In eukaryotic cells, regulation of the cell cycle is under the control of a tightly regulated network of protein kinases and phosphatases. Phosphorylation/dephosphorylation on Thr, Tyr, and Thr of Cdc2, the catalytic subunit of the mitosis-promoting factor regulates the kinase activity and therefore ensures the proper timing of mitosis(1, 2, 3, 4) . Phosphorylation of Tyr plays an important role in the negative regulation of Cdc2 and is carried out by the protein kinase Wee1(5, 6) . A stimulatory phosphorylation event is modulated by a Cdk ()activation kinase, which phosphorylates Thr(7, 8) . In Schizosaccharomyces pombe, as a protein dual specific phosphatase, Cdc25 acts as a mitotic inducer by removing the phosphate from Tyr and Thr on Cdc2 and activating the activity of the mitosis-promoting factor(9, 10, 11, 12, 13) .

Three different isoform cdc25 genes have been cloned in mammalian or human cells(14, 15) . In HeLa cells, human cdc25C is expressed predominantly in the G phase (14) and has been shown to activate the histone H1 kinase activity of pcdc2-cyclin B complex by dephosphorylation of Tyr and Thrin vitro(12, 13, 16) . Therefore, it is very likely that Cdc25C functions at the G to M transition. On the other hand, microinjection of anti-Cdc25A antibodies in G cells blocks entry into S-phase, suggesting the implication of Cdc25A for the regulation of the S-phase entry(17, 18) .

The phosphatase activity of Cdc25 proteins is regulated by extensive phosphorylation of its NH-terminal regulatory domain(16, 17, 19) . The Cdc25C stimulatory kinase has been examined and identified to be Cdc2-cyclin B(16, 20) . During interphase, Cdc25C has very weak phosphatase activity and becomes much more active at the G-M transition due to its phosphorylation. Human Cdc25A also undergoes a similar phosphorylation event during the G/S transition and exhibits an elevated phosphatase activity(17, 18) .

Recently, the catalytic mechanism of the protein-tyrosine phosphatases and dual specific phosphatases have been the subject of many biochemical and biophysical studies(21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31) . An invariant active site cysteine residue that is essential for the enzymatic activity has been identified in all the protein-tyrosine phosphatase and dual specific protein phosphatases studied up to now. In many cases, a phosphoenzyme intermediate is present during the enzymatic reaction, indicating the formation of a thiophosphate. Sequence alignments of various tyrosine and dual specific phosphatases suggest that they all contain a putative catalytic domain of about 170 amino acids(22, 32) . Within the catalytic domain, there is a highly conserved HCXXXXXR signature motif. Crystal structures of human protein-tyrosine phosphatase 1B (28, 31) and Yersinia protein-tyrosine phosphatase (33) have suggested that the conserved active site motif that contains the catalytic cysteine forms a phosphate binding loop (P loop) in a conformation that is similar to each other. Most recently, based on crystal structure of Yersinia protein-tyrosine phosphatase (33) and mutagenesis studies of vaccinia H1-related dual specific phosphatases (32) , a highly conserved aspartic acid residue was proposed to act as a general acid to protonate the leaving group in the step of the formation of the enzyme-phosphate intermediate.

In this study, we showed that the active site residues residing in the putative P loop of human Cdc25A and -B proteins play important roles in the catalysis and protein interactions between Cdc25 proteins and various cyclin-Cdk complexes. We also revealed the in vitro substrate specificity of Cdc25A and -B regarding different cyclin-Cdk complexes.

MATERIALS AND METHODS

Site-directed and Deletion Mutagenesis in Human cdc25 Genes

()

Site-specific mutagenesis was performed using PCR by Gene Amp PCR reagent kit with AmpliTag DNA Polymerase (Perkin-Elmer). A nucleotide primer overlapping the initiation codon and containing the BamHI site was used as the 5`-primer (5`-CCCCGGATCCATGGAGGTGCCCCAGCCGGAGCC), whereas a primer (5`- ATGAGAATTCAGAGTGGAAAATG) overlapping both the Cys and an adjacent EcoRI site was used as the mutagenic 3`-primer. The C446S mutant cdc25B GST fusion protein was constructed by replacing the BamHI/EcoRI fragment of the wild-type cdc25B gene with the BamHI/EcoRI PCR fragment containing the C446S mutation. The H445N, S449A, and E451Q mutations were generated in a fashion similar to C446S. The R452A mutant cdc25B was generated by recombinant PCR technique (34) . Briefly, the full-length cdc25B containing the Arg to Ala mutation was made by PCR reaction using the heteroduplex formed by two overlapping primary PCR products as the template and primed with two external PCR primers. The 1.62-kilobase PCR product containing the full-length cdc25B was digested by BamHI and HindIII and ligated to PGEX 2T treated with the same restriction enzymes.

The N-(351-540) Cdc25B, N-(366-540) Cdc25B, and N-(336-523) Cdc25A carboxyl-terminal Cdc25 proteins were also generated by PCR technique. The reactions were primed by primers that contain a BamHI site with the 5` sequence of the gene and primers that contain the 3` sequence of the gene, the stop codon, and the HindIII site. To generate the C446S and C430S mutations in N-(351-540) Cdc25B and N-(336-523) Cdc25A, the C446S cdc25B and C430S cdc25A were used as the PCR templates.

All of the mutations were confirmed by DNA sequencing.

Production and Purification of the Cdc25 GST Fusion Proteins in E. coli and the Thrombin Cleavage of the GST Fusion Protein

Bovine thrombin from Calbiochem was used to remove the GST moiety from the N-(351-540) Cdc25B GST fusion protein. The thrombin-cleaved N-(351-540) Cdc25B contains a glycine and serine next to the methionine at the amino terminus. After the thrombin reaction, the protein was further purified by a Superdex 75 HR 10/30 Gel filtration column on a Pharmacia fast protein liquid chromatography system.

pNPP Phosphatase Assays

Cell Culture, Synchronization, and Extracts

Immunoblot Analysis and Immunoprecipitation

Immunoprecipitation by anti-cyclin A and anti-cyclin B antibodies was performed with 5 mg of HeLa cell lysate, antiserum and protein A-Sepharose at 4 °C for 1 h. To test the phosphatase activity of Cdc25, the immunoprecipitates were incubated with 50 µg of GST fusion Cdc25 protein for 1 h. The protein A-Sepharose beads were then washed extensively with lysis buffer. The proteins eluted from the beads were separated on SDD-PAGE and subjected to immunoblot.

RESULTS

Function of Cys, Arg, and His of Human Cdc25B Proteins in Enzymatic Catalysis and Interaction with Cyclin-Cdk Complex

Figure 1: Domain alignment of human Cdc25A and -B. Gray box indicates the putative catalytic domain of Cdc25A and -B. Black box highlights the invariant catalytic site amino acid (P loop)(28) . The residues that have been mutated in this study are highlighted in boldface type.

To test the phosphatase activity of the mutant Cdc25B proteins on cyclin-Cdk complex, the in vivo substrate of Cdc25 proteins, cyclin A-cdc2, or cyclin B-Cdc2 protein kinase complexes was purified from HeLa lysate by immunoprecipiatation with anti-cyclin A and anti-cyclin B antibodies. When analyzed on Western blot, by anti-Cdc2 antibody, Cdc2 proteins that associate with cyclin A or cyclin B proteins were found to be mainly the tyrosine-phosphorylated species, the slower migrating band on the SDS gel when compared with the nonphosphorylated Cdc2 marker purified from E. coli(1) (see Fig. 2, A, lanes 1 and 2, and B, lanes 1 and 2). Upon incubation with wild-type Cdc25B protein, a fast migrating Cdc2 appeared, indicating the dephosphorylation of Tyr on Cdc2 (Fig. 2, A, lane 3, and B, lane 4). Both C446S (Fig. 2, A, lane 4, and B, lane 3) and R452A Cdc25B proteins (Fig. 2, A, lane 5, and B, lane 5) failed to dephosphorylate Cdc2 in this experiment.

Figure 2: Dephosphorylation of cyclin B-Cdc2 (A) and cyclin A-Cdc2 (B) by wild-type and mutant Cdc25B proteins. Cyclin B/Cdc2 and cyclin A/Cdc2 kinase complexes were immunoprecipated by anti-cyclin A or cyclin B antibodies and then incubated with Cdc25B proteins. The proteins eluted by 2 SDS sample buffer were separated by a 12% SDS-PAGE and immunoblotted using an anti-Cdc2 antibody. A, Cdc2 protein purified from E. coli was used as a marker in lane 1. Cyclin A-Cdc2 complex was treated by buffer alone (lane 2), wild-type Cdc25B (lane 3), C446S Cdc25B (lane 4), and R452A Cdc25B (lane 5). B, lane 1 is the Cdc2 protein isolated from E. coli. Cyclin B-Cdc2 complex was treated by buffer alone (lane 2), C446S Cdc25B (lane 3), wild-type Cdc25B (lane 4), and R452A Cdc25B (lane 5).

To test whether the C446S and R452A Cdc25 catalytic mutant enzymes retained their abilities to bind substrates and thus form a nonproductive stable enzyme-substrate complex, we designed and performed the following experiments. Wild-type, C446S, and R452A Cdc25B GST-fusion proteins were incubated with HeLa cell lysates. GSH-Sepharose 4B beads were added to the extracts and incubated at 4 °C for 1 h. After incubation, the beads were extensively washed with lysis buffer, and proteins eluted by Laemmli buffer were analyzed by SDS-PAGE and immunoblotting. Blots were probed with anti-human cyclin A and Cdk2 antibodies to identify the cyclin-Cdk complexes that were possibly trapped by these two mutant enzymes. As shown in Fig. 3, the C446S was able to bind significant amounts of human cyclin A (Fig. 3A, lane 3) and Cdk2 (Fig. 3B, lane 3) proteins. Neither R452A (lane 2 of Fig. 3, A and B) nor the wild-type Cdc25B protein (lane 4 of Fig. 3, A and B) formed stable complexes with cyclin A or Cdk2. Binding of the cyclin A and Cdk2 proteins with C446S mutant Cdc25B protein was specific, since the control GST protein could not bind to either cyclin (Fig. 3A, lane 5) or Cdk proteins (Fig. 3B, lane 5).

Figure 3: The cyclin A-Cdk2 complex forms a stable association with C446S Cdc25B, not R452A Cdc25B. 50 µg of GST fusion Cdc25B proteins were incubated with 2 mg of HeLa cell lysates at a concentration of 4 mg/ml as described under ``Materials and Methods.'' The proteins were eluted from the GSH-Sepharose 4B beads by 2 SDS sample buffer and loaded onto a 12% SDS-PAGE and Western blotted with anti-cyclin A antibody (A) and Cdk2 antibody (B). Lane 1 contains HeLa cell lysates. Proteins that were eluted from wild-type Cdc25B (lane 2) were analyzed along with C446S Cdc25B (lane 3), R452A Cdc25B (lane 4), and GST (lane 5). Shown in panel C is the anti-phosphotyrosine immunoblot of proteins eluted from C446S Cdc25B by 2 M NaCl (lane 1), incubated with Cdc25B in the absence of vanadate (lane 2) or in the presence of vanadate (lane 3).

Furthermore, Cdc25B C446S clearly prefers the tyrosine/threonine-phosphorylated form of Cdk2 and Cdc2 proteins. Gu et al.(40) have shown that tyrosine/threonine-phosphorylated Cdk2 tends to migrate faster on an SDS gel than the unphosphorylated Cdk2 protein. The majority of the Cdk2 proteins that are trapped by Cdc25B C446S are in the fast migrating form (Fig. 3B, lanes 1 and 3). In order to confirm that this fast migrating Cdk2 form is tyrosine-phosphorylated, cyclin A and Cdk2 proteins that were bound to C446S Cdc25B were eluted from the GSH-Sepharose 4B with 2 M NaCl. The eluted proteins were then treated by Cdc25B in the presence or absence of sodium vanadate. The samples were separated on SDS-PAGE and immunoblotted with anti-phosphotyrosine antibody. As shown in Fig. 3C, Cdk2 interacted with anti-phosphotyrosine antibody (Fig. 3C, lane 1), and this signal was abolished by incubating eluted proteins with Cdc25B (Fig. 3C, lane 2). The dephosphorylation of tyrosine phosphate on Cdk2 by Cdc25B could be prevented by sodium vanadate (Fig. 3C, lane 3). These observations are consistent with the idea that human Cdc25 proteins are the protein-tyrosine phosphatases that dephosphorylate Tyr on cyclin-Cdk complexes. Therefore, the tyrosine-phosphorylated form of cyclin and Cdk complexes should be the major species that bind to the dominant negative Cdc25 proteins since they are the substrates of the enzymes.

Ser in the Putative Catalytic Loop (P Loop) Plays an Important Role in the Interaction with Cyclin-Cdk Complexes

To test whether Ser or Glu are important for the interaction between Cdc25 and cyclin-Cdk complex, we generated the C446S/S449A and C446S/E451Q double mutations in human Cdc25B. The C446S mutation should eliminate the phosphatase activity of Cdc25 and therefore provide us the opportunity to study the effect of S449A and E451Q mutations on the interaction between Cdc25B and cyclin A-Cdk2 complex. We tested the binding of the double mutant proteins with cyclin A and Cdk2 in Western blots. As shown in Fig. 4, while C446S/E451Q double mutant protein interacts with both cyclin A and Cdk2 proteins, C446S/S449A lost its ability to bind either cyclin A or Cdk2.

Figure 4: The S449A mutation disrupts the interaction between Cdc25B and the cyclin A-Cdk2 complex. GST fusion proteins of E451Q/C446S and S449A/C446S Cdc25B double mutants were incubated with 10 mg of HeLa cell lysates at a concentration of 5 mg/ml and then affinity-purified by GSH-Sepharose 4B beads. Cyclin A-Cdk2 complex associated with Cdc25B proteins were analyzed by immunoblotting with anti-cyclin A (A) and Cdk2 (B) antibodies. In both panels A and B, lane 1 is the HeLa cell lysates. Lanes 2 and 3 are the samples of E451Q/C446S and S449A/C446S double mutants. Lane 4 contains the GST protein sample that has been incubated with the HeLa cell lysates.

In Vitro Substrate Specificity of Human Cdc25A and Cdc25B Proteins

Figure 5: In vitro substrate specificity of Cdc25A and -B asynchronized or hydroxyurea-arrested HeLa cell lysates at 2 mg/ml concentration were incubated with C446S Cdc25B and C430S Cdc25A. Shown in panels A and B are the Western blots by anti-cyclin A and anti-Cdk2 antibodies. Lanes 1 and 2 are the asynchronized and hydroxyurea-arrested HeLa cell lysates. Lanes 3, 5, and 7 are the GST, C430S Cdc25A, and C446S Cdc25B proteins that have been incubated with asynchronized HeLa cell lysates. Lanes 4, 6, and 8 are the GST, C430S Cdc25A, and C446S Cdc25B proteins that have been incubated with hydroxyurea-arrested HeLa cell lysates. Western blots developed by anti-cyclin B and Cdc2 antibodies are shown in panels C and D. Lane 1 is the asynchronized HeLa cell lysate. Lanes 2, 4, and 6 are the GST, C430S Cdc25A, and C446S Cdc25B proteins that have been incubated with asynchronized HeLa cell lysates. Lanes 3, 5, and 7 are the GST, C430S Cdc25A, and C446S Cdc25B proteins that have been incubated with hydroxyurea-arrested HeLa cell lysates.

We also tested the possible interaction between cyclin E, C430S Cdc25A and C446S Cdc25B proteins. As observed in Fig. 6, Cdc25A C430S interacted strongly with cyclin E when incubated with HeLa lysates at concentrations of either 4 mg/ml (Fig. 6A, lane 2) or 10 mg/ml (Fig. 6B, lane 1). Under the same experimental conditions, no interactions or very weak interactions between Cdc25B C446S and cyclin E proteins were observed (Fig. 6, A, lane 3, and B, lane 2). These results suggested that when compared with Cdc25B protein, Cdc25A has a much stronger interaction with cyclin E-Cdk2 complex, which is the major kinase present during the G phase(42) . Significant amounts of cyclin E and Cdk2 proteins were also found to interact with wild-type Cdc25A protein (see Fig. 6, C and D, lane 4).

Figure 6: Interactions between Cdc25A and cyclin E or Cdk2. A and B, Western blots developed by anti-human cyclin E antibodies. In A, lane 1 is HeLa cell lysate. Lanes 2, 3, and 4 are the C430S Cdc25A, C446S Cdc25B, and GST proteins incubated with 2 mg of HeLa cell lysates at a concentration of 4 mg/ml. In B, lanes 1, 2, and 3 are the C430S Cdc25A, C446S Cdc25B, and GST proteins incubated with 5 mg of HeLa cell lysates at a concentration of 10 mg/ml. Shown in C and D are the immunoblots of anti-cyclin E and anti-Cdk2 antibodies. Lane 1 is the HeLa cell lysate. Lanes 2, 3, and 4 are GST, C430S, and wild-type Cdc25A proteins that have been incubated with 5 mg of HeLa cell lysate at a concentration of 10 mg/ml.

The Catalytic Domain of Human Cdc25A and -B Resides in the Carboxyl Terminus of the Protein

To measure the kinetic parameters of the native catalytic domain of human Cdc25B, the protease, thrombin, was used to remove the GST moiety from the N-(351-540) Cdc25B GST fusion protein. After gel filtration purification on Superdex 75 column, the purity of the native Cdc25B catalytic domain was over 90%. When assayed with pNPP as substrate at pH 8.0, the enzyme showed a maximal velocity of 500 µM/mg min and a K of 4 mM.

Since it would be interesting to know whether the amino terminus of Cdc25 proteins contributes to the interactions between Cdc25 and the cyclin-Cdk complex, we mutated the catalytic cysteine residue to a serine in the catalytic domain of Cdc25B and tested whether this mutant protein could still interact with cyclin A and Cdk2 proteins. After incubation with HeLa cell lysate at two different concentrations, 4 and 10 mg/ml, we analyzed the results on immunoblots using anti-cyclin A and Cdk2 antibodies. Approximately the same amounts of cyclin A (see Fig. 7, A and B) and Cdk2 (Fig. 7, C and D) were detected for both N-(351-540) and full-length Cdc25B.

Figure 7: N-(351-540) Cdc25B retains its binding affinity for cyclin A/Cdk2 complex GST fusion proteins of full-length and N-(351-540) Cdc25B were incubated with 2 mg HeLa cell lysates at a concentration of 4 mg/ml. The interaction between the Cdc25B proteins with cyclin A or Cdk2 were tested by Western blot by either anti-cyclin A (A and B) or anti-Cdk2 (C and D). In A and C, lane 1 is the HeLa cell lysates. Lanes 2, 3, and 4 are the GST, GST C446S Cdc25B, and GST N-(351-540) C446S proteins that have been incubated with 2 mg of HeLa cell proteins at concentrations of 4 mg/ml. In B and D, lanes 1, 2, and 3 are the GST, GST C446S Cdc25B, and GST N-(351-540) C446S proteins that were incubated with 2 mg of HeLa cell proteins at concentrations of 4 mg/ml.

DISCUSSION

Like all other known protein-tyrosine phosphatases, human Cdc25B carries the active site motif HCXXXXXR. Amino acid sequence alignment of human Cdc25A, Cdc25B, and Cdc25C shows 15 identical residues (FHCEFSSERGPRMCR) in this region(15) . Previous mutagenesis studies in various protein-tyrosine phosphatases suggested that replacement of the cysteine and arginine residues in the active site motif eliminates enzymatic activity completely(9, 10, 27, 43) . However, replacement of the histidine residue with alanine in Drosophila Cdc25 (10) or alanine or asparagine in Yersinia protein-tyrosine phosphatase (24) does not apparently affect the catalytic activity of these enzymes. Our mutagenesis results on human Cdc25A and -B indicate that the cysteine and arginine in the putative P loop are also two essential residues for the phosphatase activity. As is the case for other protein tyrosine phosphatases, the histidine in the active site motif is not essential for catalysis. These results agree with the observations of crystal structure of the human protein-tyrosine phosphatase 1B (28) and Yersinia protein-tyrosine phosphatase(33) . In these structures, the side chain of histidine residues in the active sites was found not to interact with the cysteine or the phosphate. Therefore, it is unlikely that the imidazole side chain of histidine 445 in human Cdc25B is directly involved in the catalysis process of the enzymatic reaction.

It has been reported that the replacement of catalytic cysteine results in the generation of inactive enzymes such as cysteine proteases(44) , thymidylate synthetases(45, 46) , and DNA cytosine methylase(47) . Usually, the catalytically inactive mutant enzymes, in which a serine residue replaces the catalytic cysteine, retained their abilities to bind substrates, thus forming nonproductive stable enzyme-substrate complexes. Solving the crystal structure of such a complex can often provide a detailed picture of the molecular interactions between an enzyme and its substrate(31) . We believe that such mutants in human Cdc25 proteins could provide an in vitro tool for studying the surface interactions between Cdc25 and cyclin-Cdk complexes. We tested the interaction between the cyclin and Cdk proteins with the C446S and R452A mutant Cdc25B proteins. Our data in this study suggested that the C446S Cdc25B retained its ability to interact with cyclin A and Cdk2 proteins. Since cyclin A protein mainly forms complexes with Cdk2 at the G/S phase of the cell cycle, it is likely that the cyclin A and Cdk2 proteins bound by C446S Cdc25B protein exist as a cyclin A-Cdk2 complex. Furthermore, our data also suggested that Cdk2 proteins that interacted with Cdc25B are phosphorylated on Thr and Tyr. These observations are consistent with the idea that Cdc25 proteins are the dual specific protein phosphatases that dephosphorylate the cyclin-Cdk complex during the cell cycle. The fact that Cdc25B R452A lost its affinity with both cyclin A and Cdk2 proteins is consistent with the observations in the structural studies in human protein-tyrosine phosphatase 1B (28) and Yersinia protein-tyrosine phosphatase(33) . A charge-charge interaction between the active site arginine and the phosphate oxygen of the substrate was observed in human protein-tyrosine phosphatase 1B and Yersinia protein-tyrosine phosphatase. This interaction may also exist in human Cdc25B and is a determining factor in the substrate binding. The wild-type Cdc25B protein did not trap cyclin A and Cdk2 proteins in our experiment; this may reflect the transient nature of the interaction between an enzyme and its substrate.

In fission and budding yeast, the cdc25 gene has been linked to mitotic control by genetic investigations(48, 49, 50) . Different from yeast, multiple cdc25 genes have been reported in both mice and humans(14, 15, 51, 52) . Although three human Cdc25 proteins show strong homology in their putative catalytic domain, outside this region they are highly divergent, with no obvious sequence similarity. These differences suggest that the human Cdc25 species may function at different stages of the cell cycle and dephosphorylate different cyclin and Cdk complexes(53) .

Human Cdc25C protein was found to activate the Cdc2/cyclin B complex and regulate the M phase entry in HeLa cells(12, 14, 16, 20) . Microinjection of anti-Cdc25A antibodies into human fibroblasts in G blocked cell entry into S-phase(17) . Furthermore, Cdc25A is phosphorylated during S-phase by the Cdk2-cyclin E kinase, and this phosphorylation increases its pNPP phosphatase activity 15-20-fold(17) . However, until now no detailed studies have been conducted to establish substrate specificity of Cdc25 proteins. In this study, we tried to address this question by using the cysteine mutants of human Cdc25A and -B to probe for their specific interactions with various cyclin-Cdk complexes. Both Cdc25A C430S and Cdc25B C446S bind to cyclin A-Cdk2 complex from HeLa cell lysates. However, only Cdc25A C430S interacts with cyclin B and Cdc2 proteins strongly. Since Cdc2 mainly forms a complex with cyclin A or cyclin B and regulates G/M transition(1, 2, 3, 4) , it is very likely that Cdc25A interacts with both cyclin A-Cdc2 and cyclin B-Cdc2 complexes. Furthermore, our data implies that the binding affinity between human Cdc25B and cyclin B-Cdc2 or cyclin A-Cdc2 complexes is much weaker than that of Cdc25A. We also observed strong interaction between Cdc25A and the cyclin E-Cdk2 complex, which is consistent with the in vivo studies results that human Cdc25A most likely acts at G or in the early S phase of cell cycle by activating the cyclin E/Cdk2, cyclin A/Cdk2, or cyclin D/Cdk4 kinase(17, 18, 41) . Our data here also agree with observations made by Hoffmann et al.(17) that cyclin E/Cdk2 kinase phosphorylates Cdc25A protein and activates its phosphatase activity during S phase of the cell cycle (17) . The strong interaction between cyclin E-Cdk2 and wild-type Cdc25A we observed may reflect the existence of this relationship.

Previous studies using Drosophila Cdc25 by Gautier et al.(10) suggested that residues within the putative catalytic loop may be important specificity determinants for the enzyme. Our observations on S449A human Cdc25B also suggested the importance of the putative P loop residues in the enzyme-substrate interaction. Since S449A mutant Cdc25B protein retains at least 10% of the phosphatase in the pNPP assay when compared with the wild-type Cdc25B, it is unlikely that S449A mutation causes a major structural disturbance around the active site region that could cause the loss of interaction between mutant Cdc25B and cyclin A-Cdk2 complex. Instead, the side chain of this serine residue may be directly or indirectly involved in the interface interactions between the Cdc25B and cyclin-Cdk complex. Since this serine residue is highly conserved in all of the Cdc25 proteins but not present in other protein-tyrosine phosphatases or dual specific phosphatases, it may act as one of the residues that define the substrate specificity of Cdc25 protein.

The alignment of all known dual specific protein-tyrosine phosphatase indicates that they all contain a putative catalytic domain of 170 amino acids(32) . However, these enzymes are very different from each other in terms of their length and their amino acid sequence outside the putative catalytic domain. The function of these noncatalytic domains remains unknown(32) . The fact that Cdc25 is a phosphorylated protein in S. pombe, Xenopus, and human (19, 20, 54, 55) suggests the possible regulatory function of the amino-terminal domain of Cdc25. Human Cdc25C undergoes phosphorylation during the cell cycle and is hyperphosphorylated in M phase. The phosphorylated Cdc25C purified from mitotic cells by immunoprecipitation showed a higher pNPP hydrolysis activity than the unphosphorylated Cdc25C from interphase cells(20) . Microsequencing of human Cdc25C protein suggested that six of the seven potential S/T-P consensus sites can be phosphorylated by Cdc2-cyclin B, and all of these six sites are located at the NH-terminal part of the protein(16) . Phosphorylation of human Cdc25A by Cdk2-cyclin E kinase (17) or by Raf1 kinase (56) can also enhance its phosphatase activity.

Our deletion mutagenesis data on human Cdc25A and -B proteins demonstrates that their catalytic domains reside in the carboxyl terminus. Both the GST fusion catalytic domain of Cdc25A and -B are fully active in the pNPP assay when compared with the wild-type GST fusion proteins. Furthermore, the thrombin-cleaved and -purified Cdc25B native catalytic domain is also catalytically active in the pNPP assay. Since the k/K values of the catalytic domains are 3-10-fold higher than that of the full-length Cdc25 proteins, it is likely that the amino terminus has a negative regulatory effect on the Cdc25 phosphatase activity. Our results here also indicated that for Cdc25B protein, the amino terminus is not required for its interaction with cyclin A-Cdk2 complex. The catalytic domain has about the same affinity for cyclin A-Cdk2 complex as the full-length Cdc25B protein. The function of the amino terminus of Cdc25A and the interaction with various cyclin-Cdk complexes is under investigation.

FOOTNOTES

*

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§

To whom correspondence should be addressed: Mitotix Inc., One Kendall Square, Cambridge, MA 02135. Tel.: 617-225-0001; Fax: 617-225-0005.

()

The abbreviations used are: Cdk, cyclin-dependent kinase protein; pNPP, p-nitrophenyl phosphate; PCR, polymerase chain reaction; GST, glutathione S-transferase; P loop, phosphate binding loop; PAGE, polyacrylamide gel electrophoresis.

()

K. Galaktionov, unpublished observations.

ACKNOWLEDGEMENTS

REFERENCES

1. Draetta, G., Piwnica-Worms, H., Morrison, D., Druker, B., Roberts, T., and Beach, D. (1988) Nature 326, 738-744 [CrossRef]
2. Gould, K., and Nurse, P. (1989) Nature 342, 39-45 [CrossRef][Medline] [Order article via Infotrieve]
3. Krek, W., and Nigg, E. (1991) EMBO J. 10, 305-316 [Medline] [Order article via Infotrieve]
4. Norbury, C., Blow, J., and Nurse, P. (1991) EMBO J. 10, 3321-3329 [Medline] [Order article via Infotrieve]
5. Russell, P., and Nurse, P. (1987) Cell 49, 559-567 [CrossRef][Medline] [Order article via Infotrieve]
6. Parker, L., Atheron-Fessler, S., and Piwnica-Worms, H. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 2917-2921 [Abstract/Free Full Text]
7. Poon, R. Y. C., Yamashita, K., Adamczewski, J. P., Hunt, T., and Shuttleworth, J. (1993) EMBO. J. 12, 3123-3132 [Medline] [Order article via Infotrieve]
8. Solomon, M. J., Harper, J. W., and Shuttleworth, J. (1993) EMBO J. 12, 3133-3142 [Medline] [Order article via Infotrieve]
9. Dunphy, W. G., and Kumagai, A. (1991) Cell 67, 189-196 [CrossRef][Medline] [Order article via Infotrieve]
10. Gautier, J., Solomon, M. J., Booher, R. N., Bazan, J. F., and Kirschner, M. W. (1991) Cell 67, 197-211 [CrossRef][Medline] [Order article via Infotrieve]
11. Millar, J. B., McGowan, C. H., Lenaers, G., Jones, R. and Russell, P. (1991) EMBO J. 10, 4301-4309 [Medline] [Order article via Infotrieve]
12. Strausfeld, U., Labbe, J. C., Fesquet, D., Cavadore, J. C., Picard, A., Sadhu, K., Russell, P., and Doree, M. (1991) Nature 351, 242-245 [CrossRef][Medline] [Order article via Infotrieve]
13. Lee, M. S., Ogg, S., Xu, M., Parker, L. L., Donoghue, D. J., Maller, J. L., and Piwnica-Worms, H. (1992) Mol. Biol. Cell 3, 73-84 [Abstract]
14. Sadhu, K., Reed, S. I., Richardson, H., and Russel, P. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 5130-5143
15. Galaktionov, K., and Beach, D. (1991) Cell 67, 1181-1194 [CrossRef][Medline] [Order article via Infotrieve]
16. Strausfeld, U., Fernandez, A., Capony, J. P., Girard, F., Lautredou, N., Derancourt, J., Labbe, J. C., and Lamb, N. J. C. (1994) J. Biol. Chem. 269, 5989-6000 [Abstract/Free Full Text]
17. Hoffmann, I., Draetta, G., and Karsenti, E. (1994) EMBO J. 13, 4302-4310 [Medline] [Order article via Infotrieve]
18. Jinno, S., Suto, K., Nagata, A., Igarashi, M., Kanaoka, Y., Nojima, H., and Okayama, H. (1994) EMBO J. 13, 1549-1556 [Medline] [Order article via Infotrieve]
19. Kumagai, A., and Dunphy, W. G. (1992) Cell 70, 139-151 [CrossRef][Medline] [Order article via Infotrieve]
20. Hoffmann, I., Clarke, P. R., Marcote, M. J., Karsenti, E., and Draetta, G. (1993) EMBO J. 12, 53-63 [Medline] [Order article via Infotrieve]
21. Streuli, M., Krueger, N. X., Tsai, A. Y., and Saito, H. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 8698-8702 [Abstract/Free Full Text]
22. Walton, K. M., and Dixon, J. E. (1993) Annu. Rev. Biochem. 62, 101-102 [CrossRef][Medline] [Order article via Infotrieve]
23. Zhang, Z. Y., Thieme-Sefler, A. M., Maclean, D., McNamara, D. J., Dobrusin, E. M., Sawyer, T. K., and Dixon, J. E. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 4446-4450 [Abstract/Free Full Text]
24. Zhang, Z. Y., and Dixon, J. E. (1993) Biochemistry 32, 9340-9345 [CrossRef][Medline] [Order article via Infotrieve]
25. Zhang, Z. Y., and Dixon, J. E. (1994) Adv. Enzymol. Relat. Areas Mol. Biol. 68, 1-36 [CrossRef][Medline] [Order article via Infotrieve]
26. Zhang, Z. Y., Wang, Y., and Dixon, J. E. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 1624-1627 [Abstract/Free Full Text]
27. Zhou, G., Denu, J. M., Wu, L., and Dixon, J. E. (1994) J. Biol. Chem. 269, 28084-28090 [Abstract/Free Full Text]
28. Barford, D., Flint, A. J., and Tonks, N. K. (1994) Science 263, 1397-1404 [Abstract/Free Full Text]
29. Logan, T., Zhou, M. M., Nettesheim, D. G., Meadows, R. P., Van Etten, R. L., and Feski, S. W. (1994) Biochemistry 33, 11087-11096 [CrossRef][Medline] [Order article via Infotrieve]
30. Su, X. D., Taddel, N., Stefani, M., Ramponi, G., and Nordlund, P. (1994) Nature 370, 575-578 [CrossRef][Medline] [Order article via Infotrieve]
31. Jia, Z. C., Barford, D., Flint, A. J., and Tonks, N. (1995) Science 268, 1754-1758 [Abstract/Free Full Text]
32. Denu, J. M., Zhou, Y. G., and Dixon, J. E. (1995) Biochemistry 34, 3396-3403 [CrossRef][Medline] [Order article via Infotrieve]
33. Stuckey, J. A., Schubert, H. L., Fauman, E. B., Zhang, Z. Y., Dixon, J. E., and Saper, M. A. (1994) Nature 370, 571-575 [CrossRef][Medline] [Order article via Infotrieve]
34. Higuchi, R. B., Krummel, B., and Saiki, R. K. (1988) Nucleic Acids Res. 16, 7351-7367 [Abstract/Free Full Text]
35. Studier, W. F., Rosenberg, A. H., Dunn, J. J., and Dubendorff, J. W. (1990) Methods Enzymol. 185, 60-89 [Medline] [Order article via Infotrieve]
36. Pagano, M., Pepperkok, R., Verde, F., Ansorge, W., and Draetta, G. (1992) EMBO J. 11, 961-971 [Medline] [Order article via Infotrieve]
37. Laemmli, U. K. (1970) Nature 227, 680-685 [CrossRef][Medline] [Order article via Infotrieve]
38. Elledge, S. J., and Spottswood, M. R. (1991) EMBO J. 10, 2653-2659 [Medline] [Order article via Infotrieve]
39. Tsai, A. Y., Itoh, M., Streuli, M., Thai, T., and Saito, H. (1991) J. Biol. Chem. 266, 10534-10543 [Abstract/Free Full Text]
40. Gu, Y., Rosenblatt, J., and Morgan, D. O. (1992) EMBO J. 11, 3995-4005 [Medline] [Order article via Infotrieve]
41. Terada, Y., Tatska, M., Jinno, S., and Okayama, H. (1995) Nature 376, 358-362 [CrossRef][Medline] [Order article via Infotrieve]
42. Dulic, V., Lees, E., and Reed, S. I. (1992) Science 257, 1958-1961 [Abstract/Free Full Text]
43. Millar, J., McGowan, C., Jones, R., Sadhu, K., Bueno, A., Richardson, H. and Russell, P. (1991) Cold Spring Harb. Symp. Quant. Biol. 56, 577-584 [Medline] [Order article via Infotrieve]
44. Vernet, T., Khouri, H. E., Laflamme, P., Tessier, D. C., Musil, R., Gour-Salin, B. J., Storer, A. C., and Thomas, D. Y. (1991) J. Biol. Chem. 266, 21451-21457 [Abstract/Free Full Text]
45. Polasko-Lapat, L., Maley, G. F., and Maley, F. (1990) Biochemistry 29, 9561-9572 [CrossRef][Medline] [Order article via Infotrieve]
46. Climie, S., Ruiz-Perez, L., Gonzalez-Pacanowska, D., Prapunwattana, P., Cho, S. W., Stroud, R., and Santi, D. V. (1990) J. Biol. Chem. 265, 18776-18779 [Abstract/Free Full Text]
47. Wyszynski, M. W., Gabbara, S., Kubareva, E. A., Romanova, E. A., Oretskaya, T. S., Gromova, E. S., Shabarova, Z. A. and Bhagwat, A. S. (1993) Nucleic Acids Res. 21, 295-301 [Abstract/Free Full Text]
48. Nurse, P. (1975) Nature 256, 547-551 [CrossRef][Medline] [Order article via Infotrieve]
49. Fantes, P. (1979) Nature 279, 428-430
50. Russell, P., and Nurse, P. (1986) Cell 45, 145-153 [CrossRef][Medline] [Order article via Infotrieve]
51. Millar, J. B., Blevitt, J., Gerace, L., Sadhu, K., Featherstone, C., and Russell, P. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 10500-10504 [Abstract/Free Full Text]
52. Nagata, A., Igarashi, M., Jinno, S., Suto, K., and Okayama, H. (1991) New Biol. 3, 959-968 [Medline] [Order article via Infotrieve]
53. Millar, J. B. A., and Russell, P. (1992) Cell 68, 407-410 [CrossRef][Medline] [Order article via Infotrieve]
54. Ducommun, B., Draetta, G., Young, P., and Beach, D. (1990) Biochem. Biophys. Res. Commun. 167, 301-309 [CrossRef][Medline] [Order article via Infotrieve]
55. Moreno, S., and Nurse, P. (1991) Nature 351, 194
56. Galaktionov, K., Jessus, C., and Beach, D. (1995) Genes & Dev. 9, 1046-1058

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				S. Varmeh-Ziaie and J. J. Manfredi The Dual Specificity Phosphatase Cdc25B, but Not the Closely Related Cdc25C, Is Capable of Inhibiting Cellular Proliferation in a Manner Dependent upon Its Catalytic Activity J. Biol. Chem., August 24, 2007; 282(34): 24633 - 24641. [Abstract] [Full Text] [PDF]

				J. Sohn, K. Kristjansdottir, A. Safi, B. Parker, B. Kiburz, and J. Rudolph Remote hot spots mediate protein substrate recognition for the Cdc25 phosphatase PNAS, November 23, 2004; 101(47): 16437 - 16441. [Abstract] [Full Text] [PDF]

				I. Landrieu, M. da Costa, L. De Veylder, F. Dewitte, K. Vandepoele, S. Hassan, J.-M. Wieruszeski, F. Corellou, J.-D. Faure, M. Van Montagu, et al. A small CDC25 dual-specificity tyrosine-phosphatase isoform in Arabidopsis thaliana PNAS, September 7, 2004; 101(36): 13380 - 13385. [Abstract] [Full Text] [PDF]

				M.-S. Chen, C. E. Ryan, and H. Piwnica-Worms Chk1 Kinase Negatively Regulates Mitotic Function of Cdc25A Phosphatase through 14-3-3 Binding Mol. Cell. Biol., November 1, 2003; 23(21): 7488 - 7497. [Abstract] [Full Text] [PDF]

				F. Forlani, A. Carpen, and S. Pagani Evidence that elongation of the catalytic loop of the Azotobacter vinelandii rhodanese changed selectivity from sulfur- to phosphate-containing substrates Protein Eng. Des. Sel., July 1, 2003; 16(7): 515 - 519. [Abstract] [Full Text] [PDF]

				E. Melkun, M. Pilione, and R. F. Paulson A naturally occurring point substitution in Cdc25A, and not Fv2/Stk, is associated with altered cell-cycle status of early erythroid progenitor cells Blood, November 15, 2002; 100(10): 3804 - 3811. [Abstract] [Full Text] [PDF]

				H. Zhao, J. L. Watkins, and H. Piwnica-Worms Disruption of the checkpoint kinase 1/cell division cycle 25A pathway abrogates ionizing radiation-induced S and G2 checkpoints PNAS, November 12, 2002; 99(23): 14795 - 14800. [Abstract] [Full Text] [PDF]

				Z. Wang, M. Wang, J. S. Lazo, and B. I. Carr Identification of Epidermal Growth Factor Receptor as a Target of Cdc25A Protein Phosphatase J. Biol. Chem., May 24, 2002; 277(22): 19470 - 19475. [Abstract] [Full Text] [PDF]

				D. F. McCain, I. E. Catrina, A. C. Hengge, and Z.-Y. Zhang The Catalytic Mechanism of Cdc25A Phosphatase J. Biol. Chem., March 22, 2002; 277(13): 11190 - 11200. [Abstract] [Full Text] [PDF]

				Z.-Q. Ma, Z. Liu, E. S. W. Ngan, and S. Y. Tsai Cdc25B Functions as a Novel Coactivator for the Steroid Receptors Mol. Cell. Biol., December 1, 2001; 21(23): 8056 - 8067. [Abstract] [Full Text] [PDF]

				M. E. Lane, M. Elend, D. Heidmann, A. Herr, S. Marzodko, A. Herzig, and C. F. Lehner A Screen for Modifiers of Cyclin E Function in Drosophila melanogaster Identifies Cdk2 Mutations, Revealing the Insignificance of Putative Phosphorylation Sites in Cdk2 Genetics, May 1, 2000; 155(1): 233 - 244. [Abstract] [Full Text]

				I. Blomberg and I. Hoffmann Ectopic Expression of Cdc25A Accelerates the G1/S Transition and Leads to Premature Activation of Cyclin E- and Cyclin A-Dependent Kinases Mol. Cell. Biol., September 1, 1999; 19(9): 6183 - 6194. [Abstract] [Full Text] [PDF]