paneth cells in each
section.
Structure of Enteric Defensin Genes
The data
reported here (Fig. 6), together with previous studies by our
group(18, 19) , support that expression of defensin
genes HD-5 and HD-6 are limited to Paneth cells. As a
step toward defining the cis-acting nucleotide sequences that regulate
expression of enteric defensin genes, we cloned and characterized the HD-6 gene. HD-6 has two exons (Fig. 1) similar
in structure to HD-5, which was characterized
previously(18) . This two-exon structure is analogous to that
of the mouse enteric defensin genes (25) and contrasts with
that for the hematopoietic defensin genes from human (40) , (
)guinea pig(45) , and rabbit(46) , all of
which contain three exons, the last two of which encode the
prepropeptide. Highly similar respective structures for the enteric and
the hematopoietic defensin genes between several mammalian species
suggest that corresponding ancestral genes of each type existed in
evolution prior to the divergence of these species. A model for a
possible evolutionary history of the human defensin gene family has
recently been proposed by our group. (
)-defensins,
are highly inducible with their expression in differentiated epithelial
cells responsive to inflammatory stimuli (48, 49, 50) .Enteric Defensin Expression in Human Small Intestinal
Ontogeny
The appearance of HD-5 and HD-6 mRNA (Fig. 4) coincides approximately with the appearance of
morphologically distinguishable Paneth cells, which have been
identified at 12 weeks of gestation in humans by electron microscopy (51) . Although the physiological significance of low level
defensin expression is not yet clear, the data suggest defensin mRNA
expression may be an early marker of Paneth cell differentiation. This
is consistent with the notion that the human enteric defensins, similar
to the hematopoietic defensins, have constitutive levels of expression
and are part of a developmental program of the highly differentiated
cells in which they are expressed(52) .Comparison of Enteric Defensin Developmental Expression
in Mouse and Human Intestine
The developmental profile of mouse
enteric defensin gene expression is predominantly
postnatal(13) . This contrasts with the earlier pattern we
found in the human, but it also largely parallels the appearance of
Paneth cells in mice(53) . Morphologically identifiable Paneth
cells are not present in mouse intestine until birth or just
before(53) . The murine defensin mRNA levels then increase
gradually, reaching adult levels by the fourth postnatal
week(13, 47) . Using immunohistochemical methods, Bry et al.(47) have identified cryptin peptide in mouse
Paneth cells which coincides with the previously described mRNA
expression (13) . Enteric defensin peptides also have been
isolated from extracts of small bowel mucosa of weaned
mice(13, 15, 16, 17, 26) . The striking species difference in enteric
defensin gene numbers remains an enigma and may reflect selective
pressures resulting from complex interactions between host and
microbial environment.Enteric Antibiotic Peptides in Host
Defense
Antimicrobial peptides are host defense effector
molecules identified previously in the gastrointestinal tract of
insects, amphibians, and
mammals(13, 15, 16, 50, 54, 55, 56) .
The finding of antimicrobial peptides of several different gene
families expressed in the gastrointestinal tracts of diverse species
supports a role in local defense of this mucosal surface. The precise
physiological role of these molecules, however, remains an open
question. We and others(13, 15, 16, 17, 18, 19) have
postulated that the epithelial expression of defensins in the
intestinal tract serves either to constrain the proliferation of
intraluminal flora or to prevent translocation of bacteria across the
intestinal mucosa.
)))))
We thank Drs. Gill Diamond, Alan Tarver, and Douglas
Jones for helpful discussions. We thank Shirley Hwang, Sue Shackleton,
and Drs. Jeremy Hull and Scott Tebbutt for help with DNA sequencing,
Loree Kim for help with pilot 3` RACE experiments, and Dr. Douglas
Jones for supplying tailed small intestinal cDNA for 5` RACE analysis.
We are grateful to Dr. S. Gould and P. Tam for tissue samples.
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  N. A. Louis and P. W. Lin The Intestinal Immune Barrier NeoReviews, April 1, 2009; 10(4): e180 - e190. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. I Yudin, T. L Tollner, C. A Treece, R. Kays, G. N Cherr, J. W Overstreet, and C. L Bevins {beta}-Defensin 22 is a major component of the mouse sperm glycocalyx Reproduction, December 1, 2008; 136(6): 753 - 765. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.Q. Lin, J.Y. Li, H.Y. Wang, J. Liu, C.L. Zhang, W.T. Wang, J. Liu, N. Li, and S.H. Jin Cloning and identification of a novel sperm binding protein, HEL-75, with antibacterial activity and expressed in the human epididymis Hum. Reprod., September 1, 2008; 23(9): 2086 - 2094. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Menard, V. Forster, M. Lotz, D. Gutle, C. U. Duerr, R. L. Gallo, B. Henriques-Normark, K. Putsep, M. Andersson, E. O. Glocker, et al. Developmental switch of intestinal antimicrobial peptide expression J. Exp. Med., January 21, 2008; 205(1): 183 - 193. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Hubert, L. Herman, C. Maillard, J.-H. Caberg, A. Nikkels, G. Pierard, J.-M. Foidart, A. Noel, J. Boniver, and P. Delvenne Defensins induce the recruitment of dendritic cells in cervical human papillomavirus-associated (pre)neoplastic lesions formed in vitro and transplanted in vivo FASEB J, September 1, 2007; 21(11): 2765 - 2775. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Hazrati, B. Galen, W. Lu, W. Wang, Y. Ouyang, M. J. Keller, R. I. Lehrer, and B. C. Herold Human {alpha}- and beta-Defensins Block Multiple Steps in Herpes Simplex Virus Infection J. Immunol., December 15, 2006; 177(12): 8658 - 8666. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Lievin-Le Moal and A. L. Servin The Front Line of Enteric Host Defense against Unwelcome Intrusion of Harmful Microorganisms: Mucins, Antimicrobial Peptides, and Microbiota Clin. Microbiol. Rev., April 1, 2006; 19(2): 315 - 337. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. P. Sherman, S. H. Bennett, F. F. Y. Hwang, J. Sherman, and C. L. Bevins Paneth Cells and Antibacterial Host Defense in Neonatal Small Intestine Infect. Immun., September 1, 2005; 73(9): 6143 - 6146. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Boulanger, A. Vezina, S. Mongrain, F. Boudreau, N. Perreault, B. A. Auclair, J. Laine, C. Asselin, and N. Rivard Cdk2-dependent Phosphorylation of Homeobox Transcription Factor CDX2 Regulates Its Nuclear Translocation and Proteasome-mediated Degradation in Human Intestinal Epithelial Cells J. Biol. Chem., May 6, 2005; 280(18): 18095 - 18107. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Nam, M. K. Kee, R. Kuick, and S. M. Hanash Identification of Defensin {alpha}6 as a Potential Biomarker in Colon Adenocarcinoma J. Biol. Chem., March 4, 2005; 280(9): 8260 - 8265. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. D. Starner, B. Agerberth, G. H. Gudmundsson, and P. B. McCray Jr. Expression and Activity of {beta}-Defensins and LL-37 in the Developing Human Lung J. Immunol., February 1, 2005; 174(3): 1608 - 1615. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Baumgarth, R. Szubin, G. M. Dolganov, M. R. Watnik, D. Greenspan, M. Da Costa, J. M. Palefsky, R. Jordan, M. Roederer, and J. S. Greenspan Highly Tissue Substructure-Specific Effects of Human Papilloma Virus in Mucosa of HIV-Infected Patients Revealed by Laser-Dissection Microscopy-Assisted Gene Expression Profiling Am. J. Pathol., September 1, 2004; 165(3): 707 - 718. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Fujiwara, M. Ochiai, T. Ohta, M. Ohki, H. Aburatani, M. Nagao, T. Sugimura, and H. Nakagama Global gene expression analysis of rat colon cancers induced by a food-borne carcinogen, 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine Carcinogenesis, August 1, 2004; 25(8): 1495 - 1505. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Kaufman and K. D. Fairchild Clinical Microbiology of Bacterial and Fungal Sepsis in Very-Low-Birth-Weight Infants Clin. Microbiol. Rev., July 1, 2004; 17(3): 638 - 680. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. W. Lin, P. O. Simon Jr., A. T. Gewirtz, A. S. Neish, A. J. Ouellette, J. L. Madara, and W. I. Lencer Paneth Cell Cryptdins Act in Vitro as Apical Paracrine Regulators of the Innate Inflammatory Response J. Biol. Chem., May 7, 2004; 279(19): 19902 - 19907. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. M. Yamamoto, N. Banaiee, N. Y. Yount, B. Patel, and M. E. Selsted {alpha}-Defensin expression during myelopoiesis: identification of cis and trans elements that regulate expression of NP-3 in rat promyelocytes J. Leukoc. Biol., February 1, 2004; 75(2): 332 - 341. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. N. Cunliffe and Y. R. Mahida Expression and regulation of antimicrobial peptides in the gastrointestinal tract J. Leukoc. Biol., January 1, 2004; 75(1): 49 - 58. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. A. Muller, J. Markovic-Lipkovski, T. Klatt, J. Gamper, G. Schwarz, H. Beck, M. Deeg, H. Kalbacher, S. Widmann, J. T. Wessels, et al. Human {alpha}-Defensins HNPs-1, -2, and -3 in Renal Cell Carcinoma : Influences on Tumor Cell Proliferation Am. J. Pathol., April 1, 2002; 160(4): 1311 - 1324. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. S. Kim, J. H. Cho, H. W. Park, H. Yoon, M. S. Kim, and S. C. Kim Endotoxin-Neutralizing Antimicrobial Proteins of the Human Placenta J. Immunol., March 1, 2002; 168(5): 2356 - 2364. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Hase, L. Eckmann, J. D. Leopard, N. Varki, and M. F. Kagnoff Cell Differentiation Is a Key Determinant of Cathelicidin LL-37/Human Cationic Antimicrobial Protein 18 Expression by Human Colon Epithelium Infect. Immun., February 1, 2002; 70(2): 953 - 063. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Edde, R. B. Hipolito, F. F. Y. Hwang, D. R. Headon, R. A. Shalwitz, and M. P. Sherman Lactoferrin protects neonatal rats from gut-related systemic infection Am J Physiol Gastrointest Liver Physiol, November 1, 2001; 281(5): G1140 - G1150. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Yang, O. Chertov, and J. J. Oppenheim Participation of mammalian defensins and cathelicidins in anti-microbial immunity: receptors and activities of human defensins and cathelicidin (LL-37) J. Leukoc. Biol., May 1, 2001; 69(5): 691 - 697. [Abstract] [Full Text]
|
|
|
|
|
|
J. Nesper, C. M. Lauriano, K. E. Klose, D. Kapfhammer, A. Krai{beta}, and J. Reidl Characterization of Vibrio cholerae O1 El Tor galU and galE Mutants: Influence on Lipopolysaccharide Structure, Colonization, and Biofilm Formation Infect. Immun., January 1, 2001; 69(1): 435 - 445. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Kaiser and G. Diamond Expression of mammalian defensin genes J. Leukoc. Biol., December 1, 2000; 68(6): 779 - 784. [Abstract] [Full Text]
|
|
|
|
|
|
G. Diamond, V. Kaiser, J. Rhodes, J. P. Russell, and C. L. Bevins Transcriptional Regulation of beta -Defensin Gene Expression in Tracheal Epithelial Cells Infect. Immun., January 1, 2000; 68(1): 113 - 119. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. A. O'Neil, E. M. Porter, D. Elewaut, G. M. Anderson, L. Eckmann, T. Ganz, and M. F. Kagnoff Expression and Regulation of the Human {beta}-Defensins hBD-1 and hBD-2 in Intestinal Epithelium J. Immunol., December 15, 1999; 163(12): 6718 - 6724. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C L BEVINS, E MARTIN-PORTER, and T GANZ Defensins and innate host defence of the gastrointestinal tract Gut, December 1, 1999; 45(6): 911 - 915. [Full Text] [PDF]
|
|
|
|
 |
|
 S. Drouault, G. Corthier, S. D. Ehrlich, and P. Renault Survival, Physiology, and Lysis of Lactococcus lactis in the Digestive Tract Appl. Envir. Microbiol., November 1, 1999; 65(11): 4881 - 4886. [Abstract] [Full Text]
|
|
|
|
 |
|
 G. Hecht Innate mechanisms of epithelial host defense: spotlight on intestine Am J Physiol Cell Physiol, September 1, 1999; 277(3): C351 - C358. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. H. van den Berg, M. C. Faber-Krol, S. van Wetering, P. S. Hiemstra, and M. R. Daha Inhibition of Activation of the Classical Pathway of Complement by Human Neutrophil Defensins Blood, November 15, 1998; 92(10): 3898 - 3903. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Krisanaprakornkit, A. Weinberg, C. N. Perez, and B. A. Dale Expression of the Peptide Antibiotic Human beta -Defensin 1 in Cultured Gingival Epithelial Cells and Gingival Tissue Infect. Immun., September 1, 1998; 66(9): 4222 - 4228. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Shimada, H. Ishikawa, H. Tosaka–Shimada, T. Yasuda, K. Kishi, and S. Suzuki Detection of Deoxyribonuclease I Along the Secretory Pathway in Paneth Cells of Human Small Intestine J. Histochem. Cytochem., July 1, 1998; 46(7): 833 - 840. [Abstract] [Full Text]
|
|
|
|
|
|
Y. Ma, Q. Su, and P. Tempst Differentiation-stimulated Activity Binds an ETS-like, Essential Regulatory Element in the Human Promyelocytic defensin-1 Promoter J. Biol. Chem., April 10, 1998; 273(15): 8727 - 8740. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. P. Tarver, D. P. Clark, G. Diamond, J. P. Russell, H. Erdjument-Bromage, P. Tempst, K. S. Cohen, D. E. Jones, R. W. Sweeney, M. Wines, et al. Enteric beta -Defensin: Molecular Cloning and Characterization of a Gene with Inducible Intestinal Epithelial Cell Expression Associated with Cryptosporidium parvum Infection Infect. Immun., March 1, 1998; 66(3): 1045 - 1056. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Bals, M. J. Goldman, and J. M. Wilson Mouse beta -Defensin 1 Is a Salt-Sensitive Antimicrobial Peptide Present in Epithelia of the Lung and Urogenital Tract Infect. Immun., March 1, 1998; 66(3): 1225 - 1232. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |