| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
(Received for publication, September 7, 1995; and in revised form, December 12, 1995) From the
Gene expression from the human T-cell leukemia virus type I
(HTLV-I) long terminal repeat (LTR) is mediated by three cis-acting regulatory elements known as 21-base pair (bp)
repeats in addition to the transactivator protein Tax. Each of the
21-bp repeats contain nucleotide sequences which are homologous to a
cAMP response element (CRE) which bind members of the ATF/CREB family
of transcription factors. In this study, we investigated whether CREB
alone or in the presence of Tax was able to induce DNA structural
changes when bound to CRE sites in the HTLV-I 21 bp, the cellular
somatostatin promoter, or a hybrid CRE construct comprised of both the
somatostatin and 21-bp repeat sequences. Circular permutation analysis
indicated that CREB was able to induce DNA flexure upon binding to each
of these elements. However, phasing analysis, which is a more sensitive
method to determine the degree and orientation of directed DNA bending,
demonstrated that CREB induced DNA bending of the HTLV-I 21-bp repeat
and the hybrid CRE but not the somatostatin CRE. The addition of Tax
did not change CREB-mediated bending of the 21-bp repeat or the hybrid
CRE although it markedly increased the amount of CREB bound to each of
these DNA elements. These results indicate that sequence motifs
flanking the CRE in the 21-bp repeat are critical for inducing DNA
structural changes and that these changes are likely important in
mediating Tax activation of the HTLV-I LTR.
Human T-cell leukemia virus type I (HTLV-I) ( The HTLV-I long terminal repeat (LTR) contains three cis-acting regulatory elements designated 21-bp repeats which
are necessary for transactivation by Tax(16, 17) . The
sequences within the 21-bp repeats have been further subdivided into
three motifs designated A, B, and C(18) . The A and C motifs
which are GC-rich sequences flanking the B motif are involved in
controlling the level of Tax activation. The B motif in each of the
21-bp repeats is designated as the tax-response element and is
highly homologous to a cyclic AMP-response element (CRE) which is found
in a variety of genes whose expression is increased in response to
elevated levels of cAMP by binding members of the ATF/CREB family of
transcription factors(19) . The B motif mediates increases in
HTLV-I gene expression in response to Tax and serves as the binding
site for a variety of members of the ATF/CREB
family(20, 21, 22) . In contrast to the
HTLV-I LTR, Tax activation of other viral and cellular promoters is
frequently mediated by cellular transcription factors other than
ATF/CREB. For example, Tax activation of interleukin-2 receptor and the
HIV-1 LTR is mediated by increases in the level of NF- Tax stimulates the binding of a number of
members of ATF/CREB family to the 21-bp
repeats(22, 26, 27, 28, 29, 30, 31, 32) .
The mechanism of this stimulation remains unclear since several studies
do not demonstrate stable binding of Tax to gel-retarded complexes
containing CREB(26, 27, 28, 31) .
This may be due to dissociation of Tax during gel electrophoresis.
Using both in vitro binding studies and the mammalian
two-hybrid system, we find that Tax specifically interacts with CREB
but not other members of the ATF/CREB family or other leucine zipper
proteins(26) . CREB interaction with Tax is mediated by its
basic leucine zipper domain which is also required for its dimerization
and DNA binding properties(33, 34) . A variety of such
bZIP proteins including Fos-Jun, in addition to other members of the
ATF/CREB family, bind to their cognate DNA recognition elements by
forming dimeric complexes(35, 36, 37) . Tax
stimulation of CREB binding to the 21-bp repeat may result from its
ability to either enhance dimerization of CREB, change the conformation
of CREB, or alter the DNA structure of the 21-bp
repeat(31, 38) . DNA is frequently distorted from
its regular double helical structure by the binding of cellular
transcription factors. A well described and experimentally accessible
mode of DNA distortion is DNA bending (35, 36, 37, 39, 40, 41) .
Induction of DNA bending has been observed for several prokaryotic
proteins such as the Escherichia coli CAP and IHF
proteins(40, 42, 43, 44) , the
Constructs for phasing analysis
were generated by the insertion of a set of five double-stranded
oligonucleotides containing three adenine tracts
(5`-TCGAGCTTTTTGCCCGTTTTTGCCCGTTTTTG-3`) and different linker elements
containing either AG for 2 bp, CGAG for 4 bp, CAGCAG for 6 bp, and
GCAGTGCAG for 8 bp inserted into the SalI-digested pBend2
plasmid(39) . The resultant plasmids were designated
pPhaseII(2), pPhaseII(4), pPhaseII(6), pPhaseII(8), and pPhaseII(10),
respectively. The plasmids used for phasing analysis consisted of the
oligomers used in the permutation clones inserted into the five
pPhaseII vectors(41) , resulting in a distance between the
middle of the A-tract and the middle of the CREB binding site of 25,
27, 29, 31, and 33 base pairs, respectively. Oligonucleotides
containing the HTLV-I 21-bp III, somatostatin CRE, and the hybrid 21-bp
repeat-CRE were cloned into each of these pPhaseII
plasmids(41) . To construct 5 nucleotide deletions between
each of the 21-bp repeats or the 21-bp repeats and the TATA box, in
vitro mutagenesis of the HTLV-1 LTR in M13 was performed using the
Sculptor site-directed mutagenesis kit (Amersham) using the
oligonucleotides: CTCCCCCCAGAGGGACAGCACCGGCTCAGGCTA-GGCC (
For circular
permutation assays, the pBend plasmids containing the 21-bp repeat,
somatostatin CRE, or the hybrid CRE were digested with MluI, NheI, PvuII, SpeI, or BamHI
followed by dephosphorylation. The resulting fragments were end-labeled
with polynucleotide kinase and then purified following electrophoresis
on polyacrylamide gels. Approximately 20,000 cpm of these DNA probes
were incubated for 20 min with CREB at a final volume of 40 µl of
50 mM NaCl, 25 mM Tris base, pH 7.4, 1 mM EDTA in the presence or absence of Tax at room temperature. The
DNA-protein complexes were analyzed on native 5% polyacrylamide gels in
TG buffer (25 mM Tris base, pH 8.9, 190 mM glycine).
For phasing analysis, the pPhaseII constructs containing the 21-bp
repeat, the somatostatin CRE, or the hybrid CRE were digested with PvuII. The resultant fragments were dephosphorylated, end
labeled with
µ
By normalizing the mobilities to µ
Under our electrophoresis conditions, the best fit was observed
for a value of k = 1.06. To determine the directed DNA
bend angle, we calculated the best fit of a cosine function to the
relative mobilities of phasing analysis complexes. We have derived the
relation between the phasing function amplitude (A
A
where
Figure 1:
Tax stimulation of CREB binding is
dependent on sequences flanking the CRE. A, either 10 ng (lanes 2, 3, 7, 8, 12, and 13) or 30 ng (lanes 4,
5, 9, 10, 14, and 15) of CREB protein was incubated with
50,000 cpm of probe corresponding to the HTLV-I 21-bp repeat (lanes
1-5), the somatostatin CRE site (lanes 6-10),
or the hybrid CRE (lanes 11-15) in the presence (lanes 3, 5, 8, 10, 13, and 15) or absence (lanes
2, 4, 7, 9, 12, and 14) of Tax, and the DNA-protein
complexes were analyzed by electrophoretic mobility shift assay (EMSA). Lanes 1, 6, and 11 contain labeled probe in the
absence of CREB. B, gel retardation was performed with the
21-bp repeat probe (lane 1) and incubated with either CREB (30
ng) alone (lane 2) or with the addition of 50 ng of either
wild type Tax (lane 3) or an N-terminal truncation of Tax (lane 4). C, gel retardation assays were performed
with an increasing amount of CREB ranging from 5 to 120 ng in both the
presence and absence of 50 ng of Tax. The radioactivity of the
DNA-protein complexes were quantitated by PhosphorImager scanning and
the amount that Tax stimulated CREB binding to each set of
oligonucleotides was plotted as a function of increasing quantities of
CREB.
To better quantitate the differences in
Tax stimulation of CREB binding using these probes, we performed gel
retardation assays with Tax in the presence of increasing
concentrations of CREB. CREB binding was quantitated by PhosphorImager
analysis and the amount of Tax stimulation was plotted as a function of
the concentration of CREB (Fig. 1C). These results
indicated that Tax increased CREB binding to the HTLV-I 21-bp repeat
approximately 4-fold using low concentrations of CREB but only 2-fold
when higher amounts of CREB were used (Fig. 1C). A
similar degree of Tax stimulation of CREB binding was also noted using
the hybrid CRE (Fig. 1C). In contrast, Tax was unable
to increase CREB binding to somatostatin CRE site at either low or high
concentrations of CREB (Fig. 1C). These results
indicated that the DNA sequences flanking the CRE were critical for
regulating both the amount of CREB binding and the degree of
Tax-stimulation.
Figure 2:
Structure of the restriction fragments
used in circular permutation analysis. Oligonucleotides containing the
HTLV-I 21-bp repeat III, the somatostatin CRE, and the hybrid CRE were
cloned into the pBend vector and then digested with MluI (A), SpeI (B), PvuII (C), NruI (D), and BamHI (E) to generate
the fragments used in circular permutation analysis. The position of
the CRE in each of the oligonucleotides is indicated by shading.
First, we analyzed the electrophoretic mobility of circularly
permutated fragments containing the HTLV-I 21-bp repeat which were
incubated with CREB in either the presence or absence of Tax (Fig. 3). The bound and free probes are shown in separate panels
due to the prolonged times required for gel electrophoresis because of
the extremely slow mobility of the CREB-DNA complexes. No obvious
anomalous migration was observed for the free DNA probes indicating
that they did not have any intrinsic curvature (Fig. 3B,
lanes 1-10). Migration of the complex containing the 21-bp
repeat and CREB was clearly dependent on the position of the binding
site within the different pBend fragments which was suggestive of
CREB-induced DNA structural changes (Fig. 3A, lanes
1-10). This was reflected by the fact that CREB-DNA
complexes migrated slower when bound to probes in which the 21-bp
repeat was in the middle of the fragment as compared to fragments where
the binding sites were located at either end of the fragment. The
relative migration of the CREB-DNA complexes did not significantly
change in either the presence or absence of Tax although there was a
significant increase in CREB binding in the presence of Tax (Fig. 3A, lanes 1-10). This is reflected in the
graph shown in Fig. 3C which indicates a similar
pattern of mobility for each of the CREB-21 bp repeat complexes in the
presence and absence of Tax. It should be noted that the increased
amount of CREB binding to the 21-bp repeat in the presence of Tax would
also be consistent with the presence of Tax in the gel retarded complex
with CREB. However, addition of Tax antibody to these gel retardation
assays did not result in a supershift of the gel retarded complex (data
not shown).
Figure 3:
Circular permutation assay of CREB binding
to the HTLV-I 21-bp repeat. A, the labeled pBend DNA fragments (A-E) containing the 21-bp repeat oligonucleotides were
incubated with 50 ng of CREB in the presence (lanes 2, 4, 6, 8, and 10) or absence of (lanes 1, 3, 5, 7, and 9) Tax and the DNA-protein complexes analyzed by
electrohoretic mobility shift assay are shown. B, the
mobilities of the free probes (A-E) are shown. C, the
ratio of the mobilities of the HTLV-I 21-bp CREB complex relative to
that of the corresponding free DNA was plotted as a function of the
position of the binding site.
The electrophoretic mobility of circularly permutated
fragments containing the somatostatin CRE was next performed with CREB
in both the presence and absence of Tax (Fig. 4A, lanes 1 and 10). CREB induced DNA structural distortion when
bound to the somatostatin CRE site (Fig. 4A, lanes
1-10). The presence of Tax did not change the relative
mobility of the somatostatin CRE in the presence of CREB nor did it
induce CREB binding (Fig. 4, A and C).
Finally, a similar analysis was performed using the hybrid
oligonucleotide which contained the somatostatin CRE flanked by the
21-bp repeat A and C motifs (Fig. 5). The changes in the
mobility of the fragments containing the hybrid CRE in the presence of
CREB were similar to the results obtained with the somatostatin CRE and
the 21-bp repeat (Fig. 5, A and C). There were
no changes in the mobility of the hybrid CRE bound to CREB in either
the presence or absence of Tax, although Tax markedly stimulated CREB
binding (Fig. 5, A and C). A variety of
previous studies have demonstrated that a variety of other bZIP
proteins display position-dependent variations in electrophoretic
mobility upon binding to their cognate binding sites. Our results
indicate that CREB induces similar DNA structural distortions in the
HTLV-I 21-bp repeat, the somatostatin CRE site, and the hybrid CRE with
flexure angles ranging from 40° to 49° and that these
CREB-induced DNA structural changes were not influenced by the presence
of Tax (Table 1). The flexure angles seen upon the binding of
other bZIP proteins to their cognate sites vary with the Fos-Jun
heterodimer having a flexure angle of 94° and the Jun homodimer
having a flexure angle of 79°(36, 37) .
Figure 4:
Circular permutation assay of CREB binding
to the somatostatin CRE. A, the labeled pBend DNA fragments (A-E) containing the somatostatin CRE were incubated with 50
ng of CREB in the presence (lanes 2, 4, 6, 8, and 10)
or absence of (lanes 1, 3, 5, 7, and 9) Tax and the
DNA-protein complexes analyzed by electrophoretic mobility shift assay
are shown. B, the mobilities of the free probes (A-E)
are shown. C, the ratio of the mobilities of the somatostatin
CRE-CREB complex relative to that of the corresponding free DNA was
plotted as a function of the position of the binding
site.
Figure 5:
Circular permutation assay of CREB binding
to the hybrid CRE. A, the labeled pBend DNA fragments (A-E) containing the hybrid CRE were incubated with 50 ng of
CREB in the presence (lanes 2, 4, 6, 8, and 10) or
absence of (lanes 1, 3, 5, 7, and 9) Tax and the
DNA-protein complexes were analyzed by electrophoretic mobility shift
assay. B, the mobilities of the free probes (A-E) are
shown. C, the ratio of the mobilities of the hybrid CRE-CREB
complex relative to that of the corresponding free DNA was plotted as a
function of the position of the binding
site.
We cloned oligonucleotides corresponding to the HTLV-I
21-bp repeat, the somatostatin CRE, and the hybrid CRE into the
pPhaseII vector (41) which contains three adenine tracts that
intrinsically bend DNA (Fig. 6). Using a set of linkers varying
by 2 bp in length from 2 to 10 nucleotides, the distance between the
CREB binding site and the adenine tract-directed bend was
altered(41) . Thus, the length of the spacer was varied over
one turn of the DNA helix to place the CREB binding site on different
faces of the DNA relative to the DNA bend. If CREB binding induced DNA
bending, the mobility of the CREB-DNA complex should depend on the
linker length since this determines the relative orientation of the
protein-induced DNA bend. The mobility of the DNA-protein complex is
minimal in the cis-isomer where the end-to-end distance is
short and maximal in the trans-isomer.
Figure 6:
Schematic representation of protein-DNA
complexes analyzed by phasing. DNA fragments were constructed which
contained the binding sites for the 21-bp repeat, somatostatin CRE, or
hybrid CRE and an intrinsic bend induced by three A tracts followed by
linker sequences which vary in length from 2 to 10 bp. Upon binding of
proteins which bend DNA, fragments of different geometry can be
separated by gel electrophoresis. The in-phase cis-isomers
migrates with a reduced mobility while the out-of-phase trans-isomer migrates with an increased
mobility.
Gel retardation
assays were performed with CREB and the 21-bp repeat in both the
presence and absence of Tax using each of the five phasing constructs
as probes (Fig. 7). Complexes comprised of CREB and the 21-bp
repeat (Fig. 7, A and B) in addition to the
position of the free probes (Fig. 7C) are shown.
Electrophoresis of these gel retardation assays was performed for both
4 (Fig. 7A) and 12 (Fig. 7B) h to
accentuate potential CREB induced effects on DNA bending. These
prolonged times of electrophoresis resulted in marked dissociation of
CREB from the 21-bp repeat in the absence but not the presence of Tax (Fig. 7B). This effect was not seen during shorter
periods of electrophoresis (Fig. 7A). The relative
mobilities of the CREB-21 bp repeat complexes in both the presence and
absence of Tax were obtained upon long exposure of the autoradiogram in Fig. 7B and divided by the relative mobilities of free
DNA. No 10-bp periodicity was noted using the five phasing probes
containing the 21-bp repeat (Fig. 7C). A clear
variation with a 10-bp periodicity was observed when these relative
mobilities were plotted against the linker length (Fig. 7D). Although Tax markedly altered the stability
of the CREB-21 bp repeat complex following prolonged gel
electrophoresis, it did not alter the 10-bp periodicity observed upon
the binding of CREB alone to the 21-bp repeat. This finding was
confirmed in three independent experiments (Fig. 7D).
Figure 7:
Analysis of directed DNA bending of the
HTLV-I 21-bp repeat by phasing analysis. Phasing analysis was performed
with probes containing the 21-bp sequences flanked by different linker
lengths and incubated with 50 ng of CREB in either the presence (lanes 2, 4, 6, 8, and 10) or absence (lanes 1,
3, 5, 7, and 9) of Tax followed by gel electrophoresis.
The position of the bound probe following gel electrophoresis for
either (A) 4 or (B) 12 h is shown. C, the
position of the free probe is also shown and the linker length is
indicated on top of each lane. D, the ratio of the relative
mobilities of the CREB-DNA complex divided by the relative mobilities
of the corresponding free DNA was plotted against linker length in
three independent experiments and the standard deviation
included.
It was important to calculate the orientation and degree of
CREB-induced bending. Phased A:T tracts bend DNA toward the minor
groove at the center of the A:T tract(41) . Proteins that bend
DNA toward the minor groove at the center of the 21 bp cooperate with
the intrinsic bend of the A:T tract when they contain a 10-bp spacer
and counteract this bend when bound to 21-bp constructs containing
either a 4- or 6-bp spacer. Therefore, our results indicate that the
CREB homodimer, in either the presence or absence of Tax, induces a
small directed bend angle of 8° with a net orientation toward the
minor groove (Table 1). Next gel retardation was performed
using CREB and phasing probes containing the somatostatin CRE. In
contrast to the results seen with the 21-bp repeat, prolonged
electrophoresis did not markedly alter the amount of CREB bound to the
CRE in either the presence or absence of Tax (Fig. 8, A and B). The phasing probes containing the somatostatin
CRE are shown in Fig. 8C. In contrast to the results
seen with the 21-bp repeat probe, there was a 10-bp periodicity seen
using the five phasing probes in the somatostatin CRE (Fig. 8C). However, unlike the results with the 21-bp
repeat, there was no 10-bp periodicity observed when the relative
mobilities of the CREB-somatostatin-CRE complexes were divided by the
relative mobilities of free DNA and plotted against the linker length (Fig. 8D). Although CREB binding to the somatostatin
CRE was associated with changes in DNA flexibility using circular
permutation analysis, there was no directed DNA bending found using the
more specific phasing analysis as previously determined(37) .
Figure 8:
Analysis of directed DNA bending of the
somatostatin CRE by phasing analysis. Phasing analysis was performed
with probes containing the somatostatin CRE sequences flanked by
different linker lengths and incubated with 50 ng of CREB either in the
presence (lanes 2, 4, 6, 8, and 10) or absence (lanes 1, 3, 5, 7, and 9) of Tax followed by gel
electrophoresis. The position of the bound probe following gel
electrophoresis for either (A) 4 or (B) 12 h is
shown. C, the position of the free probe is also shown and the
linker length is indicated on top of each lane. D, the ratio
of the relative mobilities of the CREB-DNA complex divided by the
mobilities of the corresponding free DNA was plotted against linker
length in three independent experiments and the standard deviation
included.
Since CREB was able to induce phasing with the 21-bp repeat but not
the somatostatin CRE, we next determined whether this effect was
dependent primarily on the sequences of the CRE or the flanking A and C
motifs. Phasing analysis was performed using CREB and the hybrid CRE
construct in the presence and absence of Tax (Fig. 9). With
prolonged periods of electrophoresis, CREB dissociated from the hybrid
CRE in the absence but not the presence of Tax (Fig. 9B) which did not occur during shorter periods of
electrophoresis (Fig. 9A). This suggested that the A
and C motifs were critical for Tax-mediated stabilization of CREB
binding. The mobility of the phasing probes containing the hybrid CRE
indicated that there was no 10-bp periodicity (Fig. 9C).
Figure 9:
Analysis of directed DNA bending of the
hybrid CRE by phasing analysis. Phasing analysis was performed probes
containing the hybrid CRE flanked by different linker lengths and
incubated with 50 ng of CREB either in the presence (lanes 2, 4, 6,
8, and 10) or absence (lanes 1, 3, 5, 7, and 9) of Tax followed by gel electrophoresis. The position of the
bound probe following gel electrophoresis for either (A) 4 or (B) 12 h is shown. C, the position of the free probe
and the linker length is indicated on top of each lane. D, the
ratio of the relative mobilities of the CREB-DNA complex divided by the
mobilities of the corresponding free DNA was plotted against linker
length in three independent experiments and the standard deviation
included.
It was thus critical to determine whether
the A and C motifs influenced the degree of CREB-induced bending. When
the relative mobilities of complexes composed of CREB bound to the
hybrid CRE were divided by the relative mobilities of free DNA and
plotted against the linker length, a clear variation with a 10-bp
periodicity was observed (Fig. 9D). The presence of Tax
did not alter the 10-bp periodicity observed with CREB alone (Fig. 9, A and B). Thus, phasing analysis with
the hybrid CRE gave similar results to that seen with the 21-bp repeat
indicating that a 9° bend toward the minor groove occurred upon
CREB binding to the hybrid CRE. These results suggest that the GC-rich
sequences present in the A and C motifs flanking the CRE are required
for both CREB-induced DNA bending and Tax stimulation of CREB binding.
Whether structural changes in the 21-bp repeat are a requirement for
subsequent Tax stimulation of gene expression remains to be determined.
Since we
demonstrated that CREB binding in both the presence and absence of Tax
was able to induce DNA structural changes in the 21-bp repeat, we next
determined whether changes in the position of the 21-bp repeats
relative to each other may alter the level of basal or Tax-induced gene
expression from the HTLV-I LTR. Five base pair deletions were placed
between the first and second 21-bp repeats, the second and third 21-bp
repeats, or between the third 21-bp repeat and the TATA box. Thus, we
changed the position of the different 21-bp repeats by placing them on
opposite sides of the DNA helix. These different mutations were each
inserted into HTLV-I LTR chloramphenicol acetyltransferase reporter
plasmids and assayed for basal and Tax-induced gene expression
following transfection of Jurkat cells. There were no significant
differences in the level of gene expression with these constructs as
compared to the wild-type HTLV-I construct (Fig. 10). These
results suggest that even though CREB is able to induce bending of the
21-bp DNA, DNA bending does not result in overall changes in the
structural integrity of the HTLV-I LTR which alter interaction between
the different 21-bp repeats.
Figure 10:
Alterations in spacing between the 21-bp
repeats does not alter the levels of basal and Tax-mediated HTLV-I gene
expression. A, the wild-type HTLV-I LTR (lane 1) or
three other constructs with deletions either between 21-bp repeat I and
II (lane 2), 21-bp repeats II and III (lane 3), or
21-bp repeat II and the TATA box (lane 4) were assayed
following transfection of Jurkat cells in both the presence (+)
and absence(-) of Tax. Cells were harvested and the
chloramphenicol acetyltransferase activity was determined following
normalization of extracts with a
However, the sequences flanking the CRE
in the 21-bp repeat are critical for Tax activation. Wild-type and
mutant HTLV-I constructs and the somatostatin CRE were assayed
following transfection of these constructs in either the presence or
absence of Tax. The constructs that were assayed included the wild-type
HTLV-I LTR, HTLV-I LTR mutants in which the A (NBC), C (ABN), or A and
C (NBN) sequences flanking the 21-bp repeat CRE were mutated, an HTLV-I
hybrid in which the CRE in each of the 21-bp repeats was changed to the
somatostatin CRE sequences but the 21-bp repeat flanking sequences were
maintained, and the somatostatin CRE (Table 2). These results
demonstrated that Tax increased HTLV-I gene expression 6.5-fold, while
mutations of either one (NBC and ABN) or both (NBN) of the flanking
sequences in the 21-bp repeats resulted in nearly a complete loss of
Tax activation (Table 2). Mutations which change each of the CRE
sites in the HTLV-I 21-bp repeats to that of the somatostatin CRE
resulted in approximately a 3-fold increase in Tax activation as
compared to the wild-type HTLV-I LTR (Table 2). Finally, gene
expression of the somatostatin promoter was not activated by Tax (Table 2). These results indicate that Tax activation is
dependent on the sequences flanking the 21-bp repeat CRE and
demonstrate that in vivo Tax activation correlates with the
ability of CREB to bend DNA in phasing analysis.
Each of the three 21-bp repeats in the HTLV-I LTR contain a
non-palindromic CRE (16, 17, 51) which serve
as the binding site for members of the ATF/CREB family. Tax stimulates
CREB binding to each of these 21-bp repeats and this effect is likely
critical for subsequent Tax activation of gene expression. However, Tax
only weakly stimulates CREB binding to the palindromic CRE found in the
somatostatin promoter indicating that differences in DNA sequences
between the 21-bp repeat and the somatostatin CRE are critical for Tax
stimulation. Previous studies indicate that a variety of bZIP proteins
such as Fos and Jun are able to induce a variety of topologically
distinct DNA structures at AP-1 binding
sites(35, 36, 37) . For example, Fos-Jun
heterodimers and Jun homodimers induce DNA bends that are directed in
opposite orientations (36) whereas CREB and ATF1 do not induce
significant bending when bound to the CRE
site(36, 37) . Since CREB is a classical bZIP protein (33, 34) and stimulation of its binding to the HTLV-I
21-bp repeats by Tax is highly sequence dependent, it was important to
delineate whether CREB induces DNA structural changes in the HTLV-I
21-bp repeat as compared to the somatostatin CRE. The role of the CRE versus flanking DNA sequences was also addressed. Furthermore,
we wished to determine whether DNA bending was associated with the
ability of Tax to stimulate CREB binding to DNA. Circular
permutation analysis indicates that CREB induces DNA structural
distortion in the HTLV-I 21-bp repeat, the somatostatin CRE, and a
hybrid CRE comprised of the somatostatin CRE flanked by the A and C
motifs from the 21-bp repeats. However, Tax does not change the pattern
of CREB-induced DNA structural distortion although it is able to
markedly stimulate CREB binding to the 21-bp repeat and hybrid CRE. A
variety of previous studies indicate that circular permutation analysis
will detect changes in DNA flexibility rather than directed DNA binding
which is detected by phasing analysis. For example, several members of
the ATF/CREB family have been shown to induce marked changes of CRE DNA
flexure in circular permutation analysis although they induce no
changes in phasing analysis(37) . Likewise the helix-loop-helix
proteins TFEB, TFE3, USF, Myc, and Max induce significant DNA flexure
using circular permutation analysis(56, 57) . Phasing
analysis demonstrates that TFEB, TFE3, USF, Max, and Myc-Max dimers
bend DNA in the same orientation (56) and Myc homodimers bend
DNA in the opposite orientation (57) although these proteins
induce relatively small DNA bending angles. Phasing analysis was
performed to determine the degree of CREB-induced DNA bending and the
orientation of this bending. The results using phasing analysis
indicate that CREB induces modest but reproducible directed DNA bending
of the 21-bp repeat and the hybrid CRE, but does not induce bending of
the somatostatin CRE. These results support previous observations that
circular permutation analysis is not a reliable method for the
determination of directed DNA bends and that although ATF/CREB proteins
induce DNA mobility variation in circular permutation analysis they are
unable to induce directed DNA bending in CRE site or in AP-1
sites(37, 38) . The inability of CREB to induce
bending of the CRE has been suggested to result from intrinsic bending
of the CRE sequence into a conformation that enhances CREB binding (38) . Our results are in agreement with this previous study
and indicate that the somatostatin CRE is pre-bent but the binding of
CREB eliminates this bending. Circular dichroism spectroscopy
demonstrates that the DNA-binding domains of several bZIP proteins
undergo conformational transitions to structures of a high helix
content in the presence of their cognate DNA-binding
site(58, 59, 60) . Since CREB binding induces
different DNA structural changes in the HTLV-I 21-bp repeat and
somatostatin CRE, it is possible that the CREB protein adopts different
conformations upon binding to different DNA binding sites. According to
thermodynamic principles, a conformational change in the 21-bp repeat
and the hybrid CRE, which is dependent on the sequences found in the A
and C motifs, could generate an energy barrier preventing efficient
CREB binding. This may explain why CREB binding to the pre-bent CRE
site occurs with higher affinity than to the unbent CRE sequences found
in the 21-bp repeat. A similar mechanism ocurs with TBP which binds to
pre-bent DNA with 100-fold higher affinity than unbent DNA of identical
sequence(61) . Although Tax does not alter the CREB-induced DNA
bending angle, it may alter the CREB conformation to overcome a high
energy barrier to CREB binding to the 21-bp repeat. One of the
intriguing features of this study is that prolonged electrophoresis of
the 21-bp repeat and the hybrid CRE during gel electrophoresis results
in dissociation of CREB in the absence but not the presence of Tax.
However, no similar effect is seen with prolonged electrophoresis of
CREB binding to the somatostatin CRE. These results suggest that Tax
increases the stability of CREB binding to the 21-bp repeat and the
hybrid CRE. Whether this effect is mediated by the presence of Tax in
the DNA complex with CREB or whether Tax induces a conformational
change in CREB remains to be determined. The inability in many studies
to supershift Tax in the complex with CREB would favor the latter
possibility(26, 27, 28, 31) . The
failure of Tax to change the CREB-induced bending angle of the 21-bp
repeat and hybrid CRE would also be consistent with the presence of
CREB alone in the complex bound to DNA. However, these possibilities
need to be addressed by performing structural studies of the CREB-Tax
complex bound to different CRE sites. Our results support previous data
that subtle differences in the DNA structure of CRE and AP-1 sites
result in marked differences on the binding and subsequent bending by
the bZIP family of proteins(37, 38) . DNA bending
may promote or inhibit the binding of proteins that recognize
overlapping or adjacent DNA elements. Intrinsic DNA bends have been
shown to markedly influence DNA binding by several eucaryotic
transcription factors(62) . Therefore, CREB binding to the
21-bp repeat and subsequent induction of DNA bending may help to
recruit a variety of cellular transcription factors or prevent
inhibitors from binding to this important regulatory element. Cellular
transcription factors which are recruited to CREB bound to the 21-bp
repeat may be important in the regulation of HTLV-I gene expression.
For example, it will be critical to address whether factors such as
p300 which are able to associate with phosphorylated form of CREB (63) are able to bind to the 21-bp repeat. However, our results
indicate that CREB-induced DNA bending is dependent on the sequences
flanking the CRE and that these sequences are also critical for Tax
activation. Future studies will be required to better understand the
role of cellular factors which bind to the HTLV-I LTR and how changes
in the DNA structure modulate HTLV-I gene expression.
Volume 271,
Number 9,
Issue of March 1, 1996 pp. 4781-4790
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
)is a
human retrovirus which is the etiologic agent of adult T-cell
leukemia/lymphoma (1, 2) and a degenerative neurologic
syndrome designated tropical spastic
paraparesis(3, 4) . The 40-kDa viral transactivator
protein, Tax, is critical for modulating HTLV-I gene expression (5, 6, 7, 8) and is also involved in
the cellular transformation by
HTLV-I(9, 10, 11) . In addition, Tax also
activates the expression of several viral and cellular genes including
interleukin-2, the interleukin-2 receptor 
, c-fos, and
the HIV-I LTR(12, 13, 14, 15) .
Thus, Tax is an important modulator of both viral and cellular gene
expression.
B (13, 15, 23, 24) while Tax
activation of the c-fos and the parathyroid hormone-related
protein genes are controlled by modulation of the cellular factors SRF
and AP-2, respectively(14, 25) . Thus, it is likely
that Tax may either directly or indirectly interact with a variety of
different transcription factors to increase the gene expression from
Tax-responsive genes.
O protein (45) and a variety of eucaryotic transcriptional
regulators including the Drosophila heat-shock transcription
factor(26) , Xenopus transcription factor
IIIA(46) , and the Jun-Fos containing AP-1
complex(35) . Furthermore, induction of DNA bending by these
transcription factors is not a mere side effect of DNA-protein complex
formation, but it is of functional significance in many
instances(47, 48) . Since several bZIP proteins can
induce distinct changes in DNA structure upon stable binding to their
cognate binding sites(35, 36) , we wished to determine
whether CREB could induce DNA bending of either the HTLV-I 21-bp repeat
or the somatostatin CRE. Furthermore, we wanted to determine whether
Tax was able to facilitate CREB-mediated DNA bending using both
circular permutation and phasing analysis. Our results using phasing
analysis indicate that CREB is able to induce directed DNA bending of
both the HTLV-I 21-bp repeat and a hybrid construct containing the
somatostatin CRE flanked by the 21-bp repeat A and C motifs. However,
CREB does not induce DNA bending of the somatostatin CRE. Although Tax
markedly stimulates both the amount and stability of CREB bound to the
HTLV-I 21-bp and the hybrid CRE, it does not itself modify CREB-induced
DNA bending. These results suggest that the A and C motifs flanking the
CRE are critical for CREB-induced structural changes in the 21-bp
repeat. Such structural changes in the 21-bp repeats are likely
important for CREB-mediated induction of HTLV-I gene expression.
Plasmid Constructs
Oligonucleotides containing
the HTLV-I LTR 21-bp III(26) , somatostatin CRE(49) ,
and the hybrid somatostatin CRE(30) /21-bp repeat were cloned
into the SalI site of the circular permutation vector pBend2 (39) to generate the derivative plasmids pBend-21 bp repeat,
pBend-CRE, and pBend-hybrid CRE, respectively. The sequences of the
sense strand of each of the oligonucleotides are: 21-bp III,
5`-TCGACAGGCGTTGACGACAACCCCT-3`; somatostatin CRE,
5`-TCGACCTTGGCTGACGTCAGAGAGA-3`; and the hybrid,
5`-TCGACAGGCTGACGTCACAACCCCT-3`.
5 bp I),
GTGTCCCCCTGAAGACAAAAGCTCAGACCTCCGGGAAG (5 bp II-III),
CCATTTCCTCCCCATGTTTGCCGCCCTCAGGCGTTGAC (5 bp III-TATA),
GGCGTTGACGACAACCCCTCAAAAAACTTTTCATGGCA (5 bp 4). The HTLV-I LTR
containing the hybrid CRE was also made by in vitro mutagenesis (Amersham). The oligonucleotide primers used to change
each of the 21-bp repeats were:
5`-CCTCCTCAGGCGCTGACGTCAGCCCCTCACCTC-3`,
5`-CGGGCTAGGCGCTGACGTCAGCCCCTGAAGAC-3`,
5`-CCAGACTAAGGCGCTGACGTCAGCCCCCGGAGGG-3`. The resulting products from
all in vitro mutagenesis reactions were confirmed by DNA
sequencing. The construction of the ANC, ABN, and the NBN constructs
were previously described(50) . Each of the mutants was
reinserted into the HTLV-I LTR chloramphenicol acetyltransferase
construct. The somatostatin promoter chloramphenicol acetyltransferase
construct was described previously(49) .Gel Electrophoresis
Oligonucleotides containing
HTLV-I 21-bp III, somatostatin in CRE, and the hybrid CRE were
end-labeled using polynucleotide kinase and
[-
P]ATP. The labeled DNA probes (50,000
cpm) were incubated with bacterial produced CREB in the absence or
presence of 50 ng of Tax protein at room temperature for 20 min. The
purification of the Tax and CREB proteins were previously
described(26) . The DNA-protein complexes were then subjected
to electrophoresis on 5% polyacrylamide gels in 0.25
TBE and
the gels were dried and subjected to autoradiography.P, and gel purified. The DNA-protein
complexes were then analyzed as described for the circular permutation
assays.
Protein Purification
The full-length
histidine-tagged CREB and Tax cDNAs were cloned into pQE60 (Qiagen)
vector and the resultant plasmids were transformed into the E. coli strain M15 (pREP 4)(26) . 400-ml cultures of E. coli were grown to an optical density of 600 of 0.6-0.8 and
induced with 0.5 mM isopropyl-1-thio-
-D-galactopyranoside for 3 h. Cells
were pelleted, resuspended in buffer A (50 mM Tris-HCl, pH
8.0, 100 mM NaCl, 0.1 mM phenylmethylsulfonyl
fluoride), mildly sonicated, and the debris were pelleted. The cell
lysate was incubated with 1 ml of Ni-NTA agarose (Qiagen) for 60 min at
4 °C. The proteins were eluted with elution buffer (5 mM Tris-HCl, pH 8.0, 100 mM NaCl, 1 mM dithiothreitol, 1 mM EDTA) containing from 150 to 500
mM imidazole. The proteins were dialyzed against buffer
containing (10 mM Tris-HCl, pH 8.0, 50 mM NaCl, 10%
glycerol, 1 mM dithiothreitol, 0.1 mM phenylmethylsulfonyl fluoride) and stored at -80 °C.Quantitation of DNA Distortion and Bending
To
determine the DNA flexure angle, we calculated the best fit of a cosine
function to relative mobilities of circular permutation analysis
complexes as described previously(35) . We have derived a
relation between the circular permutation function amplitude
(A) and DNA flexure angle (
) from the
dependence of electrophoretic mobility on end-to-end-distance,
, minimum mobility with the bend at the bend
at the middle; µ
, the maximum mobility with the bend
at the end. The relative electrophoretic mobilities are influenced by a
number of factors, including temperature, gel composition, fragment
length, and electrical field strength. To account for these factors, we
have introduced a coefficient into the function:
= 1
and substituting µ = 1-A, and
= , we obtain
) and
the directed DNA bend angle (
) from the dependence of
electrophoretic mobility on end-to-end distance ()(35) . We substitute,
is the amplitude of phasing function,
is the intrinsic DNA bend angle, is the
protein-induced bend angle, and plus is less than 120°. Determination of the absolute orientation
is derived from (37) ,
is the DNA bend orientation relative to
the major groove-minor groove axis. S
is the transspacer
length, P is phasing period.
Transfections and Chloramphenicol Acetyltransferase
Assays
Jurkat cells were maintained in RPMI containing 10% fetal
bovine serum with penicillin and streptomycin. DEAE transfections were
performed by adding 5 µg of either the wild-type or mutant HTLV-I
constructs in both the presence and absence of 1 µg of a wild-type
or mutated Tax expression vector and a -galactosidase control
plasmid (50) . Cells were harvested after 48 h and one-fourth
of each of the cell extract, normalized for -galactosidase
activity, was used for chloramphenicol acetyltransferase assays. All
transfections were repeated three times.
Tax Stimulates CREB Binding to the HTLV-I 21-bp Repeat
but Not to the Somatostatin CRE
Each of the HTLV-I 21-bp repeats
contain non-palindromic CRE sites in contrast to the palindromic sites
found in the somatostatin
promoter(17, 49, 51) . Before analyzing the
role of CREB and Tax on inducing DNA structural changes of the 21-bp
repeat and the somatostatin CRE, gel retardation analysis was performed
with each of these elements to compare the binding of the bacterial
expressed CREB in both the presence and absence of Tax. CREB bound
weakly to oligonucleotides corresponding to 21 bp repeat III (Fig. 1A, lanes 2 and 4). In contrast, a much
greater degree of CREB binding to somatostatin CRE was observed (Fig. 1A, lanes 7 and 9). Tax was able to
markedly stimulate CREB binding to HTLV-I 21-bp repeat III using both
low and high concentrations of CREB (Fig. 1A, lanes 3 and 5). Similar results were also noted using 21-bp
repeats I and II (data not shown). In contrast, there was little (Fig. 1A, lanes 7 and 8) or no (Fig. 1A, lanes 9 and 10) Tax-induced
stimulation of CREB binding to the somatostatin CRE. Since the A and C
motifs flanking the B motif in the 21-bp motif are critical for Tax
activation, hybrid oligonucleotides which contained these motifs
flanking the palindromic CRE from the somatostatin promoter were tested
for their ability to bind CREB in the presence and absence of Tax. Tax
was able to stimulate the binding of CREB to the hybrid CRE (Fig. 1A, lanes 12-15) indicating the critical
nature of sequences flanking the CRE for Tax-mediated stimulation of
CREB binding. An amino-terminal truncation of Tax which did not
interact with CREB using the mammalian two-hybrid system (26) was unable to stimulate CREB binding to the 21-bp repeat
indicating the specificity of Tax stimulation (Fig. 1B,
lanes 2-4). Although Tax markedly stimulated CREB binding,
no slower mobility complex potentially comprised of both the Tax and
CREB proteins was detected.
CREB Induces DNA Structural Changes in the HTLV-I 21-bp
Repeat, Hybrid CRE, and the Somatostatin CRE
Since an increasing
number of both procaryotic and eucaryotic transcription factors have
been demonstrated to mediate interactions by bending DNA upon binding
to their recognition sites, we wanted to determine whether CREB alone
or in the presence of Tax resulted in DNA structural changes. Bending
of DNA upon the binding of transcription factors can be detected by the
anomalous migration of protein-DNA complexes in polyacrylamide gels (40) . Thus, anomalous migration is maximized when the
DNA-protein binding site is located in the center of a fragment and
minimized when it is located near the end of the
fragment(35, 40, 42, 43, 44, 45, 46, 47) .
Oligonucleotides containing either the HTLV-I 21-bp repeat, the
somatostatin CRE, or the hybrid CRE were cloned into the pBend2 vector (39) and used to perform circular permutation
analysis(43) . Digestion with a number of different restriction
endonucleases generated fragments of identical size (145 bp), which
varied in the position of the DNA binding site (Fig. 2).
Phasing Analysis Demonstrates that CREB Induces DNA
Bending of the 21-bp Repeat and the Hybrid CRE but Not the Somatostatin
CRE
Circular permutation analysis does not allow a determination
of specific DNA bending, because it also detects distortion in DNA
structure such as regions of increased DNA flexibility. Phasing
analysis introduces an approach for determining the relative DNA
bending angle and the direction of the DNA bend by using isomers
containing helical phasing between two DNA bends(41) . It
provides a more specific method for the analysis of DNA bending
allowing discrimination between directed DNA bends and regions of
increased DNA flexibility(52) . In addition, the orientation of
the bend relative to the reference standard in the fragment can be
determined.
Alterations in Spacing of the HTLV-I 21-bp Repeats does
Not Alter Basal and Tax-induced Gene Expression
Examination of
the HTLV-I LTR indicates that there is an exact 80-bp spacing between
the B motifs in the three 21-bp repeats thus placing the three 21-bp
repeats on the same side of the DNA helix(17, 51) .
The transcription factor YY1 binds to three sites in the c-fos promoter and induces a phased DNA bend that facilitates
interactions between CRE and TATA binding sites(53) . Insertion
of 5 bp of DNA between either the YY1 or CREB binding sites and the
TATA element in the c-fos promoter place the YY1 and CREB
sites on opposite sides of the DNA relative to the TATA
element(53) . This insertion resulted in changes in
transcription indicating that YY1 functions to maintain optimal spacing
between the CRE and the TATA element(53) . Similar dependence
on DNA structure has been noted with other transcription factors such
as LEF-1 (54) and HMG I(Y)(55) .
-galactosidase internal control. B, a schematic of these constructs is also
shown.
)
We thank Sharon Johnson for manuscript preparation and
Susan Vaughn for preparation of the figures.
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  J. R. Lundblad, R. P. S. Kwok, M. E. Laurance, M. S. Huang, J. P. Richards, R. G. Brennan, and R. H. Goodman The Human T-cell Leukemia Virus-1 Transcriptional Activator Tax Enhances cAMP-responsive Element-binding Protein (CREB) Binding Activity through Interactions with the DNA Minor Groove J. Biol. Chem., July 24, 1998; 273(30): 19251 - 19259. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. K. Swamynathan, A. Nambiar, and R. V. Guntaka Role of single-stranded DNA regions and Y-box proteins in transcriptional regulation of viral and cellular genes FASEB J, May 1, 1998; 12(7): 515 - 522. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||
