|
|
|
|||||||
|
|||||||||
(Received for publication, September 11, 1995; and in revised form, December 28, 1995) From the
Terminal differentiation of muscle cells results in opposite
effects on gene promoters: muscle-specific promoters, which are
repressed during active proliferation of myoblasts, are turned on,
whereas at least some proliferation-associated promoters, such as
c-fos, which are active during cell division, are turned off.
MyoD and myogenin, transcription factors from the
basic-helix-loop-helix (bHLH) family, are involved in both processes,
up-regulating muscle genes and down-regulating c-fos. On the
other hand, the serum response factor (SRF) is involved in the
activation of muscle-specific genes, such as c-fos, as well as
in the up-regulation of a subset of genes that are responsive to
mitogens. Upon terminal differentiation, the activity of these various
transcription factors could be modulated by the formation of distinct
protein-protein complexes. Here, we have investigated the hypothesis
that the function of SRF and/or MyoD and myogenin could be modulated by
a physical association between these transcription factors. We show
that myogenin from differentiating myoblasts specifically binds to SRF. In vitro analysis, using the glutathione S-transferase pull-down assay, indicates that SRF-myogenin
interactions occur only with myogenin-E12 heterodimers and not with
isolated myogenin. A physical interaction between myogenin, E12, and
SRF could also be demonstrated in vivo using a triple-hybrid
approach in yeast. Glutathione S-transferase pull-down
analysis of various mutants of the proteins demonstrated that the bHLH
domain of myogenin and that of E12 were necessary and sufficient for
the interaction to be observed. Specific binding to SRF was also seen
with MyoD. In contrast, Id, a natural inhibitor of myogenic bHLH
proteins, did not bind SRF in any of the situations tested. These data
suggest that SRF, on one hand, and myogenic bHLH, on the other, could
modulate each other's activity through the formation of a
heterotrimeric complex.
Proliferation and cell differentiation are mutually exclusive
processes, as best exemplified in muscle precursor cells. Proliferation
inhibition is a crucial step that precedes muscle-specific gene
expression and cell fusion into myotubes in the process of muscle cell
terminal differentiation(1) . Indeed, terminal differentiation
of myoblastic cell lines in vitro is triggered by the
accumulation of the precursor cells (myoblasts) in a G Two distinct families of transcription
factors, MEF-1 and MEF-2, ( MEF-2 transcription factors are
members of the MADS box protein family. MADS box proteins are widely
expressed, from plants to man and including yeast(30) . MADS
box proteins exert a wide range of functions from development in plant
cells to muscle differentiation or growth factor responses in mammalian
cells. In yeast, the MADS box protein MCM1 is involved in the
mating-type phenotype(31) . A highly homologous protein, the
serum response factor (SRF), is instrumental to immediate early gene
mitogenic responses in mammals(32, 33) . The sequences
that are recognized by the two proteins are homologous(34) .
The two proteins function in a similar manner: although both proteins
are able to transactivate transcription(35, 36) , they
mainly function by recruiting ternary complex-forming factors through a
protein motif located in the MADS box(37, 38) . The
MEF-2 subset of MADS box proteins includes four members, MEF-2A,
MEF-2B, MEF-2C, and MEF-2D, some of which are ubiquitous and some
restricted to differentiated muscle cells. These proteins are related
to SRF and are often referred to as rSRF proteins(39) . They
bind to and transactivate CTA(A/T) The
factors that control the balance between proliferation and
differentiation in muscle are not fully understood at present. However,
myogenic factors of the bHLH family seem to be involved in this
delicate control. In particular, MyoD is both a target for mitogens
that are inhibiting differentiation (2, 7, 10) and a negative regulator for cell
proliferation in vitro(40, 41) . Part of the
mechanism by which MyoD blocks cell proliferation in vitro seems to be the repression of proliferation-associated genes, and
indeed, most of the proliferation-associated genes are silent in
differentiated muscle cells(42) . In particular, immediate
early genes such as c-fos are repressed on terminal
differentiation(42, 43) . In fact, the transcription
factor AP1, which is formed by heterodimers between members of the
Fos-related proteins and members of the Jun-related factors, is a
prominent target for MyoD: MyoD interferes with AP1 function by forming
specific complexes with Jun proteins(44) . In addition, MyoD (43) and myogenin (45) both act as repressors for the
c-fos promoter through the inhibition of its main element, the
serum response element (SRE)(46) . The SRE includes a CArG box,
the binding site for SRF, which is repressed on differentiation. Paradoxically, CArG boxes are involved in the up-regulation of some
muscle-specific genes such as cardiac
The mechanism by which SRF is converted into
a muscle-specific transactivator is largely unknown. In muscle-specific
promoters, transactivation by SRF could use a slightly different
mechanism than that used in the c-fos promoter: the affinity
of SRF for muscle CArG boxes is lower than its affinity for c-fos SRE (58, 59) . Furthermore, whereas one
SRF-binding site is sufficient for mitogen responses, several sites are
necessary to observe muscle-specific
expression(51, 60) . Therefore, it seems likely that
with regard to muscle genes, SRF needs to cooperate with other factors
for optimal transactivation. A tempting hypothesis would thus be that,
in order to be active on muscle promoters, SRF needs to interact
physically with other factors. In this paper, we have tested the
hypothesis that SRF interacts with the myogenic bHLH proteins. We
demonstrate that a heterotrimeric complex forms between bHLH proteins
and SRF both in vitro and in cultured cells. The formation of
this complex could be one of the means by which SRF activity is
deviated from proliferative to differentiating genes upon muscle cell
terminal differentiation.
Plasmids pGAD424 and pGBT9 were
a kind gift of Dr. S. Fields(63) . Plasmid pRS313 has been
described by Sikorski and Hieter(64) . Plasmids pGAD-E12 and
pGAD-myogenin were constructed by inserting the corresponding complete
coding sequence, obtained by polymerase chain reaction using the
above-described primers for myogenin or the primers described in (43) for E12, into the EcoRI site of pGAD424. Plasmid
pGB-SRF was constructed by inserting the complete coding sequence of
SRF, obtained by polymerase chain reaction using the above-described
primers and subcloned into a Bluescribe pEMSV-MyoD, pEMSV-MyoD-
Figure 1:
In vitro and in vivo interactions between myogenin and SRF. A, GST pull-down
assay. E12 (lane 1) and myogenin (lane 2) were in
vitro translated alone or in combination (lane 3), as
indicated (Input: one-tenth of the amount used in the GST
pull-down assay). Translation products were incubated with beads
covered with GST (G; lanes 5, 7, and 9) or GST-SRF (S; lanes 4, 6, and 8). Bound products were analyzed by SDS-polyacrylamide gel
electrophoresis. The positions of E12 and myogenin translation products
are shown. B, triple-hybrid assay. Indicator yeast cells were
transfected with expression vectors for fusion proteins between the
GAL4-activating domain (pGAD) or the DNA-binding domain (pGB) and a
third construct, pRS, resulting in the expression of GAL4 AD-E12 and/or
GAL4 AD-myogenin (Myog) and GAL4 GB-SRF, as indicated.
Transfected yeast cells were analyzed for
These
results were confirmed in vivo using a double-hybrid approach
in yeast(63) . Indicator yeast cells (permanently transfected
with a GAL1-lacZ reporter construct) were transfected with expression
vectors encoding fusion proteins between the GAL4 DNA-binding domain
(pGB series) or transactivating domain (pGAD series) and SRF, myogenin,
or E12 in all combinations. These experiments showed that expression of
fusion products between the GAL4 DNA-binding domain and E12 or myogenin
resulted in a high background, indicating that the transactivation
domains of these proteins are active in yeast (data not shown).
Therefore, these constructs could not be used in subsequent assays.
When yeast cells were transfected with pGB-SRF and pGAD-myogenin or
pGAD-E12, no A complex between SRF and myogenin was also detected when
nuclear extracts from differentiating myoblasts were used (Fig. 1C). C2C12 cells were or were not induced to
differentiate in low serum. Nuclear proteins were extracted at
different time points and incubated with GST- or GST-SRF-covered
agarose beads. Bound proteins were analyzed by SDS-polyacrylamide gel
electrophoresis followed by Western blotting using an anti-myogenin
monoclonal antibody. These experiments demonstrated that cellular
myogenin, amounts of which increased during differentiation, was
specifically retained on SRF-coated beads in differentiating myoblasts.
Taken together, these data demonstrate that myogenin, in its
physiological heterodimeric form, binds to SRF.
Figure 2:
The bHLH domains of E12 and myogenin are
necessary and sufficient for specific SRF recognition. A,
deletion mutants used. Solid boxes, basic domain; hatched
boxes, HLH domain. B, GST pull-down analysis of wild-type
myogenin and E12 (lanes 1 and 2) or deletion mutants
of myogenin (lanes 3-8) or E12 (lanes
9-12). The positions of the various mutants are indicated by arrows, and the corresponding inputs are shown in C. D, GST pull-down analysis of wild-type myogenin (lanes
1, 4, 5, and 10) or deletion mutants
that have lost the b and H1 region (
On the other hand, experiments performed with deletion
mutants of SRF indicated that, similarly, core SRF (a minimal domain of
SRF that includes the DNA-binding and dimerization domains) was
sufficient to observe a specific interaction with myogenin (Fig. 3). No interaction could be detected with the N- or
C-terminal moiety of SRF.
Figure 3:
Core SRF is necessary and sufficient to
interact specifically with bHLH proteins. A, deletion mutants
of SRF used. The hatched boxes indicate the location of the
MADS box. B, GST-pull down analysis of wild-type myogenin and
E12 on beads coated with GST (lane 2), GST-wild-type SRF (lane 1), or mutants that have lost amino acids 11-244 (C-SRF; lane 3), 142-508 (N-SRF; lane 4), or 11-142 and 244-508 (
Taken together, these results indicate
that the DNA-binding domains of SRF, E12, and myogenin are both
necessary and sufficient to observe the interaction, raising the
possibility that the interaction occurs through nonspecific binding of
these proteins to contaminating DNA during the GST pull-down assay.
However, the interaction among the three proteins was still observed
when contaminating DNA was degraded using nuclease or when the GST
pull-down assay was performed in the presence of ethidium bromide,
which prevents DNA-protein interaction (data not shown). The results of
these control experiments rule out the possibility that the
SRF
Figure 4:
Analysis of various bHLH proteins. A, MyoD mutants used in the assay. B, GST-pull down
analysis of wild-type MyoD (lanes 1, 3, and 4) or a mutant that has lost the N-terminal part of the bHLH
domain (lanes 2, 5, and 6) on GST-coated (G; lanes 4 and 6) or GST-SRF-coated (S; lanes 3 and 5) beads. Lanes 1 and 2 show the input. C, GST pull-down analysis
of Id on GST (lane 3), GST-SRF (lane 2), or
GST-E12/myogenin (lane 4). Lane 1 shows the input. D, GST pull-down analysis of wild-type MyoD (lanes 1, 2, 7, and 8), a deletion mutant that has
lost the N-terminal part of the bHLH domain (lanes 3 and 4), or mutants in which the b domain has been replaced by that
of E12 (lanes 5 and 6) or T4 achaete scute (lanes 9 and 10).
However, the ability to physically
interact with SRF was not observed for all members of the bHLH family.
In particular, Id, a functional antagonist of MyoD or myogenin, did not
bind to SRF, either alone or in combination with E12 (Fig. 4C). We have also tested several mutants of MyoD
or myogenin (Fig. 4D). MyoD-bE12 (a mutant of MyoD in
which the basic domain has been replaced by the E12 basic domain) and
MyoD-bT4 (in which the basic domain has been replaced by that of the T4 achaete scute Drosophila protein) both bind to DNA
efficiently(27) , but do not transactivate muscle genes.
Whereas MyoD-bE12 retains a high affinity for SRF, MyoD-bT4 has lost
SRF recognition. Terminal differentiation of myoblasts is accompanied by
drastic changes in the pattern of gene expression: muscle-specific
genes are up-regulated, while mitogen-responsive promoters are
repressed. Paradoxically, some enhancer elements are involved in the
activation of both mitogen-responsive and differentiation-associated
genes. In particular, CArG boxes or related elements are active in a
number of muscle promoters(51, 55, 60, 72, 73, 74, 75, 76) as
well as in immediate early genes such as c-fos or cytoskeletal
actin(33, 77) . Furthermore, the CArG box-binding
protein SRF, a prominent factor in the immediate early response to
mitogens, seems also to be indispensable for muscle cell terminal
differentiation(57) . Thus, SRF is involved in the
up-regulation of both mitogen-responsive genes (such as c-fos)
and differentiation-associated genes (such as those encoding
muscle-specific proteins), although these two sets of genes are
regulated in an opposite manner. A tempting hypothesis to explain this
apparent paradox is that SRF activity is regulated through the
formation of distinct protein complexes. In particular, SRF activity,
during muscle terminal differentiation, could be modulated by a
physical interaction with factors involved in this process. We have
thus tested the hypothesis that such a physical interaction could occur
between the myogenic bHLH proteins and SRF and found that complexes
could indeed be detected between MyoD or myogenin using various assays in vitro or in vivo, including GST pull-down and
hybrid assays in yeast. Interestingly, this interaction requires that
myogenic bHLH be in a heterodimeric form: no complex could be detected
between myogenin or MyoD and SRF in the absence of E12. Accordingly,
complex formation required the integrity of the bHLH domain on both E12
and MyoD or myogenin. A likely interpretation of these results is that
heterodimeric formation between E12 and MyoD or myogenin induces a
conformational change in the proteins that unmasks a site of
interaction with SRF. The bHLH domain is also sufficient for the
interaction to occur, suggesting that this conformational change occurs
in the bHLH domain, which is not unexpected. Interestingly, core SRF is
also necessary and sufficient for complex formation with bHLH. This
suggests that core SRF is involved in a wide variety of functions,
including dimerization and DNA binding(32) , interaction with
p62 From a biochemical point of
view, we do not know if the interaction between SRF and the
heterodimeric bHLH proteins involves amino acids from the three
proteins or if only two of the proteins are physically involved. It
should be noted, however, that some mutations in MyoD the bHLH domain
result in inactivation of SRF recognition, suggesting that MyoD and
myogenin are directly involved in SRF binding. Our experiments have
been performed in various systems, from reticulocytes to yeast, and
thus, it is likely that the interaction among the three proteins is
direct. However, we cannot rule out the possibility that a fourth
protein, which would be ubiquitous, is also involved. From a
functional point of view, it is not clear which activity, that of SRF
or that of myogenic bHLH, is modulated by the formation of the
trimolecular complex. It is, however, clear that formation of this
trimeric complex is associated with the terminal step of muscle
differentiation since 1) it is detected only with cells that have
entered the differentiation process; 2) it requires heterodimerization
of MyoD or myogenin with E12, an event that occurs only at this step of
the process, even if MyoD pre-exists in myoblasts; and 3) Id-E12
complexes, which are present in proliferating myoblasts, do not bind to
SRF. The formation of the complex on terminal differentiation might
turn SRF, a ubiquitous protein that is a key participant in immediate
early responses, into a muscle-specific transactivator. In this regard,
this interaction could explain several puzzling observations. First,
SRF has a low affinity for muscle gene CArG
boxes(51, 58, 59) , although it seems
instrumental to the up-regulation of these genes. By a cooperative
binding with heterodimers of myogenic bHLH proteins, SRF However, we cannot rule out the
possibility that the formation of this complex also results in
MyoD/myogenin modulation by SRF. In fact, for some muscle promoters,
the transactivation of E boxes by MyoD or myogenin requires that an
intact CArG box also be present on the promoter(52) . This
suggests some cooperation between myogenic bHLH and proteins binding to
the CArG box. Clearly, however, the interaction with SRF is not
sufficient for myogenic activity of bHLH proteins: MyoD-bE12, a MyoD
mutant that has lost myogenic activity(27) , is still able to
recognize SRF in a specific manner; thus, some functionality of the
basic domain distinct from SRF recognition is required for myogenic
activity. It is thus possible that the formation of the
SRF An alternative hypothesis would be that the interaction
between SRF and myogenic bHLH increases the affinity of SRF for
noncanonical CArG boxes or the affinity of myogenic bHLH for E boxes
that are distant from the consensus sequence. We are currently running
experiments to test this hypothesis. It is also possible that this
interaction is involved in a step that follows the binding to DNA, such
as transcriptional transactivation. It is important to note that the
cooperation between CArG boxes and E boxes in muscle genes is mainly
observed in cardiac muscle cells. It is thus possible that a similar
interaction involves members of both families of protein that are
specifically expressed in cardiac muscle. Taken together, our
results indicate that myogenic bHLH proteins are able to form a
heterotrimeric complex with SRF both in vitro and in
vivo. The existence of this complex could help explain how SRF,
which is a ubiquitous factor involved in immediate early responses, is
converted into a muscle-specific transactivator on muscle cell
differentiation.
Volume 271,
Number 9,
Issue of March 1, 1996 pp. 5258-5264
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
state(1) . This step is a prerequisite, and a number of
mitogens(2, 3, 4, 5) or oncogenes (6, 7, 8, 9, 10) inhibit
terminal differentiation.
)are instrumental to the muscle
cell differentiation process. The MEF-1 family includes the myogenic
bHLH proteins MyoD(11, 12, 13) ,
myogenin(14, 15) , Myf5 (16) and
MRF4/herculin/Myf6(17) . These proteins are all able to elicit in vitro a muscle determination program in a number of
nonmuscle cell types(18, 19) . These muscle-restricted
proteins share a domain of homology, the bHLH, which is also common to
ubiquitous transcription factors such as the products of the E2A gene,
E12 and E47(20, 21) , with which myogenic factors form
heterodimeric complexes. Heterodimers between myogenic bHLH and E12 or
E47 (22, 23, 24, 25, 26) bind
to upstream regulatory sequences of the form CANNTG (E boxes) (27) in muscle-specific gene promoters. MyoD, myogenin, and
Myf5 are all able to transactivate these promoters
efficiently(28) , a function that involves a common motif in
the basic domain(29) .
TAG DNA elements, a
consensus sequence that is homologous, but not identical, to the CArG
boxes (CC(A/T)
GG), which are recognized by SRF. In fact,
SRF and rSRF(MEF-2) cannot heterodimerize with each other(39) ,
and thus, they belong to distinct subsets of MADS box proteins.
-actin(22, 47, 48, 49) ,
skeletal -actin(50, 51) , myosin light chain
1A(52) , dystrophin(53) , and muscle creatine
kinase(54) . SRF itself has been shown to be involved in muscle
gene up-regulation(51, 55, 56) . Furthermore,
SRF seems to be indispensable for muscle cell terminal
differentiation(57) . Indeed, CArG boxes of muscle genes can be
replaced by the c-fos SRF-binding site without any loss of
function(58) , strongly suggesting that the same protein is
involved in the activation of both genes. Thus, SRF is instrumental to
the activation of both mitogen-responsive genes, such as c-fos or 
-actin, which are down-regulated on muscle cell terminal
differentiation(32, 33, 46) , and
muscle-specific genes.
Plasmids
pEMSV-E12, pGST-SRF, and pSRE-CAT were
as described in (43) . pEMSV-myogenin was a kind gift of Dr. E.
Olson. pEMSV-
bH1-myogenin (in which amino acids 71-96 have
been deleted) and pEMSV-H-myogenin (in which amino acids
71-163 have been deleted) were constructed using a polymerase
chain reaction-amplified insert. The internal primers were
TGCAAGGTGCACAGCGCCTCCTGCAG and GGCGCTGTGCACCTTGCATGCCCACG for
pEMSV-H-myogenin and TGCAAGGTGGTGAATGAGGCCTTCGAGG and
CTCATTCACCACCTTGCATGCCCACG for pEMSV-bH1-myogenin. The forward
external primer included a consensus translation start
site(61) , and both forward and reverse external primers
included an EcoRI restriction site for cloning convenience.
The sequences of these primers were GGAATTCACCATGGAGCTGTATGAGACATCCC
(forward) and GGGGGGAATTCAGTTGGGCATGGTTTCG (reverse). pHIV-SRF, used in in vitro translation experiments, was constructed by replacing
the chloramphenicol acetyltransferase gene in a pGEM-HIV-CAT construct (62) with a sequence encoding the complete SRF protein obtained
by polymerase chain reaction amplification (forward primer sequence,
5`-CCCCAAGCTTACCATGTTACCGACCCAA-3`; and reverse primer sequence,
5`-TCATTCACTCTTGGTGCTGTGGGCGGTG-3`). vector,
between the EcoRI and SalI sites of pGBT9. pRS-E12
and pRS-myogenin were constructed by subcloning an SphI-SphI insert from the corresponding pGAD
construct into the SmaI site of pRS313. These constructs were
controlled by partial sequence (which did not reveal any mutations),
and results obtained with these constructs were confirmed using two
independent clones.
bH, pEMSV-MyoD-bE12,
and pEMSVMyoD-bT4 were kind gifts of Dr. H. Weintraub(27) .
pEMSV-myogenin, pEMSV-N-myogenin, pEMSV-C-myogenin, and
pEMSV-N/C-myogenin were kind gifts of Dr. E.
Olson(65) .Cells and Transfections
NIH-3T3 cells were
maintained in Dulbecco's modified Eagle's medium
supplemented with antibiotics (a mixture of penicillin and streptomycin
(Life Technologies, Inc.) used according to the manufacturer's
recommendations) and 5% FCS. Cells were transfected by electroporation
as described previously(43) . Briefly, cells were harvested by
scraping, washed, and resuspended in 150 µl of Dulbecco's
modified Eagle's medium supplemented with 0.5% FCS. 2 µg of
SRE-CAT; the indicated doses of pEMSV-E12, pEMSV-myogenin, or mutants;
and 1 µg of RSV-luc (as an internal control for transfection
efficiency) were added. After electrical shock (using a Bio-Rad
apparatus at 960 microfarads and 200 V), each sample was divided into
two aliquots, and cells were maintained in Dulbecco's modified
Eagle's medium supplemented with 0.5% FCS for 48 h, after which
one of the aliquots was treated with 20% serum for 4 h. Cells were
harvested, and extracts were standardized based on the luciferase
activity of the nonserum-treated sample (samples from the same
transfection were standardized based on the protein content, as
measured by a Bio-Rad assay). Chloramphenicol acetyltransferase
activity was measured using [
C]chloramphenicol
and standard procedures with a 4-h assay.GST Pull-down
GST or GST-SRF beads were prepared
according to Lassar et al.(66) , except that the
fusion proteins were not eluted. After four washes in NETN buffer (100
mM NaCl, 1 mM EDTA, 20 mM Tris, pH 8, and
0.5% Nonidet P-40), aliquots of 10 µl of beads were frozen at
-70 °C. pEMSV-E12, pEMSV-myogenin, pEMSV-MyoD, and various
mutants were in vitro translated or cotranslated using the TNT
translation kit (Promega) following the manufacturer's
recommendations. The programed lysates (10 µl) were incubated with
the GST or GST-SRF beads (10 µl) for 1 h at room temperature. The
beads were washed five times in NETN buffer and mixed with 1 volume of
2 
SDS loading buffer, and bound proteins were analyzed by
SDS-polyacrylamide gel electrophoresis using standard procedures.Analysis of Myoblastic Proteins
C2C12 myoblasts
were maintained in Dulbecco's modified Eagle's medium
supplemented with 10% FCS. Confluent dishes were induced to
differentiate by switching the medium to 0.5% FCS. Differentiating
cells were harvested by scraping, and nuclear proteins were prepared
according to the method of Dignam et al.(67) . 200
µg of extracts were incubated for 1 h at room temperature with GST
or GST-SRF beads, and bound proteins were analyzed by
SDS-polyacrylamide gel electrophoresis followed by dry transfer.
Filters were probed with an anti-myogenin monoclonal antibody, a kind
gift of Dr. W. E. Wright(68) , and revealed by
chemiluminescence using an Amersham kit following the
manufacturer's recommendations.Double and Triple Hybrids in Yeast
Yeast cells
(strain Y526) were transfected with 1 µg of each of the indicated
plasmids and brought to 5 µg in salmon sperm DNA as described by
Legrain and Chapon(69) . Transfected yeast cells were processed
for colorimetric detection of -galactosidase activity using
standard procedures(70) . Clones of transfected yeast were also
grown to 0.8 A and extracted as
described(69) . 20 µl of extract were assayed for
-galactosidase activity using a chemiluminescent detection
procedure (Tropix Inc.) according to the manufacturer's
instructions.
Myogenin Physically Interacts with SRF
A
biochemical approach was used (71) to test the hypothesis of a
physical interaction between SRF and myogenic bHLH. GST or GST-SRF
covered beads were incubated with S-labeled, in vitro translated myogenin and/or E12 (Fig. 1A). These
experiments were controlled using an irrelevant translation product
(luciferase) as a negative control and standardized using SRF core (DNA
binding and dimerization domain) as an internal positive control (data
not shown). The results demonstrated that neither myogenin (lane
6) nor E12 (lane 4) was able to bind to SRF when
isolated. However, a significant level of binding could be detected
when both proteins were cotranslated (lane 8), suggesting that
formation of heterodimers between myogenin and E12 results in SRF
recognition. The converse experiments, in which beads were coated with
a mixture of GST-E12 and GST-myogenin and used to retain in vitro translated SRF, did not give clearly interpretable data, most
likely due to inefficient heterodimerization of E12 and myogenin on the
beads. However, when myogenin-coated beads were incubated sequentially
with in vitro translated E12 and then with SRF, a significant
level of SRF retention could be observed (data not shown).
-galactosidase
expression by a colorimetric assay (each streak represents an
independent clone) or by a quantitative chemiluminescent assay (RLUs, arbitrary light units), as indicated. C,
confluent C2C12 mouse myoblastic cells were kept in high serum (lanes 3, 6, and 7) or induced to
differentiate for 24 h (lanes 4, 8, and 9)
or 48 h (lanes 5, 10, and 11). Nuclear
proteins were analyzed by Western blotting using anti-myogenin
antibodies, either directly (lanes 3-5) or after
absorption onto GST-covered beads (G; lanes 7, 9, and 11) or GST-SRF-covered beads (S; lanes 6, 8, and 10). Lanes 1 and 2 show a direct analysis by Western blotting of in vitro translated myogenin. NP, nonprogramed lysate; myog, myogenin.
-galactosidase could be detected, suggesting that a
heterodimer does not form between SRF and E12 or myogenin, as expected
from the results of GST pull-down assays. We next introduced, into the
same yeast indicator cells, three expression vectors bearing three
distinct selectable markers and encoding a fusion protein between the
GAL4 DNA-binding domain and SRF and fusion proteins between the GAL4
activation domain and myogenin or E12, respectively. Yeast that had
received the three expression vectors expressed significant amounts of
-galactosidase (Fig. 1B), indicating that a
heterotrimer had formed in the cells, resulting in the activation of
the GAL4-responsive promoter. In contrast, galactosidase activity was
hardly detectable in yeast transfected with SRF and E12 or with SRF and
myogenin (lanes 1 and 2), confirming that complex
formation between SRF and isolated E12 or myogenin was not very
efficient. All other combinations, including pGAD-myogenin (or
pGAD-E12), pGB-SRF, and pRS as a backbone vector, resulted in
background or low expression of -galactosidase (data not shown).
Taken together, these data indicate that heterodimers of myogenin and
E12 physically interact with SRF in vitro and in
vivo.Physical Interaction between SRF and Myogenin Occurs
through Dimerization/DNA-binding Domains
Myogenin and E12 are
structurally organized in domains. To test which parts of the molecules
were involved in the interaction with SRF, deletion mutants of both
proteins were tested in the GST pull-down assay (Fig. 2).
Removing the C- or N-terminal part of myogenin or E12 was not
detrimental to SRF recognition (Fig. 2B). In fact, both
regions of the molecules could be deleted, and the resulting minimal
bHLH domain was sufficient to observe specific binding to SRF-covered
beads. Indeed, myogenin mutants in which the bHLH domain was partly
(bH1) or entirely (H) deleted could not bind specifically to
SRF (Fig. 2D, lanes 6-9). Note that
these mutants were also unable to heterodimerize with E12 (lanes
10-12). These data indicate that the bHLH domains of
myogenin and E12 are both necessary and sufficient to observe the
interaction.
bH1; lanes 2, 6, 7, and 11) or the entire bHLH domain
(H; lanes 3, 8, 9, and 12).
Translation products were analyzed on beads coated with GST (G; lanes 5, 7, and 9), GST-SRF (S; lanes 4, 6, and 8), or
GST-E12/myogenin (lanes
10-12).
NC-SRF; lane 5). Translation products were
also analyzed on beads coated with core SRF as an internal control for
the various beads (MADS-SRF; lanes
6-10).
bHLH complex could be due to artifactual nonspecific binding
to DNA.SRF Recognition Is Restricted to a Subset of bHLH
Proteins
To further analyze the interaction between bHLH
proteins and SRF, we have tested a variety of bHLH proteins in the GST
pull-down assay. The results indicate that specific binding to SRF is
not a feature restricted to myogenin, but is also observed for MyoD (Fig. 4B). MyoD was not retained on SRF-covered beads,
but the products of MyoD and E12 cotranslation were specifically
retained. MyoD-SRF interaction requires the MyoD bHLH domain since a
mutant that has lost this domain cannot recognize SRF (Fig. 4B).
(78) , transcriptional activation in response
to some signal transduction pathways(36) , and interaction with
members of distinct transcription factor families (this study).
Furthermore, this interaction might also be observed with other members
of the MADS box family that share large domains of homology with core
SRF. Indeed, a similar physical interaction has been demonstrated for
MEF-2(79) , although for MEF-2, the formation of the complex
did not require the presence of E12.
DNA
complexes could gain enough stability for SRF to be active. Second,
although SRF is present and active on mitogen-responsive genes in
proliferating myoblasts, muscle-specific genes remain silent until
terminal differentiation. This could easily be explained by the fact
that transactivation of muscle genes by SRF requires the formation of a
complex with myogenic bHLH proteins.bHLH complex results in the modulation of each of the partners
of the complex, SRF and myogenic bHLH proteins. Various functions could
be regulated in this manner. For example, the formation of this complex
could be a mechanism used by myogenic bHLH proteins to repress SRF from
transactivating mitogen-responsive genes such as
c-fos(43) . Myogenic bHLH proteins repress c-fos SRE through binding to an E box overlapping the CArG box in the
DNA element. The formation of a multiprotein complex on the element
could explain the observed inhibition. Preliminary data, using an
improved electrophoretic mobility shift assay(80) , suggested
that such a multiprotein complex (including myogenin, E12, and SRF)
could assemble on c-fos SRE, although this complex seems to be
unstable (data not shown). We are currently analyzing this complex in
more detail.
)
We thank Pierre Legrain for helpful discussion and
advice in the triple-hybrid system in yeast, Serge Leibovitch for
helpful discussion, and Marie-Christine Dokhélar
and Linda Pritchard for critical reading of the manuscript.
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  K. D. Yokoyama, U. Ohler, and G. A. Wray Measuring spatial preferences at fine-scale resolution identifies known and novel cis-regulatory element candidates and functional motif-pair relationships Nucleic Acids Res., June 2, 2009; (2009) gkp423v2. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. P. Makarenkova, K. N. Gonzalez, W. B. Kiosses, and R. Meech Barx2 Controls Myoblast Fusion and Promotes MyoD-mediated Activation of the Smooth Muscle{alpha}-Actin Gene J. Biol. Chem., May 29, 2009; 284(22): 14866 - 14874. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. M. Meadows, A. S. Warkman, M. C. Salanga, E. M. Small, and P. A. Krieg The myocardin-related transcription factor, MASTR, cooperates with MyoD to activate skeletal muscle gene expression PNAS, February 5, 2008; 105(5): 1545 - 1550. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. H. Cheung, K. K. B. Barthel, Y. L. Kwan, and X. Liu Identifying pattern-defined regulatory islands in mammalian genomes PNAS, June 12, 2007; 104(24): 10116 - 10121. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Charvet, C. Houbron, A. Parlakian, J. Giordani, C. Lahoute, A. Bertrand, A. Sotiropoulos, L. Renou, A. Schmitt, J. Melki, et al. New Role for Serum Response Factor in Postnatal Skeletal Muscle Growth and Regeneration via the Interleukin 4 and Insulin-Like Growth Factor 1 Pathways. Mol. Cell. Biol., September 1, 2006; 26(17): 6664 - 6674. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Kawai-Kowase, M. S. Kumar, M. H. Hoofnagle, T. Yoshida, and G. K. Owens PIAS1 Activates the Expression of Smooth Muscle Cell Differentiation Marker Genes by Interacting with Serum Response Factor and Class I Basic Helix-Loop-Helix Proteins Mol. Cell. Biol., September 15, 2005; 25(18): 8009 - 8023. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C.-H. Kim, W. C. Xiong, and L. Mei Inhibition of MuSK Expression by CREB Interacting with a CRE-Like Element and MyoD Mol. Cell. Biol., July 1, 2005; 25(13): 5329 - 5338. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Blais, M. Tsikitis, D. Acosta-Alvear, R. Sharan, Y. Kluger, and B. D. Dynlacht An initial blueprint for myogenic differentiation Genes & Dev., March 1, 2005; 19(5): 553 - 569. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Zhang, G. Azhar, Y. Zhong, and J. Y. Wei Identification of a Novel Serum Response Factor Cofactor in Cardiac Gene Regulation J. Biol. Chem., December 31, 2004; 279(53): 55626 - 55632. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. K. Owens, M. S. Kumar, and B. R. Wamhoff Molecular Regulation of Vascular Smooth Muscle Cell Differentiation in Development and Disease Physiol Rev, July 1, 2004; 84(3): 767 - 801. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. A. Stieger, A. D. Meyer, P. Kathmann, C. Frundt, I. Niederhauser, M. Barone, and C. Kuhlemeier The orf13 T-DNA Gene of Agrobacterium rhizogenes Confers Meristematic Competence to Differentiated Cells Plant Physiology, July 1, 2004; 135(3): 1798 - 1808. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. S. Kumar, J. A. Hendrix, A. D. Johnson, and G. K. Owens Smooth Muscle {alpha}-Actin Gene Requires Two E-Boxes for Proper Expression In Vivo and Is a Target of Class I Basic Helix-Loop-Helix Proteins Circ. Res., May 2, 2003; 92(8): 840 - 847. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. S. Kumar and G. K. Owens Combinatorial Control of Smooth Muscle-Specific Gene Expression Arterioscler. Thromb. Vasc. Biol., May 1, 2003; 23(5): 737 - 747. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Meech, H. Makarenkova, D. B. Edelman, and F. S. Jones The Homeodomain Protein Barx2 Promotes Myogenic Differentiation and Is Regulated by Myogenic Regulatory Factors J. Biol. Chem., February 28, 2003; 278(10): 8269 - 8278. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Mead, A. R. Bruning, M. K. Gill, A. M. Steiner, T. B. Acton, and A. K. Vershon Interactions of the Mcm1 MADS Box Protein with Cofactors That Regulate Mating in Yeast Mol. Cell. Biol., July 1, 2002; 22(13): 4607 - 4621. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Q. Gong and L. Li Dermo-1, a Multifunctional Basic Helix-Loop-Helix Protein, Represses MyoD Transactivation via the HLH Domain, MEF2 Interaction, and Chromatin Deacetylation J. Biol. Chem., March 29, 2002; 277(14): 12310 - 12317. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Zeng and A. R. Morrison Disruption of the actin cytoskeleton regulates cytokine-induced iNOS expression Am J Physiol Cell Physiol, September 1, 2001; 281(3): C932 - C940. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. WEI, L. WANG, J. A. CARSON, J. E. AGAN, K. IMANAKA-YOSHIDA, and R. J. SCHWARTZ {beta}1 integrin and organized actin filaments facilitate cardiomyocyte-specific RhoA-dependent activation of the skeletal {alpha}-actin promoter FASEB J, March 1, 2001; 15(3): 785 - 796. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. S. Belaguli, J. L. Sepulveda, V. Nigam, F. Charron, M. Nemer, and R. J. Schwartz Cardiac Tissue Enriched Factors Serum Response Factor and GATA-4 Are Mutual Coregulators Mol. Cell. Biol., October 15, 2000; 20(20): 7550 - 7558. [Abstract] [Full Text]
|
|
|
|
 |
|
 L. Wei, W. Zhou, L. Wang, and R. J. Schwartz beta 1-Integrin and PI 3-kinase regulate RhoA-dependent activation of skeletal alpha -actin promoter in myoblasts Am J Physiol Heart Circ Physiol, June 1, 2000; 278(6): H1736 - H1743. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Ding, M. M. Witte, and R. E. Scott Transformation Blocks Differentiation-induced Inhibition of Serum Response Factor Interactions with Serum Response Elements Cancer Res., August 1, 1999; 59(15): 3795 - 3802. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. S. Belaguli, W. Zhou, T.-H. T. Trinh, M. W. Majesky, and R. J. Schwartz Dominant Negative Murine Serum Response Factor: Alternative Splicing within the Activation Domain Inhibits Transactivation of Serum Response Factor Binding Targets Mol. Cell. Biol., July 1, 1999; 19(7): 4582 - 4591. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Spencer, M. L. Major, and R. P. Misra Basic Fibroblast Growth Factor Activates Serum Response Factor Gene Expression by Multiple Distinct Signaling Mechanisms Mol. Cell. Biol., June 1, 1999; 19(6): 3977 - 3988. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Spencer, M. H. Baron, and E. N. Olson Cooperative Transcriptional Activation by Serum Response Factor and the High Mobility Group Protein SSRP1 J. Biol. Chem., May 28, 1999; 274(22): 15686 - 15693. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Chaudhary and M. K. Skinner Basic Helix-Loop-Helix Proteins Can Act at the E-Box within the Serum Response Element of the c-fos Promoter to Influence Hormone-Induced Promoter Activation in Sertoli Cells Mol. Endocrinol., May 1, 1999; 13(5): 774 - 786. [Abstract] [Full Text]
|
|
|
|
|
|
E. Biesiada, Y. Hamamori, L. Kedes, and V. Sartorelli Myogenic Basic Helix-Loop-Helix Proteins and Sp1 Interact as Components of a Multiprotein Transcriptional Complex Required for Activity of the Human Cardiac alpha -Actin Promoter Mol. Cell. Biol., April 1, 1999; 19(4): 2577 - 2584. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Galvagni, E. Cartocci, and S. Oliviero The Dystrophin Promoter Is Negatively Regulated by YY1 in Undifferentiated Muscle Cells J. Biol. Chem., December 11, 1998; 273(50): 33708 - 33713. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Wei, W. Zhou, J. D. Croissant, F.-E. Johansen, R. Prywes, A. Balasubramanyam, and R. J. Schwartz RhoA Signaling via Serum Response Factor Plays an Obligatory Role in Myogenic Differentiation J. Biol. Chem., November 13, 1998; 273(46): 30287 - 30294. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Ferreira, L. Magnaghi-Jaulin, P. Robin, A. Harel-Bellan, and D. Trouche The three members of the pocket proteins family share the ability to repress E2F activity through recruitment of a histone deacetylase PNAS, September 1, 1998; 95(18): 10493 - 10498. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Carnac, M. Primig, M. Kitzmann, P. Chafey, D. Tuil, N. Lamb, and A. Fernandez RhoA GTPase and Serum Response Factor Control Selectively the Expression of MyoD without Affecting Myf5 in Mouse Myoblasts Mol. Biol. Cell, July 1, 1998; 9(7): 1891 - 1902. [Abstract] [Full Text]
|
|
|
|
|
|
Y. Ling, A. G. West, E. C. Roberts, J. H. Lakey, and A. D. Sharrocks Interaction of Transcription Factors with Serum Response Factor. IDENTIFICATION OF THE Elk-1 BINDING SURFACE J. Biol. Chem., April 24, 1998; 273(17): 10506 - 10514. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Takano, I. Komuro, T. Oka, I. Shiojima, Y. Hiroi, T. Mizuno, and Y. Yazaki The Rho Family G Proteins Play a Critical Role in Muscle Differentiation Mol. Cell. Biol., March 1, 1998; 18(3): 1580 - 1589. [Abstract] [Full Text]
|
|
|
|
|
|
K. A. Dooley, S. Millinder, and T. F. Osborne Sterol Regulation of 3-Hydroxy-3-Methylglutaryl-coenzyme A Synthase Gene through a Direct Interaction Between Sterol Regulatory Element Binding Protein and the Trimeric CCAAT-binding Factor/Nuclear Factor Y J. Biol. Chem., January 16, 1998; 273(3): 1349 - 1356. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Katoh, J. D. Molkentin, V. Dave, E. N. Olson, and M. Periasamy MEF2B Is a Component of a Smooth Muscle-specific Complex That Binds an A/T-rich Element Important for Smooth Muscle Myosin Heavy Chain Gene Expression J. Biol. Chem., January 16, 1998; 273(3): 1511 - 1518. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Ramirez, S. A. S. Ali, P. Robin, D. Trouche, and A. Harel-Bellan The CREB-binding Protein (CBP) Cooperates with the Serum Response Factor for Transactivation of the c-fos Serum Response Element J. Biol. Chem., December 5, 1997; 272(49): 31016 - 31021. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. S. Belaguli, L. A. Schildmeyer, and R. J. Schwartz Organization and Myogenic Restricted Expression of the Murine Serum Response Factor Gene. A ROLE FOR AUTOREGULATION J. Biol. Chem., July 18, 1997; 272(29): 18222 - 18231. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Spencer and R. P. Misra Expression of the Serum Response Factor Gene Is Regulated by Serum Response Factor Binding Sites J. Biol. Chem., July 12, 1996; 271(28): 16535 - 16543. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. P. Mack, A. V. Somlyo, M. Hautmann, A. P. Somlyo, and G. K. Owens Smooth Muscle Differentiation Marker Gene Expression Is Regulated by RhoA-mediated Actin Polymerization J. Biol. Chem., January 5, 2001; 276(1): 341 - 347. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Carson, R. A. Fillmore, R. J. Schwartz, and W. E. Zimmer The Smooth Muscle gamma -Actin Gene Promoter Is a Molecular Target for the Mouse bagpipe Homologue, mNkx3-1, and Serum Response Factor J. Biol. Chem., December 8, 2000; 275(50): 39061 - 39072. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Gupta, P. Kogut, F. J. Davis, N. S. Belaguli, R. J. Schwartz, and M. P. Gupta Physical Interaction between the MADS Box of Serum Response Factor and the TEA/ATTS DNA-binding Domain of Transcription Enhancer Factor-1 J. Biol. Chem., March 23, 2001; 276(13): 10413 - 10422. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. S. Chang, L. Li, J. McAnally, and E. N. Olson Muscle Specificity Encoded by Specific Serum Response Factor-binding Sites J. Biol. Chem., May 11, 2001; 276(20): 17206 - 17212. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. J. Phiel, V. Gabbeta, L. M. Parsons, D. Rothblat, R. P. Harvey, and K. M. McHugh Differential Binding of an SRF/NK-2/MEF2 Transcription Factor Complex in Normal Versus Neoplastic Smooth Muscle Tissues J. Biol. Chem., September 7, 2001; 276(37): 34637 - 34650. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. J. Davis, M. Gupta, S. M. Pogwizd, E. Bacha, V. Jeevanandam, and M. P. Gupta Increased expression of alternatively spliced dominant-negative isoform of SRF in human failing hearts Am J Physiol Heart Circ Physiol, April 1, 2002; 282(4): H1521 - H1533. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |