Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Groisman, R.
Right arrow Articles by Harel-Bellan, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Groisman, R.
Right arrow Articles by Harel-Bellan, A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 271, Number 9, Issue of March 1, 1996 pp. 5258-5264
©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
Physical Interaction between the Mitogen-responsive Serum Response Factor and Myogenic Basic-Helix-Loop-Helix Proteins (*)

(Received for publication, September 11, 1995; and in revised form, December 28, 1995)

Regina Groisman (§) Hiroshi Masutani (¶) Marie-Pierre Leibovitch (1) Philippe Robin Isabelle Soudant Didier Trouche Annick Harel-Bellan (**)

From the Laboratoire de Biologie des Tumeurs Humaines, CNRS URA 1156 and theLaboratoire d'Oncologie Moléculaire, CNRS URA 1967, Institut Gustave Roussy, 39 rue Camille Desmoulins, 94805 Villejuif, France

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Terminal differentiation of muscle cells results in opposite effects on gene promoters: muscle-specific promoters, which are repressed during active proliferation of myoblasts, are turned on, whereas at least some proliferation-associated promoters, such as c-fos, which are active during cell division, are turned off. MyoD and myogenin, transcription factors from the basic-helix-loop-helix (bHLH) family, are involved in both processes, up-regulating muscle genes and down-regulating c-fos. On the other hand, the serum response factor (SRF) is involved in the activation of muscle-specific genes, such as c-fos, as well as in the up-regulation of a subset of genes that are responsive to mitogens. Upon terminal differentiation, the activity of these various transcription factors could be modulated by the formation of distinct protein-protein complexes. Here, we have investigated the hypothesis that the function of SRF and/or MyoD and myogenin could be modulated by a physical association between these transcription factors.

We show that myogenin from differentiating myoblasts specifically binds to SRF. In vitro analysis, using the glutathione S-transferase pull-down assay, indicates that SRF-myogenin interactions occur only with myogenin-E12 heterodimers and not with isolated myogenin. A physical interaction between myogenin, E12, and SRF could also be demonstrated in vivo using a triple-hybrid approach in yeast.

Glutathione S-transferase pull-down analysis of various mutants of the proteins demonstrated that the bHLH domain of myogenin and that of E12 were necessary and sufficient for the interaction to be observed. Specific binding to SRF was also seen with MyoD. In contrast, Id, a natural inhibitor of myogenic bHLH proteins, did not bind SRF in any of the situations tested. These data suggest that SRF, on one hand, and myogenic bHLH, on the other, could modulate each other's activity through the formation of a heterotrimeric complex.


INTRODUCTION

Proliferation and cell differentiation are mutually exclusive processes, as best exemplified in muscle precursor cells. Proliferation inhibition is a crucial step that precedes muscle-specific gene expression and cell fusion into myotubes in the process of muscle cell terminal differentiation(1) . Indeed, terminal differentiation of myoblastic cell lines in vitro is triggered by the accumulation of the precursor cells (myoblasts) in a G(0) state(1) . This step is a prerequisite, and a number of mitogens(2, 3, 4, 5) or oncogenes (6, 7, 8, 9, 10) inhibit terminal differentiation.

Two distinct families of transcription factors, MEF-1 and MEF-2, (^1)are instrumental to the muscle cell differentiation process. The MEF-1 family includes the myogenic bHLH proteins MyoD(11, 12, 13) , myogenin(14, 15) , Myf5 (16) and MRF4/herculin/Myf6(17) . These proteins are all able to elicit in vitro a muscle determination program in a number of nonmuscle cell types(18, 19) . These muscle-restricted proteins share a domain of homology, the bHLH, which is also common to ubiquitous transcription factors such as the products of the E2A gene, E12 and E47(20, 21) , with which myogenic factors form heterodimeric complexes. Heterodimers between myogenic bHLH and E12 or E47 (22, 23, 24, 25, 26) bind to upstream regulatory sequences of the form CANNTG (E boxes) (27) in muscle-specific gene promoters. MyoD, myogenin, and Myf5 are all able to transactivate these promoters efficiently(28) , a function that involves a common motif in the basic domain(29) .

MEF-2 transcription factors are members of the MADS box protein family. MADS box proteins are widely expressed, from plants to man and including yeast(30) . MADS box proteins exert a wide range of functions from development in plant cells to muscle differentiation or growth factor responses in mammalian cells. In yeast, the MADS box protein MCM1 is involved in the mating-type phenotype(31) . A highly homologous protein, the serum response factor (SRF), is instrumental to immediate early gene mitogenic responses in mammals(32, 33) . The sequences that are recognized by the two proteins are homologous(34) . The two proteins function in a similar manner: although both proteins are able to transactivate transcription(35, 36) , they mainly function by recruiting ternary complex-forming factors through a protein motif located in the MADS box(37, 38) .

The MEF-2 subset of MADS box proteins includes four members, MEF-2A, MEF-2B, MEF-2C, and MEF-2D, some of which are ubiquitous and some restricted to differentiated muscle cells. These proteins are related to SRF and are often referred to as rSRF proteins(39) . They bind to and transactivate CTA(A/T)(4)TAG DNA elements, a consensus sequence that is homologous, but not identical, to the CArG boxes (CC(A/T)(6)GG), which are recognized by SRF. In fact, SRF and rSRF(MEF-2) cannot heterodimerize with each other(39) , and thus, they belong to distinct subsets of MADS box proteins.

The factors that control the balance between proliferation and differentiation in muscle are not fully understood at present. However, myogenic factors of the bHLH family seem to be involved in this delicate control. In particular, MyoD is both a target for mitogens that are inhibiting differentiation (2, 7, 10) and a negative regulator for cell proliferation in vitro(40, 41) . Part of the mechanism by which MyoD blocks cell proliferation in vitro seems to be the repression of proliferation-associated genes, and indeed, most of the proliferation-associated genes are silent in differentiated muscle cells(42) . In particular, immediate early genes such as c-fos are repressed on terminal differentiation(42, 43) . In fact, the transcription factor AP1, which is formed by heterodimers between members of the Fos-related proteins and members of the Jun-related factors, is a prominent target for MyoD: MyoD interferes with AP1 function by forming specific complexes with Jun proteins(44) . In addition, MyoD (43) and myogenin (45) both act as repressors for the c-fos promoter through the inhibition of its main element, the serum response element (SRE)(46) . The SRE includes a CArG box, the binding site for SRF, which is repressed on differentiation.

Paradoxically, CArG boxes are involved in the up-regulation of some muscle-specific genes such as cardiac alpha-actin(22, 47, 48, 49) , skeletal alpha-actin(50, 51) , myosin light chain 1A(52) , dystrophin(53) , and muscle creatine kinase(54) . SRF itself has been shown to be involved in muscle gene up-regulation(51, 55, 56) . Furthermore, SRF seems to be indispensable for muscle cell terminal differentiation(57) . Indeed, CArG boxes of muscle genes can be replaced by the c-fos SRF-binding site without any loss of function(58) , strongly suggesting that the same protein is involved in the activation of both genes. Thus, SRF is instrumental to the activation of both mitogen-responsive genes, such as c-fos or beta-actin, which are down-regulated on muscle cell terminal differentiation(32, 33, 46) , and muscle-specific genes.

The mechanism by which SRF is converted into a muscle-specific transactivator is largely unknown. In muscle-specific promoters, transactivation by SRF could use a slightly different mechanism than that used in the c-fos promoter: the affinity of SRF for muscle CArG boxes is lower than its affinity for c-fos SRE (58, 59) . Furthermore, whereas one SRF-binding site is sufficient for mitogen responses, several sites are necessary to observe muscle-specific expression(51, 60) . Therefore, it seems likely that with regard to muscle genes, SRF needs to cooperate with other factors for optimal transactivation. A tempting hypothesis would thus be that, in order to be active on muscle promoters, SRF needs to interact physically with other factors.

In this paper, we have tested the hypothesis that SRF interacts with the myogenic bHLH proteins. We demonstrate that a heterotrimeric complex forms between bHLH proteins and SRF both in vitro and in cultured cells. The formation of this complex could be one of the means by which SRF activity is deviated from proliferative to differentiating genes upon muscle cell terminal differentiation.


MATERIALS AND METHODS

Plasmids

pEMSV-E12, pGST-SRF, and pSRE-CAT were as described in (43) . pEMSV-myogenin was a kind gift of Dr. E. Olson. pEMSV-DeltabH1-myogenin (in which amino acids 71-96 have been deleted) and pEMSV-DeltaH-myogenin (in which amino acids 71-163 have been deleted) were constructed using a polymerase chain reaction-amplified insert. The internal primers were TGCAAGGTGCACAGCGCCTCCTGCAG and GGCGCTGTGCACCTTGCATGCCCACG for pEMSV-DeltaH-myogenin and TGCAAGGTGGTGAATGAGGCCTTCGAGG and CTCATTCACCACCTTGCATGCCCACG for pEMSV-DeltabH1-myogenin. The forward external primer included a consensus translation start site(61) , and both forward and reverse external primers included an EcoRI restriction site for cloning convenience. The sequences of these primers were GGAATTCACCATGGAGCTGTATGAGACATCCC (forward) and GGGGGGAATTCAGTTGGGCATGGTTTCG (reverse). pHIV-SRF, used in in vitro translation experiments, was constructed by replacing the chloramphenicol acetyltransferase gene in a pGEM-HIV-CAT construct (62) with a sequence encoding the complete SRF protein obtained by polymerase chain reaction amplification (forward primer sequence, 5`-CCCCAAGCTTACCATGTTACCGACCCAA-3`; and reverse primer sequence, 5`-TCATTCACTCTTGGTGCTGTGGGCGGTG-3`).

Plasmids pGAD424 and pGBT9 were a kind gift of Dr. S. Fields(63) . Plasmid pRS313 has been described by Sikorski and Hieter(64) . Plasmids pGAD-E12 and pGAD-myogenin were constructed by inserting the corresponding complete coding sequence, obtained by polymerase chain reaction using the above-described primers for myogenin or the primers described in (43) for E12, into the EcoRI site of pGAD424. Plasmid pGB-SRF was constructed by inserting the complete coding sequence of SRF, obtained by polymerase chain reaction using the above-described primers and subcloned into a Bluescribe vector, between the EcoRI and SalI sites of pGBT9. pRS-E12 and pRS-myogenin were constructed by subcloning an SphI-SphI insert from the corresponding pGAD construct into the SmaI site of pRS313. These constructs were controlled by partial sequence (which did not reveal any mutations), and results obtained with these constructs were confirmed using two independent clones.

pEMSV-MyoD, pEMSV-MyoD-DeltabH, pEMSV-MyoD-bE12, and pEMSVMyoD-bT4 were kind gifts of Dr. H. Weintraub(27) . pEMSV-myogenin, pEMSV-DeltaN-myogenin, pEMSV-DeltaC-myogenin, and pEMSV-DeltaN/DeltaC-myogenin were kind gifts of Dr. E. Olson(65) .

Cells and Transfections

NIH-3T3 cells were maintained in Dulbecco's modified Eagle's medium supplemented with antibiotics (a mixture of penicillin and streptomycin (Life Technologies, Inc.) used according to the manufacturer's recommendations) and 5% FCS. Cells were transfected by electroporation as described previously(43) . Briefly, cells were harvested by scraping, washed, and resuspended in 150 µl of Dulbecco's modified Eagle's medium supplemented with 0.5% FCS. 2 µg of SRE-CAT; the indicated doses of pEMSV-E12, pEMSV-myogenin, or mutants; and 1 µg of RSV-luc (as an internal control for transfection efficiency) were added. After electrical shock (using a Bio-Rad apparatus at 960 microfarads and 200 V), each sample was divided into two aliquots, and cells were maintained in Dulbecco's modified Eagle's medium supplemented with 0.5% FCS for 48 h, after which one of the aliquots was treated with 20% serum for 4 h. Cells were harvested, and extracts were standardized based on the luciferase activity of the nonserum-treated sample (samples from the same transfection were standardized based on the protein content, as measured by a Bio-Rad assay). Chloramphenicol acetyltransferase activity was measured using [^14C]chloramphenicol and standard procedures with a 4-h assay.

GST Pull-down

GST or GST-SRF beads were prepared according to Lassar et al.(66) , except that the fusion proteins were not eluted. After four washes in NETN buffer (100 mM NaCl, 1 mM EDTA, 20 mM Tris, pH 8, and 0.5% Nonidet P-40), aliquots of 10 µl of beads were frozen at -70 °C. pEMSV-E12, pEMSV-myogenin, pEMSV-MyoD, and various mutants were in vitro translated or cotranslated using the TNT translation kit (Promega) following the manufacturer's recommendations. The programed lysates (10 µl) were incubated with the GST or GST-SRF beads (10 µl) for 1 h at room temperature. The beads were washed five times in NETN buffer and mixed with 1 volume of 2 times SDS loading buffer, and bound proteins were analyzed by SDS-polyacrylamide gel electrophoresis using standard procedures.

Analysis of Myoblastic Proteins

C2C12 myoblasts were maintained in Dulbecco's modified Eagle's medium supplemented with 10% FCS. Confluent dishes were induced to differentiate by switching the medium to 0.5% FCS. Differentiating cells were harvested by scraping, and nuclear proteins were prepared according to the method of Dignam et al.(67) . 200 µg of extracts were incubated for 1 h at room temperature with GST or GST-SRF beads, and bound proteins were analyzed by SDS-polyacrylamide gel electrophoresis followed by dry transfer. Filters were probed with an anti-myogenin monoclonal antibody, a kind gift of Dr. W. E. Wright(68) , and revealed by chemiluminescence using an Amersham kit following the manufacturer's recommendations.

Double and Triple Hybrids in Yeast

Yeast cells (strain Y526) were transfected with 1 µg of each of the indicated plasmids and brought to 5 µg in salmon sperm DNA as described by Legrain and Chapon(69) . Transfected yeast cells were processed for colorimetric detection of beta-galactosidase activity using standard procedures(70) . Clones of transfected yeast were also grown to 0.8 A and extracted as described(69) . 20 µl of extract were assayed for beta-galactosidase activity using a chemiluminescent detection procedure (Tropix Inc.) according to the manufacturer's instructions.


RESULTS

Myogenin Physically Interacts with SRF

A biochemical approach was used (71) to test the hypothesis of a physical interaction between SRF and myogenic bHLH. GST or GST-SRF covered beads were incubated with S-labeled, in vitro translated myogenin and/or E12 (Fig. 1A). These experiments were controlled using an irrelevant translation product (luciferase) as a negative control and standardized using SRF core (DNA binding and dimerization domain) as an internal positive control (data not shown). The results demonstrated that neither myogenin (lane 6) nor E12 (lane 4) was able to bind to SRF when isolated. However, a significant level of binding could be detected when both proteins were cotranslated (lane 8), suggesting that formation of heterodimers between myogenin and E12 results in SRF recognition. The converse experiments, in which beads were coated with a mixture of GST-E12 and GST-myogenin and used to retain in vitro translated SRF, did not give clearly interpretable data, most likely due to inefficient heterodimerization of E12 and myogenin on the beads. However, when myogenin-coated beads were incubated sequentially with in vitro translated E12 and then with SRF, a significant level of SRF retention could be observed (data not shown).


Figure 1: In vitro and in vivo interactions between myogenin and SRF. A, GST pull-down assay. E12 (lane 1) and myogenin (lane 2) were in vitro translated alone or in combination (lane 3), as indicated (Input: one-tenth of the amount used in the GST pull-down assay). Translation products were incubated with beads covered with GST (G; lanes 5, 7, and 9) or GST-SRF (S; lanes 4, 6, and 8). Bound products were analyzed by SDS-polyacrylamide gel electrophoresis. The positions of E12 and myogenin translation products are shown. B, triple-hybrid assay. Indicator yeast cells were transfected with expression vectors for fusion proteins between the GAL4-activating domain (pGAD) or the DNA-binding domain (pGB) and a third construct, pRS, resulting in the expression of GAL4 AD-E12 and/or GAL4 AD-myogenin (Myog) and GAL4 GB-SRF, as indicated. Transfected yeast cells were analyzed for beta-galactosidase expression by a colorimetric assay (each streak represents an independent clone) or by a quantitative chemiluminescent assay (RLUs, arbitrary light units), as indicated. C, confluent C2C12 mouse myoblastic cells were kept in high serum (lanes 3, 6, and 7) or induced to differentiate for 24 h (lanes 4, 8, and 9) or 48 h (lanes 5, 10, and 11). Nuclear proteins were analyzed by Western blotting using anti-myogenin antibodies, either directly (lanes 3-5) or after absorption onto GST-covered beads (G; lanes 7, 9, and 11) or GST-SRF-covered beads (S; lanes 6, 8, and 10). Lanes 1 and 2 show a direct analysis by Western blotting of in vitro translated myogenin. NP, nonprogramed lysate; myog, myogenin.



These results were confirmed in vivo using a double-hybrid approach in yeast(63) . Indicator yeast cells (permanently transfected with a GAL1-lacZ reporter construct) were transfected with expression vectors encoding fusion proteins between the GAL4 DNA-binding domain (pGB series) or transactivating domain (pGAD series) and SRF, myogenin, or E12 in all combinations. These experiments showed that expression of fusion products between the GAL4 DNA-binding domain and E12 or myogenin resulted in a high background, indicating that the transactivation domains of these proteins are active in yeast (data not shown). Therefore, these constructs could not be used in subsequent assays. When yeast cells were transfected with pGB-SRF and pGAD-myogenin or pGAD-E12, no beta-galactosidase could be detected, suggesting that a heterodimer does not form between SRF and E12 or myogenin, as expected from the results of GST pull-down assays. We next introduced, into the same yeast indicator cells, three expression vectors bearing three distinct selectable markers and encoding a fusion protein between the GAL4 DNA-binding domain and SRF and fusion proteins between the GAL4 activation domain and myogenin or E12, respectively. Yeast that had received the three expression vectors expressed significant amounts of beta-galactosidase (Fig. 1B), indicating that a heterotrimer had formed in the cells, resulting in the activation of the GAL4-responsive promoter. In contrast, galactosidase activity was hardly detectable in yeast transfected with SRF and E12 or with SRF and myogenin (lanes 1 and 2), confirming that complex formation between SRF and isolated E12 or myogenin was not very efficient. All other combinations, including pGAD-myogenin (or pGAD-E12), pGB-SRF, and pRS as a backbone vector, resulted in background or low expression of beta-galactosidase (data not shown). Taken together, these data indicate that heterodimers of myogenin and E12 physically interact with SRF in vitro and in vivo.

A complex between SRF and myogenin was also detected when nuclear extracts from differentiating myoblasts were used (Fig. 1C). C2C12 cells were or were not induced to differentiate in low serum. Nuclear proteins were extracted at different time points and incubated with GST- or GST-SRF-covered agarose beads. Bound proteins were analyzed by SDS-polyacrylamide gel electrophoresis followed by Western blotting using an anti-myogenin monoclonal antibody. These experiments demonstrated that cellular myogenin, amounts of which increased during differentiation, was specifically retained on SRF-coated beads in differentiating myoblasts. Taken together, these data demonstrate that myogenin, in its physiological heterodimeric form, binds to SRF.

Physical Interaction between SRF and Myogenin Occurs through Dimerization/DNA-binding Domains

Myogenin and E12 are structurally organized in domains. To test which parts of the molecules were involved in the interaction with SRF, deletion mutants of both proteins were tested in the GST pull-down assay (Fig. 2). Removing the C- or N-terminal part of myogenin or E12 was not detrimental to SRF recognition (Fig. 2B). In fact, both regions of the molecules could be deleted, and the resulting minimal bHLH domain was sufficient to observe specific binding to SRF-covered beads. Indeed, myogenin mutants in which the bHLH domain was partly (DeltabH1) or entirely (DeltaH) deleted could not bind specifically to SRF (Fig. 2D, lanes 6-9). Note that these mutants were also unable to heterodimerize with E12 (lanes 10-12). These data indicate that the bHLH domains of myogenin and E12 are both necessary and sufficient to observe the interaction.


Figure 2: The bHLH domains of E12 and myogenin are necessary and sufficient for specific SRF recognition. A, deletion mutants used. Solid boxes, basic domain; hatched boxes, HLH domain. B, GST pull-down analysis of wild-type myogenin and E12 (lanes 1 and 2) or deletion mutants of myogenin (lanes 3-8) or E12 (lanes 9-12). The positions of the various mutants are indicated by arrows, and the corresponding inputs are shown in C. D, GST pull-down analysis of wild-type myogenin (lanes 1, 4, 5, and 10) or deletion mutants that have lost the b and H1 region (DeltabH1; lanes 2, 6, 7, and 11) or the entire bHLH domain (DeltaH; lanes 3, 8, 9, and 12). Translation products were analyzed on beads coated with GST (G; lanes 5, 7, and 9), GST-SRF (S; lanes 4, 6, and 8), or GST-E12/myogenin (lanes 10-12).



On the other hand, experiments performed with deletion mutants of SRF indicated that, similarly, core SRF (a minimal domain of SRF that includes the DNA-binding and dimerization domains) was sufficient to observe a specific interaction with myogenin (Fig. 3). No interaction could be detected with the N- or C-terminal moiety of SRF.


Figure 3: Core SRF is necessary and sufficient to interact specifically with bHLH proteins. A, deletion mutants of SRF used. The hatched boxes indicate the location of the MADS box. B, GST-pull down analysis of wild-type myogenin and E12 on beads coated with GST (lane 2), GST-wild-type SRF (lane 1), or mutants that have lost amino acids 11-244 (C-SRF; lane 3), 142-508 (N-SRF; lane 4), or 11-142 and 244-508 (DeltaNDeltaC-SRF; lane 5). Translation products were also analyzed on beads coated with core SRF as an internal control for the various beads (MADS-SRF; lanes 6-10).



Taken together, these results indicate that the DNA-binding domains of SRF, E12, and myogenin are both necessary and sufficient to observe the interaction, raising the possibility that the interaction occurs through nonspecific binding of these proteins to contaminating DNA during the GST pull-down assay. However, the interaction among the three proteins was still observed when contaminating DNA was degraded using nuclease or when the GST pull-down assay was performed in the presence of ethidium bromide, which prevents DNA-protein interaction (data not shown). The results of these control experiments rule out the possibility that the SRFbulletbHLH complex could be due to artifactual nonspecific binding to DNA.

SRF Recognition Is Restricted to a Subset of bHLH Proteins

To further analyze the interaction between bHLH proteins and SRF, we have tested a variety of bHLH proteins in the GST pull-down assay. The results indicate that specific binding to SRF is not a feature restricted to myogenin, but is also observed for MyoD (Fig. 4B). MyoD was not retained on SRF-covered beads, but the products of MyoD and E12 cotranslation were specifically retained. MyoD-SRF interaction requires the MyoD bHLH domain since a mutant that has lost this domain cannot recognize SRF (Fig. 4B).


Figure 4: Analysis of various bHLH proteins. A, MyoD mutants used in the assay. B, GST-pull down analysis of wild-type MyoD (lanes 1, 3, and 4) or a mutant that has lost the N-terminal part of the bHLH domain (lanes 2, 5, and 6) on GST-coated (G; lanes 4 and 6) or GST-SRF-coated (S; lanes 3 and 5) beads. Lanes 1 and 2 show the input. C, GST pull-down analysis of Id on GST (lane 3), GST-SRF (lane 2), or GST-E12/myogenin (lane 4). Lane 1 shows the input. D, GST pull-down analysis of wild-type MyoD (lanes 1, 2, 7, and 8), a deletion mutant that has lost the N-terminal part of the bHLH domain (lanes 3 and 4), or mutants in which the b domain has been replaced by that of E12 (lanes 5 and 6) or T4 achaete scute (lanes 9 and 10).



However, the ability to physically interact with SRF was not observed for all members of the bHLH family. In particular, Id, a functional antagonist of MyoD or myogenin, did not bind to SRF, either alone or in combination with E12 (Fig. 4C). We have also tested several mutants of MyoD or myogenin (Fig. 4D). MyoD-bE12 (a mutant of MyoD in which the basic domain has been replaced by the E12 basic domain) and MyoD-bT4 (in which the basic domain has been replaced by that of the T4 achaete scute Drosophila protein) both bind to DNA efficiently(27) , but do not transactivate muscle genes. Whereas MyoD-bE12 retains a high affinity for SRF, MyoD-bT4 has lost SRF recognition.


DISCUSSION

Terminal differentiation of myoblasts is accompanied by drastic changes in the pattern of gene expression: muscle-specific genes are up-regulated, while mitogen-responsive promoters are repressed. Paradoxically, some enhancer elements are involved in the activation of both mitogen-responsive and differentiation-associated genes. In particular, CArG boxes or related elements are active in a number of muscle promoters(51, 55, 60, 72, 73, 74, 75, 76) as well as in immediate early genes such as c-fos or cytoskeletal actin(33, 77) . Furthermore, the CArG box-binding protein SRF, a prominent factor in the immediate early response to mitogens, seems also to be indispensable for muscle cell terminal differentiation(57) . Thus, SRF is involved in the up-regulation of both mitogen-responsive genes (such as c-fos) and differentiation-associated genes (such as those encoding muscle-specific proteins), although these two sets of genes are regulated in an opposite manner. A tempting hypothesis to explain this apparent paradox is that SRF activity is regulated through the formation of distinct protein complexes. In particular, SRF activity, during muscle terminal differentiation, could be modulated by a physical interaction with factors involved in this process. We have thus tested the hypothesis that such a physical interaction could occur between the myogenic bHLH proteins and SRF and found that complexes could indeed be detected between MyoD or myogenin using various assays in vitro or in vivo, including GST pull-down and hybrid assays in yeast. Interestingly, this interaction requires that myogenic bHLH be in a heterodimeric form: no complex could be detected between myogenin or MyoD and SRF in the absence of E12. Accordingly, complex formation required the integrity of the bHLH domain on both E12 and MyoD or myogenin. A likely interpretation of these results is that heterodimeric formation between E12 and MyoD or myogenin induces a conformational change in the proteins that unmasks a site of interaction with SRF. The bHLH domain is also sufficient for the interaction to occur, suggesting that this conformational change occurs in the bHLH domain, which is not unexpected. Interestingly, core SRF is also necessary and sufficient for complex formation with bHLH. This suggests that core SRF is involved in a wide variety of functions, including dimerization and DNA binding(32) , interaction with p62(78) , transcriptional activation in response to some signal transduction pathways(36) , and interaction with members of distinct transcription factor families (this study). Furthermore, this interaction might also be observed with other members of the MADS box family that share large domains of homology with core SRF. Indeed, a similar physical interaction has been demonstrated for MEF-2(79) , although for MEF-2, the formation of the complex did not require the presence of E12.

From a biochemical point of view, we do not know if the interaction between SRF and the heterodimeric bHLH proteins involves amino acids from the three proteins or if only two of the proteins are physically involved. It should be noted, however, that some mutations in MyoD the bHLH domain result in inactivation of SRF recognition, suggesting that MyoD and myogenin are directly involved in SRF binding. Our experiments have been performed in various systems, from reticulocytes to yeast, and thus, it is likely that the interaction among the three proteins is direct. However, we cannot rule out the possibility that a fourth protein, which would be ubiquitous, is also involved.

From a functional point of view, it is not clear which activity, that of SRF or that of myogenic bHLH, is modulated by the formation of the trimolecular complex. It is, however, clear that formation of this trimeric complex is associated with the terminal step of muscle differentiation since 1) it is detected only with cells that have entered the differentiation process; 2) it requires heterodimerization of MyoD or myogenin with E12, an event that occurs only at this step of the process, even if MyoD pre-exists in myoblasts; and 3) Id-E12 complexes, which are present in proliferating myoblasts, do not bind to SRF. The formation of the complex on terminal differentiation might turn SRF, a ubiquitous protein that is a key participant in immediate early responses, into a muscle-specific transactivator. In this regard, this interaction could explain several puzzling observations. First, SRF has a low affinity for muscle gene CArG boxes(51, 58, 59) , although it seems instrumental to the up-regulation of these genes. By a cooperative binding with heterodimers of myogenic bHLH proteins, SRFbulletDNA complexes could gain enough stability for SRF to be active. Second, although SRF is present and active on mitogen-responsive genes in proliferating myoblasts, muscle-specific genes remain silent until terminal differentiation. This could easily be explained by the fact that transactivation of muscle genes by SRF requires the formation of a complex with myogenic bHLH proteins.

However, we cannot rule out the possibility that the formation of this complex also results in MyoD/myogenin modulation by SRF. In fact, for some muscle promoters, the transactivation of E boxes by MyoD or myogenin requires that an intact CArG box also be present on the promoter(52) . This suggests some cooperation between myogenic bHLH and proteins binding to the CArG box. Clearly, however, the interaction with SRF is not sufficient for myogenic activity of bHLH proteins: MyoD-bE12, a MyoD mutant that has lost myogenic activity(27) , is still able to recognize SRF in a specific manner; thus, some functionality of the basic domain distinct from SRF recognition is required for myogenic activity.

It is thus possible that the formation of the SRFbulletbHLH complex results in the modulation of each of the partners of the complex, SRF and myogenic bHLH proteins. Various functions could be regulated in this manner. For example, the formation of this complex could be a mechanism used by myogenic bHLH proteins to repress SRF from transactivating mitogen-responsive genes such as c-fos(43) . Myogenic bHLH proteins repress c-fos SRE through binding to an E box overlapping the CArG box in the DNA element. The formation of a multiprotein complex on the element could explain the observed inhibition. Preliminary data, using an improved electrophoretic mobility shift assay(80) , suggested that such a multiprotein complex (including myogenin, E12, and SRF) could assemble on c-fos SRE, although this complex seems to be unstable (data not shown). We are currently analyzing this complex in more detail.

An alternative hypothesis would be that the interaction between SRF and myogenic bHLH increases the affinity of SRF for noncanonical CArG boxes or the affinity of myogenic bHLH for E boxes that are distant from the consensus sequence. We are currently running experiments to test this hypothesis. It is also possible that this interaction is involved in a step that follows the binding to DNA, such as transcriptional transactivation. It is important to note that the cooperation between CArG boxes and E boxes in muscle genes is mainly observed in cardiac muscle cells. It is thus possible that a similar interaction involves members of both families of protein that are specifically expressed in cardiac muscle.

Taken together, our results indicate that myogenic bHLH proteins are able to form a heterotrimeric complex with SRF both in vitro and in vivo. The existence of this complex could help explain how SRF, which is a ubiquitous factor involved in immediate early responses, is converted into a muscle-specific transactivator on muscle cell differentiation.


FOOTNOTES

*
This work was supported in part by grants from the Association pour la Recherche sur le Cancer, from the Association Française contre les Myopathies, and from the Ligue Nationale contre le Cancer. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
Recipient of a fellowship from the Association des Amis des Sciences.

Recipient of a travel award from the Ryoichi Naito Fondation for Medical Research.

**
To whom correspondence should be addressed. Tel.: 33-1-45-59-45-15; Fax: 33-1-45-59-64-94.

(^1)
The abbreviations used are: MEF, myocyte enhancer factor; SRF, serum response factor; SRE, serum response element; FCS, fetal calf serum; GST, glutathione S-transferase; bHLH, basic-helix-loop-helix.


ACKNOWLEDGEMENTS

We thank Pierre Legrain for helpful discussion and advice in the triple-hybrid system in yeast, Serge Leibovitch for helpful discussion, and Marie-Christine Dokhélar and Linda Pritchard for critical reading of the manuscript.


REFERENCES

  1. Olson, E. N., Brennan, T. J., Chakraborty, T., Cheng, T. C., Cserjesi, P., Edmondson, D., James, G., and Li, L. (1991) Mol. Cell. Biochem. 104, 7-13 [Medline] [Order article via Infotrieve]
  2. Vaidya, T. B., Rhodes, S. J., Taparowsky, E. J., and Konieczny, S. F. (1989) Mol. Cell. Biol. 9, 3576-3579 [Abstract/Free Full Text]
  3. Brennan, T. J., Edmondson, D. G., Li, L., and Olson, E. N. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 3822-3826 [Abstract/Free Full Text]
  4. Martin, J. F., Li, L., and Olson, E. N. (1992) J. Biol. Chem. 267, 10956-10960 [Abstract/Free Full Text]
  5. Edmondson, D. G., Brennan, T. J., and Olson, E. N. (1991) J. Biol. Chem. 266, 21343-21346 [Abstract/Free Full Text]
  6. Miner, J. H., and Wold, B. J. (1991) Mol. Cell. Biol. 11, 2842-2851 [Abstract/Free Full Text]
  7. Lassar, A. B., Thayer, M. J., Overell, R. W., and Weintraub, H. (1989) Cell 58, 659-667 [CrossRef][Medline] [Order article via Infotrieve]
  8. Grossi, M., Calconi, A., and Tato, F. (1991) Oncogene 6, 1767-1773 [Medline] [Order article via Infotrieve]
  9. Falcone, G., Alema, S., and Tato, F. (1991) Mol. Cell. Biol. 11, 3331-3338 [Abstract/Free Full Text]
  10. Li, L., Chambard, J. C., Karin, M., and Olson, E. N. (1992) Genes & Dev. 6, 676-689
  11. Tapscott, S. J., Davis, R. L., Thayer, M. J., Cheng, P., Weintraub, H., and Lassar, A. B. (1988) Science 242, 405-411 [Abstract/Free Full Text]
  12. Davis, R. L., Weintraub, H., and Lassar, A. B. (1987) Cell 51, 987-1000 [CrossRef][Medline] [Order article via Infotrieve]
  13. Weintraub, H., Tapscott, S. J., Davis, R. L., Thayer, M. J., Adam, M. A., Lassar, A. B., and Miller, A. D. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 5434-5438 [Abstract/Free Full Text]
  14. Wright, W. E., Sassoon, D. A., and Lin, V. K. (1989) Cell 56, 607-617 [CrossRef][Medline] [Order article via Infotrieve]
  15. Edmondson, D. G., and Olson, E. N. (1989) Genes & Dev. 3, 628-640
  16. Braun, T., Buschhausen-Denker, G., Bober, E., Tannich, E., and Arnold, H. H. (1989) EMBO J. 8, 701-709 [Medline] [Order article via Infotrieve]
  17. Rhodes, S. J., and Konieczny, S. F. (1989) Genes & Dev. 3, 2050-2061
  18. Olson, E. N. (1990) Genes & Dev. 4, 1454-1461
  19. Weintraub, H., Davis, R., Tapscott, S., Thayer, M., Krauze, M., Benezra, R., Blackwell, T. K., Turner, D., Rupp, R., and Hollenberg, S. (1991) Science 251, 761-766 [Abstract/Free Full Text]
  20. Schlissel, M., Voronova, A., and Baltimore, D. (1991) Genes & Dev. 5, 1367-1376
  21. Murre, C., Mc Caw, P. S., and Baltimore, D. (1989) Cell 56, 777-783 [CrossRef][Medline] [Order article via Infotrieve]
  22. French, B. A., Chow, K. L., Olson, E. N., and Schwartz, R. J. (1991) Mol. Cell. Biol. 11, 2439-2450 [Abstract/Free Full Text]
  23. Lin, H., and Konieczny, S. F. (1992) J. Biol. Chem. 267, 4773-4780 [Abstract/Free Full Text]
  24. Lassar, A. B., Davis, R. L., Wright, W. E., Kadesch, T., Murre, C., Voronova, A., Baltimore, D., and Weintraub, H. (1991) Cell 66, 305-315 [CrossRef][Medline] [Order article via Infotrieve]
  25. Chakraborty, T., Brennan, T. J., Li, L., Edmondson, D., and Olson, E. N. (1991) Mol. Cell. Biol. 11, 3633-3641 [Abstract/Free Full Text]
  26. Brennan, T. J., and Olson, E. N. (1990) Genes & Dev. 4, 582-595
  27. Davis, R. L., Cheng, P., Lassar, A. B., and Weintraub, H. (1990) Cell 60, 733-746 [CrossRef][Medline] [Order article via Infotrieve]
  28. Weintraub, H. (1994) Cell 75, 1241-1244
  29. Brennan, T. J., Chakraborty, T., and Olson, E. N. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 5675-5679 [Abstract/Free Full Text]
  30. Schwarz-Sommer, Z., Huijser, P., Nacken, W., Saedler, H., and Sommer, H. (1990) Science 250, 931-936 [Abstract/Free Full Text]
  31. Passmore, S., Elble, R., and Tye, B. K. (1989) Genes & Dev. 3, 921-935
  32. Norman, C., Runswick, M., Pollock, R., and Treisman, R. (1988) Cell 55, 989-1003 [CrossRef][Medline] [Order article via Infotrieve]
  33. Treisman, R. (1987) EMBO J. 6, 2711-2717 [Medline] [Order article via Infotrieve]
  34. Hayes, T. E., Sengupta, P., and Cochran, B. H. (1988) Genes & Dev. 2, 1713-1722
  35. Christ, C., and Tye, B. K. (1995) Genes & Dev. 5, 751-763
  36. Hill, C. S., Wynne, J., and Treisman, R. (1994) EMBO J. 13, 5421-5432 [Medline] [Order article via Infotrieve]
  37. Primig, M., Winkler, H., and Hammerer, G. (1991) EMBO J. 10, 4209-4218 [Medline] [Order article via Infotrieve]
  38. Sharrocks, A. D., Gille, H., and Shaw, P. E. (1993) Mol. Cell. Biol. 13, 123-132 [Abstract/Free Full Text]
  39. Pollock, R., and Treisman, R. (1991) Genes & Dev. 5, 2327-2341
  40. Sorrentino, V., Pepperkok, R., Davis, R. L., Ansorge, W., and Philipson, L. (1990) Nature 345, 813-815 [CrossRef][Medline] [Order article via Infotrieve]
  41. Crescenzi, M., Fleming, T. P., Lassar, A. B., Weintraub, H., and Aaronson, S. A. (1990) Proc. Natl. Acad. Sci. U. S. A.. 87, 8442-8446 [Abstract/Free Full Text]
  42. Leibovitch, M. P., Leibovitch, S. A., Hillion, J., Guillier, M., Schmitz, A., and Harel, J. (1987) Exp. Cell Res. 170, 80-92 [CrossRef][Medline] [Order article via Infotrieve]
  43. Trouche, D., Grigoriev, M., Lenormand, J. L., Robin, P., Leibovitch, S. A., Sassone-Corsi, P., and Harel-Bellan, A. (1993) Nature 363, 79-82 [CrossRef][Medline] [Order article via Infotrieve]
  44. Bengal, E., Ransone, L., Scharfmann, R., Dwarki, V. J., Tapscott, S. J., Weintraub, H., and Verma, I. M. (1992) Cell 68, 507-519 [CrossRef][Medline] [Order article via Infotrieve]
  45. Trouche, D., Masutani, H., Groisman, R., Robin, P., Lenormand, J.-L., and Harel-Bellan, A. (1995) FEBS Lett. 361, 140-144 [CrossRef][Medline] [Order article via Infotrieve]
  46. Treisman, R. (1992) Trends Biochem. Sci. 17, 423-426 [CrossRef][Medline] [Order article via Infotrieve]
  47. Miwa, T., and Kedes, L. (1987) Mol. Cell. Biol. 7, 2803-2813 [Abstract/Free Full Text]
  48. Mohun, T. J., Taylor, M. V., Garett, N., and Gurdon, J. B. (1989) EMBO J. 8, 1153-1161 [Medline] [Order article via Infotrieve]
  49. Quitschke, W. W., DePonti-Zilli, L., Lin, Z. Y., and Paterson, B. M. (1989) Mol. Cell. Biol. 9, 3218-3230 [Abstract/Free Full Text]
  50. Muscat, G. E. O., Gustafson, T. A., and Kedes, L. (1988) Mol. Cell. Biol. 8, 4120-4133 [Abstract/Free Full Text]
  51. Lee, T. C., Chow, K. L., Fang, P., and Schwartz, R. J. (1991) Mol. Cell. Biol. 11, 5090-5100 [Abstract/Free Full Text]
  52. Catala, F., Wanner, R., Barton, P., Cohen, A., Wright, W., and Buckingham, M. (1995) Mol. Cell. Biol. 15, 4585-4596 [Abstract]
  53. Gilgenkrantz, H., Hugnot, J. P., Lambert, M., Chafey, P., Kaplan, J. C., and Kahn, A. (1992) J. Biol. Chem. 267, 10823-10830 [Abstract/Free Full Text]
  54. Amacher, S. L., Buskin, J. N., and Hauschka, S. D. (1993) Mol. Cell. Biol. 13, 2753-2764 [Abstract/Free Full Text]
  55. Phan-Dinh-Tuy, F., Tuil, D., Schweighoffer, F., Pinset, C., Kahn, A., and Minty, A. (1988) Eur. J. Biochem. 173, 507-515 [Medline] [Order article via Infotrieve]
  56. Boxer, L. M., Prywes, R., Roeder, R. G., and Kedes, L. (1989) Mol. Cell. Biol. 9, 515-522 [Abstract/Free Full Text]
  57. Vandromme, M., Gauthier-Rouvière, C., Carnac, G., Lamb, N., and Fernandez, A. (1992) J. Cell Biol. 118, 1489-1500 [Abstract/Free Full Text]
  58. Taylor, M. R., Treisman, R., Garett, N., and Mohun, T. (1989) Development (Camb.) 106, 67-78
  59. Walsh, K. (1989) Mol. Cell. Biol. 9, 2191-2201 [Abstract/Free Full Text]
  60. Soulez, M., Tuil, D., Kahn, A., and Phan-Dinh-Tuy, F. (1993) Biochem. Biophys. Res. Commun. 195, 400-408 [CrossRef][Medline] [Order article via Infotrieve]
  61. Kozak, M. (1986) Cell 44, 283-292 [CrossRef][Medline] [Order article via Infotrieve]
  62. Trouche, D., Grigoriev, M., Robin, P., and Harel-Bellan, A. (1993) Biochem. Biophys. Res. Commun. 196, 611-618 [CrossRef][Medline] [Order article via Infotrieve]
  63. Fields, S., and Song, O. (1989) Nature 340, 245-246 [CrossRef][Medline] [Order article via Infotrieve]
  64. Sikorski, R. S., and Hieter, P. (1989) Genetics 122, 19-27 [Abstract/Free Full Text]
  65. Schwarz, J. J., Chakraborty, T., Martin, J., Zhou, J. M., and Olson, E. N. (1992) Mol. Cell. Biol. 12, 266-275 [Abstract/Free Full Text]
  66. Lassar, A. B., Buskin, J. N., Lockshon, D., Davis, R. L., Apone, S., Hauschka, S. D., and Weintraub, H. (1989) Cell 58, 823-831 [CrossRef][Medline] [Order article via Infotrieve]
  67. Dignam, J. D., Lebowitz, R. M., and Roeder, R. G. (1983) Nucleic Acids Res. 11, 1474-1486
  68. Funk, W. D., and Wright, W. E. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 9484-9488 [Abstract/Free Full Text]
  69. Legrain, P., and Chapon, C. (1993) Science 262, 108-110 [Abstract/Free Full Text]
  70. Legrain, P., Chapon, C., and Galisson, F. (1993) Genes & Dev. 7, 1390-1399
  71. Kaelin, W. G., Pallas, D. C., DeCaprio, J. A., Kaye, F., and Livingston, D. M. (1991) Cell 64, 521-532 [CrossRef][Medline] [Order article via Infotrieve]
  72. Sartorelli, V., Webster, K. A., and Kedes, L. (1990) Genes & Dev. 4, 1811-1822
  73. Cserjesi, P., and Olson, E. N. (1991) Mol. Cell. Biol. 11, 4854-4862 [Abstract/Free Full Text]
  74. Gosset, L. A., Kelvin, D. J., Sternberg, E. A., and Olson, E. N. (1989) Mol. Cell. Biol. 9, 5022-5033 [Abstract/Free Full Text]
  75. Lee, T. C., Shi, Y., and Schwartz, R. J. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 9814-9818 [Abstract/Free Full Text]
  76. Tuil, D., Clergue, N., Montarras, D., Pinset, C., Kahn, A., and Phan-Dinh-Tuy, F. (1990) J. Mol. Biol. 213, 677-686 [CrossRef][Medline] [Order article via Infotrieve]
  77. Treisman, R. (1986) Cell 46, 567-574 [CrossRef][Medline] [Order article via Infotrieve]
  78. Dalton, S., and Treisman, R. (1992) Cell 68, 597-612 [CrossRef][Medline] [Order article via Infotrieve]
  79. Kaushal, S., Schneider, J. W., Nadal-Ginard, B., and Mahdavi, V. (1994) Science 266, 1236-1240 [Abstract/Free Full Text]
  80. Natesan, S., and Gilman, M. (1995) Mol. Cell. Biol. 15, 5975-5982 [Abstract]

©1996 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
K. D. Yokoyama, U. Ohler, and G. A. Wray
Measuring spatial preferences at fine-scale resolution identifies known and novel cis-regulatory element candidates and functional motif-pair relationships
Nucleic Acids Res., June 2, 2009; (2009) gkp423v2.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. P. Makarenkova, K. N. Gonzalez, W. B. Kiosses, and R. Meech
Barx2 Controls Myoblast Fusion and Promotes MyoD-mediated Activation of the Smooth Muscle{alpha}-Actin Gene
J. Biol. Chem., May 29, 2009; 284(22): 14866 - 14874.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. M. Meadows, A. S. Warkman, M. C. Salanga, E. M. Small, and P. A. Krieg
The myocardin-related transcription factor, MASTR, cooperates with MyoD to activate skeletal muscle gene expression
PNAS, February 5, 2008; 105(5): 1545 - 1550.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. H. Cheung, K. K. B. Barthel, Y. L. Kwan, and X. Liu
Identifying pattern-defined regulatory islands in mammalian genomes
PNAS, June 12, 2007; 104(24): 10116 - 10121.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. Charvet, C. Houbron, A. Parlakian, J. Giordani, C. Lahoute, A. Bertrand, A. Sotiropoulos, L. Renou, A. Schmitt, J. Melki, et al.
New Role for Serum Response Factor in Postnatal Skeletal Muscle Growth and Regeneration via the Interleukin 4 and Insulin-Like Growth Factor 1 Pathways.
Mol. Cell. Biol., September 1, 2006; 26(17): 6664 - 6674.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. Kawai-Kowase, M. S. Kumar, M. H. Hoofnagle, T. Yoshida, and G. K. Owens
PIAS1 Activates the Expression of Smooth Muscle Cell Differentiation Marker Genes by Interacting with Serum Response Factor and Class I Basic Helix-Loop-Helix Proteins
Mol. Cell. Biol., September 15, 2005; 25(18): 8009 - 8023.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C.-H. Kim, W. C. Xiong, and L. Mei
Inhibition of MuSK Expression by CREB Interacting with a CRE-Like Element and MyoD
Mol. Cell. Biol., July 1, 2005; 25(13): 5329 - 5338.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
A. Blais, M. Tsikitis, D. Acosta-Alvear, R. Sharan, Y. Kluger, and B. D. Dynlacht
An initial blueprint for myogenic differentiation
Genes & Dev., March 1, 2005; 19(5): 553 - 569.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Zhang, G. Azhar, Y. Zhong, and J. Y. Wei
Identification of a Novel Serum Response Factor Cofactor in Cardiac Gene Regulation
J. Biol. Chem., December 31, 2004; 279(53): 55626 - 55632.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
G. K. Owens, M. S. Kumar, and B. R. Wamhoff
Molecular Regulation of Vascular Smooth Muscle Cell Differentiation in Development and Disease
Physiol Rev, July 1, 2004; 84(3): 767 - 801.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
P. A. Stieger, A. D. Meyer, P. Kathmann, C. Frundt, I. Niederhauser, M. Barone, and C. Kuhlemeier
The orf13 T-DNA Gene of Agrobacterium rhizogenes Confers Meristematic Competence to Differentiated Cells
Plant Physiology, July 1, 2004; 135(3): 1798 - 1808.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. S. Kumar, J. A. Hendrix, A. D. Johnson, and G. K. Owens
Smooth Muscle {alpha}-Actin Gene Requires Two E-Boxes for Proper Expression In Vivo and Is a Target of Class I Basic Helix-Loop-Helix Proteins
Circ. Res., May 2, 2003; 92(8): 840 - 847.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. S. Kumar and G. K. Owens
Combinatorial Control of Smooth Muscle-Specific Gene Expression
Arterioscler. Thromb. Vasc. Biol., May 1, 2003; 23(5): 737 - 747.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Meech, H. Makarenkova, D. B. Edelman, and F. S. Jones
The Homeodomain Protein Barx2 Promotes Myogenic Differentiation and Is Regulated by Myogenic Regulatory Factors
J. Biol. Chem., February 28, 2003; 278(10): 8269 - 8278.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Mead, A. R. Bruning, M. K. Gill, A. M. Steiner, T. B. Acton, and A. K. Vershon
Interactions of the Mcm1 MADS Box Protein with Cofactors That Regulate Mating in Yeast
Mol. Cell. Biol., July 1, 2002; 22(13): 4607 - 4621.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Q. Gong and L. Li
Dermo-1, a Multifunctional Basic Helix-Loop-Helix Protein, Represses MyoD Transactivation via the HLH Domain, MEF2 Interaction, and Chromatin Deacetylation
J. Biol. Chem., March 29, 2002; 277(14): 12310 - 12317.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
C. Zeng and A. R. Morrison
Disruption of the actin cytoskeleton regulates cytokine-induced iNOS expression
Am J Physiol Cell Physiol, September 1, 2001; 281(3): C932 - C940.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
L. WEI, L. WANG, J. A. CARSON, J. E. AGAN, K. IMANAKA-YOSHIDA, and R. J. SCHWARTZ
{beta}1 integrin and organized actin filaments facilitate cardiomyocyte-specific RhoA-dependent activation of the skeletal {alpha}-actin promoter
FASEB J, March 1, 2001; 15(3): 785 - 796.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
N. S. Belaguli, J. L. Sepulveda, V. Nigam, F. Charron, M. Nemer, and R. J. Schwartz
Cardiac Tissue Enriched Factors Serum Response Factor and GATA-4 Are Mutual Coregulators
Mol. Cell. Biol., October 15, 2000; 20(20): 7550 - 7558.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
L. Wei, W. Zhou, L. Wang, and R. J. Schwartz
beta 1-Integrin and PI 3-kinase regulate RhoA-dependent activation of skeletal alpha -actin promoter in myoblasts
Am J Physiol Heart Circ Physiol, June 1, 2000; 278(6): H1736 - H1743.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
W. Ding, M. M. Witte, and R. E. Scott
Transformation Blocks Differentiation-induced Inhibition of Serum Response Factor Interactions with Serum Response Elements
Cancer Res., August 1, 1999; 59(15): 3795 - 3802.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
N. S. Belaguli, W. Zhou, T.-H. T. Trinh, M. W. Majesky, and R. J. Schwartz
Dominant Negative Murine Serum Response Factor: Alternative Splicing within the Activation Domain Inhibits Transactivation of Serum Response Factor Binding Targets
Mol. Cell. Biol., July 1, 1999; 19(7): 4582 - 4591.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. A. Spencer, M. L. Major, and R. P. Misra
Basic Fibroblast Growth Factor Activates Serum Response Factor Gene Expression by Multiple Distinct Signaling Mechanisms
Mol. Cell. Biol., June 1, 1999; 19(6): 3977 - 3988.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. A. Spencer, M. H. Baron, and E. N. Olson
Cooperative Transcriptional Activation by Serum Response Factor and the High Mobility Group Protein SSRP1
J. Biol. Chem., May 28, 1999; 274(22): 15686 - 15693.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. Chaudhary and M. K. Skinner
Basic Helix-Loop-Helix Proteins Can Act at the E-Box within the Serum Response Element of the c-fos Promoter to Influence Hormone-Induced Promoter Activation in Sertoli Cells
Mol. Endocrinol., May 1, 1999; 13(5): 774 - 786.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
E. Biesiada, Y. Hamamori, L. Kedes, and V. Sartorelli
Myogenic Basic Helix-Loop-Helix Proteins and Sp1 Interact as Components of a Multiprotein Transcriptional Complex Required for Activity of the Human Cardiac alpha -Actin Promoter
Mol. Cell. Biol., April 1, 1999; 19(4): 2577 - 2584.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Galvagni, E. Cartocci, and S. Oliviero
The Dystrophin Promoter Is Negatively Regulated by YY1 in Undifferentiated Muscle Cells
J. Biol. Chem., December 11, 1998; 273(50): 33708 - 33713.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Wei, W. Zhou, J. D. Croissant, F.-E. Johansen, R. Prywes, A. Balasubramanyam, and R. J. Schwartz
RhoA Signaling via Serum Response Factor Plays an Obligatory Role in Myogenic Differentiation
J. Biol. Chem., November 13, 1998; 273(46): 30287 - 30294.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. Ferreira, L. Magnaghi-Jaulin, P. Robin, A. Harel-Bellan, and D. Trouche
The three members of the pocket proteins family share the ability to repress E2F activity through recruitment of a histone deacetylase
PNAS, September 1, 1998; 95(18): 10493 - 10498.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
G. Carnac, M. Primig, M. Kitzmann, P. Chafey, D. Tuil, N. Lamb, and A. Fernandez
RhoA GTPase and Serum Response Factor Control Selectively the Expression of MyoD without Affecting Myf5 in Mouse Myoblasts
Mol. Biol. Cell, July 1, 1998; 9(7): 1891 - 1902.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
Y. Ling, A. G. West, E. C. Roberts, J. H. Lakey, and A. D. Sharrocks
Interaction of Transcription Factors with Serum Response Factor. IDENTIFICATION OF THE Elk-1 BINDING SURFACE
J. Biol. Chem., April 24, 1998; 273(17): 10506 - 10514.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
H. Takano, I. Komuro, T. Oka, I. Shiojima, Y. Hiroi, T. Mizuno, and Y. Yazaki
The Rho Family G Proteins Play a Critical Role in Muscle Differentiation
Mol. Cell. Biol., March 1, 1998; 18(3): 1580 - 1589.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
K. A. Dooley, S. Millinder, and T. F. Osborne
Sterol Regulation of 3-Hydroxy-3-Methylglutaryl-coenzyme A Synthase Gene through a Direct Interaction Between Sterol Regulatory Element Binding Protein and the Trimeric CCAAT-binding Factor/Nuclear Factor Y
J. Biol. Chem., January 16, 1998; 273(3): 1349 - 1356.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Katoh, J. D. Molkentin, V. Dave, E. N. Olson, and M. Periasamy
MEF2B Is a Component of a Smooth Muscle-specific Complex That Binds an A/T-rich Element Important for Smooth Muscle Myosin Heavy Chain Gene Expression
J. Biol. Chem., January 16, 1998; 273(3): 1511 - 1518.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Ramirez, S. A. S. Ali, P. Robin, D. Trouche, and A. Harel-Bellan
The CREB-binding Protein (CBP) Cooperates with the Serum Response Factor for Transactivation of the c-fos Serum Response Element
J. Biol. Chem., December 5, 1997; 272(49): 31016 - 31021.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. S. Belaguli, L. A. Schildmeyer, and R. J. Schwartz
Organization and Myogenic Restricted Expression of the Murine Serum Response Factor Gene. A ROLE FOR AUTOREGULATION
J. Biol. Chem., July 18, 1997; 272(29): 18222 - 18231.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. A. Spencer and R. P. Misra
Expression of the Serum Response Factor Gene Is Regulated by Serum Response Factor Binding Sites
J. Biol. Chem., July 12, 1996; 271(28): 16535 - 16543.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. P. Mack, A. V. Somlyo, M. Hautmann, A. P. Somlyo, and G. K. Owens
Smooth Muscle Differentiation Marker Gene Expression Is Regulated by RhoA-mediated Actin Polymerization
J. Biol. Chem., January 5, 2001; 276(1): 341 - 347.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. A. Carson, R. A. Fillmore, R. J. Schwartz, and W. E. Zimmer
The Smooth Muscle gamma -Actin Gene Promoter Is a Molecular Target for the Mouse bagpipe Homologue, mNkx3-1, and Serum Response Factor
J. Biol. Chem., December 8, 2000; 275(50): 39061 - 39072.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Gupta, P. Kogut, F. J. Davis, N. S. Belaguli, R. J. Schwartz, and M. P. Gupta
Physical Interaction between the MADS Box of Serum Response Factor and the TEA/ATTS DNA-binding Domain of Transcription Enhancer Factor-1
J. Biol. Chem., March 23, 2001; 276(13): 10413 - 10422.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. S. Chang, L. Li, J. McAnally, and E. N. Olson
Muscle Specificity Encoded by Specific Serum Response Factor-binding Sites
J. Biol. Chem., May 11, 2001; 276(20): 17206 - 17212.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. J. Phiel, V. Gabbeta, L. M. Parsons, D. Rothblat, R. P. Harvey, and K. M. McHugh
Differential Binding of an SRF/NK-2/MEF2 Transcription Factor Complex in Normal Versus Neoplastic Smooth Muscle Tissues
J. Biol. Chem., September 7, 2001; 276(37): 34637 - 34650.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
F. J. Davis, M. Gupta, S. M. Pogwizd, E. Bacha, V. Jeevanandam, and M. P. Gupta
Increased expression of alternatively spliced dominant-negative isoform of SRF in human failing hearts
Am J Physiol Heart Circ Physiol, April 1, 2002; 282(4): H1521 - H1533.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Groisman, R.
Right arrow Articles by Harel-Bellan, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Groisman, R.
Right arrow Articles by Harel-Bellan, A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1996 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement