| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
(Received for publication, September 5, 1996, and in revised form, October 11, 1996)
From the Department of Cell Biology, Faculty of Medicine and
Institute of Biomembranes, Utrecht University, 3584 CX Utrecht, The
Netherlands and the § Departments of Molecular Biology,
Pharmacology, Biochemistry, and Pediatrics, Washington University
School of Medicine, St. Louis, Missouri 63110
ABSTRACT The growth hormone receptor (GHR) is a
ubiquitinated cell surface protein. Ligand binding and receptor
dimerization activate the cytosolic kinase Jak2. This event initiates
signal transduction via STAT proteins. Expression of GHR in a Chinese
hamster ovary (CHO) cell line, which exhibits a temperature-sensitive
defect in ubiquitin conjugation (CHO-ts20), as well as in wild type
cells (CHO-E36) has shown that endocytosis of the receptor requires an
intact ubiquitin conjugation system (Strous G. J., van Kerkhof, P.,
Govers, R., Ciechanover A., and Schwartz, A. L. (1996) EMBO J. 15, 3806-3812). We have now examined the requirement for
ubiquitin conjugation in growth factor-mediated signal transduction. In CHO-E36 and in CHO-ts20 cells at the permissive temperature, STAT proteins were activated in a growth factor-dependent
fashion. However, no activation of STAT proteins was observed at the
nonpermissive temperature in CHO-ts20 cells. Neither tyrosine
phosphorylation of GHR nor of Jak2 was inhibited at the nonpermissive
temperature. When tyrosine phosphorylation was inhibited following
treatment with staurosporin, ubiquitination of the receptor
proceeded normally. Furthermore, mutation of GHR phenylalanine-327,
which prevents GHR endocytosis, inhibited receptor ubiquitination but
allowed normal Jak/STAT-mediated signal transduction. Thus, these data provide evidence that the ubiquitin conjugation system is involved in
the Jak/STAT signaling pathway, be it not at the initial stage(s) of
Jak2 activity.
INTRODUCTION Binding of growth hormone (GH)1 to its
receptor causes dimerization of two growth hormone receptor (GHR)
polypeptides, which in turn initiates a cascade of events leading to
signal transduction in the cell nucleus and down-regulation of the
receptor (1, 2). Lacking intrinsic tyrosine kinase activity, the GHR
recruits and activates a member of the Janus family of cytosolic
kinases (Jak2) upon dimerization (3). In addition to the GHR
polypeptides and itself, Jak2 phosphorylates special signal transducers
and activators of transcription proteins (STATs), which translocate to
the nucleus and convey the appropriate signal to specific regulatory DNA-responsive elements (3, 4, 5, 6, 7, 8).
The ubiquitin system has been established as the major regulatory
protein degradation system within eukaryotic cells (9, 10, 11, 12). Proteins
destined for degradation are covalently modified by conjugation of
multiple ubiquitin polypeptides following recognition and modification
by members of the E2 (ubiquitin conjugating) and E3 (ligating) protein
families. Recently, the ubiquitin conjugation system has been shown to
play a role in other regulatory functions such as control of protein
kinase activity (13) and receptor endocytosis (14, 15). An intact
ubiquitin conjugation system is required for prompt ligand-induced GHR
endocytosis and degradation (15). Many other cell surface receptors are
ubiquitinated upon ligand binding (16, 17, 18, 19, 20), although their dependence
upon ubiquitin conjugation for endocytosis has not been addressed. As
signal transduction and down-regulation of most cell surface signaling
receptors are tightly coupled, we have examined the role of the
ubiquitin conjugation system in GHR signal transduction.
We have utilized GHR-transfected CHO-ts20 cells that express a
thermolabile ubiquitin activating enzyme, E1 (21). At the nonpermissive
temperature ligand-induced endocytosis of the GHR is blocked in these
cells (15). Herein, we report that although GH-induced tyrosine
phosphorylation of GHR and Jak2 at the cell surface is not affected at
the nonpermissive temperature, the Jak2/STAT signaling pathway is
completely inhibited.
MATERIALS AND METHODS Cell lines derived from CHO-ts20 and
CHO-E36 cells, stably transfected with rabbit GHR-cDNA, were used (15).
The GHR-F327A mutant was prepared by inserting a polymerase chain
reaction product using a 5 The
cells were lysed on ice in 0.3 ml of lysis mix containing 1% Triton
X-100, 2 mM Na3VO4, 1 mM EDTA, 10 µg/ml aprotinin, 10 µg/ml leupeptin, and 1 mM phenylmethylsulfonyl fluoride in PBS. In ubiquitin
blotting experiments the cells were lysed in 0.3 ml of boiling lysis
buffer containing 1% SDS in PBS in order to minimize isopeptidase
activity. The lysate was heated at 100 °C for 5 min, sheared to
break DNA, and centrifuged for 5 min at 10,000 × g.
Immunoprecipitations were carried out in 1% Triton X-100, 0.5% SDS,
0.25% sodium deoxycholate, 0.5% bovine serum albumin, 1 mM EDTA, 2 mM Na3VO4,
10 µg/ml leupeptin, 10 µg/ml aprotinin, and 1 mM
phenylmethylsulfonyl fluoride in PBS. The reactions were incubated for
2 h at 0 °C with 5 µl of specific rabbit anti-GHR antiserum;
protein A-agarose (Repligen Co., Cambridge, MA) was used to isolate the
immune complexes. The immunoprecipitates were washed twice with the
same buffer and once with 10-fold diluted PBS; immune complexes were
analyzed by 7.5% polyacrylamide gel electrophoresis in the presence of
SDS.
After transfer to polyvinylidene difluoride paper, the blots were
immunostained using anti-ubiquitin conjugate antibody, anti-GHR (after
stripping of the blots), and anti-PY (15). The antigens were visualized
using the ECL system (Amersham Corp.).
Either total cell
lysates or nuclear extracts from 2 × 108 cells were
incubated with a 32P-labeled oligonucleotide known as the
c-sis-inducible element (SIE) of the c-fos gene
promoter as described (22, 23). To prepare radiolabeled SIE two
oligonucleotides were synthesized (5 RESULTS In order to determine whether the ubiquitin conjugation system is
involved in signal transduction of the GHR, CHO-ts20, and CHO-E36 cells
stably transfected with GHR were incubated at the permissive (30 °C)
and nonpermissive (42 °C) temperatures, and the cell and nuclear
extracts were examined for GH-inducible band shifts using
32P-labeled SIE. As seen in Fig.
1A, GH induced a clear signal in CHO-E36
cells at both the permissive and nonpermissive temperatures and in
CHO-ts20 cells incubated at the permissive temperature. Closer
examination of the band pattern (Fig. 1B) reveals that the
specific signal is composed of three bands (a, b,
and c). If excess unlabeled SIE was added, all three bands
disappeared (Fig. 1B, lanes 2 and 3);
if antibodies against STAT1 were present the two lower bands
disappeared and a new more slowly migrating complex became visible;
anti-STAT3 had no effect, probably because our antibody did not
interfere with STAT complex formation in CHO cells. These observations
together with data from literature indicate that the three-band pattern
represents homo- and heterodimers of STAT1 and STAT3 (5). In nuclear
extracts from CHO-E36 cells the lower band (Fig. 1B,
c) was lacking (Fig. 1A).
If CHO-ts20 cells were incubated at the nonpermissive temperature in
the presence of GH, no STAT complexes were detectable. This observation
was consistently made over a temperature range of 40-42 °C, and the
STAT complex formation coincided fully with the capacity of the
CHO-ts20 cells to activate ubiquitin. The weak signal at lower
electrophoretic mobility in this lane did not disappear if the
incubation was carried out in the presence of excess unlabeled probe.
If CHO-ts20 cells were used transfected with a mutant DNA (GHR-F327A),
the same results were obtained as with wild type GHR. No STAT complex
was observed in these cells following incubation at the nonpermissive
temperature in the presence of GH (Fig. 1C). Together, the
data show that an intact ubiquitin conjugation system is necessary for
GH-mediated Jak/STAT signaling.
The F327A mutation in the GHR was previously shown to affect
ligand-induced endocytosis, not signal transduction (24). As seen in
Fig. 1C, CHO-ts20 cells transfected with GHR-F327A DNA show
normal signaling via STAT pathway upon GH addition at the permissive
temperature. The mutated GHR in these cells is not ubiquitinated upon
GH addition at the permissive temperature.2
Thus, although endocytosis and ubiquitination of the GHR were inhibited
in the GHR-F327A mutant, Jak/STAT signal transduction occurred
normally. This result also shows that ubiquitination of the receptor
tail is not required for signal transduction.
Following dimerization of the GHR polypeptides, tyrosine
phosphorylation of both GHR and Jak2 is the initial event in the signaling cascade. Therefore, we examined whether an intact ubiquitin conjugation system is essential for this event. In all cases a substantial phosphotyrosine signal was observed on both the mature GHR
and Jak2 upon the addition of GH. In the case of Jak2 (Fig. 2, right panel) an extra diffuse and slower
migrating PY-labeled band is visible, most probably originating from
co-immunoprecipitation of GHR. A somewhat diminished PY signal was
observed in both GHR and Jak2 in CHO-ts20 and in CHO-E36 cells
following incubation at temperatures above 40 °C. Occasionally the
decrease in signal was more prominent in the CHO-ts20 than in CHO-E36
cells. This variability is likely due to
temperature-dependent activity of Jak2. Thus, it is
unlikely that the ubiquitin conjugating system is required for Jak2
recruitment nor for its action. We also examined the extent to which
the GHR-F327A mutant was phosphorylated in response to ligand. Both
receptor and Jak2 phosphorylation were similar to that observed with
the wild type receptor (not shown).
Because both GHR tyrosine phosphorylation and ubiquitination appear to
occur at the cell surface, it is important to determine whether the two
events are independent. Thus, to eliminate indirect effects of
phosphorylation on receptor ubiquitination, we utilized the
phosphokinase inhibitor staurosporin. As seen in Fig.
3, staurosporin inhibited the ligand-induced GHR
phosphorylation almost completely. However, the GH stimulation of GHR
ubiquitination was unaffected. Of note is that no PY signal is visible
at the position of ubiquitinated GHR (Fig. 3, middle panel),
indicating that ubiquitinated GHR is not phosphorylated. Taken together
with the results described above, we conclude that ubiquitin
conjugation and tyrosine phosphorylation of the GHR (and Jak2) are
independent events.
DISCUSSION The ubiquitin conjugating system plays a pivotal role in a diverse
array of regulatory events including cell cycle progression, DNA
repair, and transcriptional control. Many of these processes are
dependent upon both ubiquitin conjugation to target proteins as well as
the subsequent degradation of the protein-ubiquitin moieties via the
proteasome. In the present study we demonstrate that the ubiquitin
conjugating system is involved in signal transduction via the Jak/STAT
pathway. This pathway mediates transduction of a wide variety of
extracellular signals via receptors for interferon, many cytokines, and
GH (3, 4, 5, 7, 8, 25). Using cells that display an intact GH-GHR pathway
yet contain a temperature-sensitive mutation in the initial enzyme of
the ubiquitin conjugation pathway, we have demonstrated that
inactivation of the ubiquitin pathway inhibits GH-induced stimulation
the Jak/STAT pathway. Our data do not define at which stage(s)
ubiquitin conjugation is involved in the signaling cascade, although
the data render it unlikely that the initial steps that likely occur at
the cell surface (receptor dimerization, Jak2 recruitment, and Jak2
activation) are affected by the ubiquitin system. Previously, we have
shown that the ubiquitin system is involved in receptor endocytosis
(15). These results together with the current data suggest that the
cell surface is the likely site of GHR signaling. Dependent upon the GH
concentration, temperature, and cell type, ligand-induced endocytosis
of the GHR occurs with a half-time of 30-60 min (26, 27, 28). Tyrosine phosphorylation, however, occurs maximally within 15-20 min (Ref. 29
and Fig. 2). Because no phosphotyrosine-labeled GHR was found to be
ubiquitinated and because the two events appear to be independent, it
is tempting to speculate that phosphorylation and subsequently Jak/STAT
transduction occur first, following which the receptor is subject to
endocytosis mediated by the ubiquitin conjugation system.
As proposed for the role of ubiquitination in ligand-induced
endocytosis of the GHR, ubiquitination in addition to protein phosphorylation may act as a control point in regulating some step(s)
in the Jak/STAT signaling cascade. However, because many basic cellular
processes are regulated subsequent to ubiquitin conjugation, use of the
E1 mutant cell line at the nonpermissive temperature does not exclude
the possibility that other E1-dependent events are critical
in the control of this signaling pathway.
Recently, Allevato and colleagues (24) have reported that phenylalanine
346 within the rat GHR cytoplasmic tail is critical for ligand-induced
internalization but not essential for transcriptional control. We have
made the analogous mutation in the rabbit receptor, which results in
defective endocytosis as well as ubiquitination.2 These
results further support the notion that the ubiquitin conjugating system acts on the signaling pathway downstream from the tyrosine phosphorylating action of Jak2. Recently, Chen et al. (13)
have shown that the protein kinase involved in the activation of the transcription factor NF FOOTNOTES Acknowledgments We thank Dennis Lebbing for excellent
technical assistance, Rachel Leckie for preparing the GHR-F327A DNA
construct, Dr. Willem Stoorvogel for helpful discussions, Dr. Aaron
Ciechanover for providing the anti-ubiquitin conjugate antiserum, and
Dr. William Wood for the GHR cDNA.
REFERENCES
Volume 272, Number 1,
Issue of January 3, 1997
pp. 40-43
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
COMMUNICATION:
,
-oligonucleotide, containing a Pfl1 site
(GATCCCACCCATTGGCCTCAACTGGACTTT) and a 3-oligonucleotide containing a
ClaI site and a TTC 
GCC mutation (F A)
(GATCCATCGATGTCTAGCTCGATGGCTTCA). The DNA sequence was confirmed for
the entire polymerase chain reaction fragment. Cells were grown in
Eagle's minimal essential medium supplemented with 4.5 g/liter
glucose, 10% fetal bovine serum, penicillin, and streptomycin, and 0.4 mg/ml geneticin. For experiments the cells were grown on 35-mm plates
and used at 75% confluence. The CHO-ts20 clone used in this study
expressed approximately 10-fold more receptor than the CHO-E36 clone.
To compensate for this, 10 mM sodium butyrate was added to
CHO-E36 cells 18 h before use, increasing GHR expression
approximately 5-fold (15). As before, the sodium butyrate treatment did
not alter the behavior of GHR in any of the parameters examined in this
study. Anti-GHR antiserum was raised in rabbits against a fusion
protein of glutathione S-transferase and a GHR tail peptide
consisting of amino acids 327-493 (15). The fusion protein was
expressed in Escherichia coli after transformation with the
appropriate pGEX-2T DNA construct (Pharmacia Biotech Inc.). Anti-PY and
rabbit anti-mouse STAT3 were from Upstate Biotechnology, Inc. (Lake
Placid, NY), and anti-ISGF3 (monoclonal antibody against the N-terminal
194 amino acid sequence of STAT1) from Transduction Labs (Lexington,
KY). Antiserum against Jak2 was raised in rabbits against a synthetic
peptide corresponding to the hinge region between domains 1 and 2 of
murine Jak2. Antiserum specific for ubiquitin-protein conjugates was a
gift of Dr. A. Ciechanover (Technion-Israel Institute of Technology,
Haifa, Israel). GH was a gift of Lilly Research Labs (Indianapolis,
IN).
-GTCGACATTTCCCGTAAATCGTCGA-3 and
5-TCGACGATTTACGG-3) and hybridized, and the gap was filled using the
Klenow reaction in the presence of [
-32P]ATP and
unlabeled dCTP, dGTP, and dTTP. Transcription factor complex formation
and electrophoresis were performed as described (22).
Fig. 1.
Protein complex formation with
32P-labeled DNA SIE element. The binding of nuclear
(A) and whole cell extracts (C) was performed as
described under "Materials and Methods." Cells were cultured in
serum-free medium overnight, and the incubation was continued at the
temperatures indicated in Eagle's minimal essential medium
supplemented with 20 mM Hepes, pH 7.2, for 60 min, followed by a 15-min incubation in the presence or the absence of 8 nM GH. Cellular or nuclear extracts were analyzed in the
transcription factor complexation assay, and the label patterns were
visualized by a PhosphorImager (Molecular Dynamics). A and
C represent different experiments. In B, the
specificity of the reaction was determined using the same extract as in
the second lane of A (CHO-ts20, incubated at
30 °C for 15 min in the presence of GH); additions to the complex formation: lane 1, none; lane 2, 100 times excess
unlabeled probe; lane 3, 10 times excess unlabeled probe;
lane 4, 0.5 µg of anti-STAT3; lane 5, 0.12 µg
of anti-ISGF3. Due to relatively high protein concentrations in the
total cell lysates (C), the specific complexes (arrowhead) migrate as diffuse bands as compared with the
nuclear extracts (A). The lower intense band in all lanes of
C are nonspecific, because they do not disappear in the
presence of excess unlabeled probe.
[View Larger Version of this Image (55K GIF file)]
Fig. 2.
Tyrosine phosphorylation of GHR and Jak2 at
permissive and nonpermissive temperature. Effect of temperature.
CHO-ts20 or CHO-E36 cells expressing GHR were cultured in serum-free
medium overnight. Cells were then incubated for 60 min at the indicated temperature, followed by 20 min in the absence or the presence of 8 nM GH. Half of the cell extracts were used for
immunoprecipitation using anti-GHR (left panel), and the
other half were used for immunoprecipitation using anti-Jak2
(right panel); both blots were probed with anti-PY antiserum
as described under "Materials and Methods." Reprobing of the
left panel with anti-GHR and of the right panel
with anti-Jak2 showed equal intensities of both antigens in each lane
(not shown).
[View Larger Version of this Image (49K GIF file)]
Fig. 3.
Tyrosine phosphorylation of GHR/Jak2 is not
required for GH-induced receptor ubiquitination. After overnight
serum-free incubation, CHO-ts20 cells expressing GHR were kept at
30 °C, preincubated with or without 1 µM staurosporin
for 15 min, incubated in the absence or the presence of 8 nM GH for 20 min, and then lysed in hot lysis buffer as
described under "Materials and Methods." After immunoprecipitation
half of the samples were used for the anti-ubiquitin blot, and the
other half were used for the anti-PY blot. Reprobing of the PY-blot
with anti-GHR showed equal intensity bands for GHR (left
panel).
[View Larger Version of this Image (41K GIF file)]
B depends on the presence and function of
several factors of the ubiquitin conjugation system. Thus, the
ubiquitin system appears to be involved in a variety of growth control
and signal transduction pathways. Future studies will focus on the
mechanism(s) involved in modulation of the Jak/STAT pathway by the
ubiquitin system.
To whom correspondence should be addressed: Dept. of Cell Biology,
Faculty of Medicine, Inst. of Biomembranes, Utrecht University, Heidelberglaan 100, AZU-H02.314, 3584 CX Utrecht, The Netherlands. Tel.: 31-30-2506476; Fax: 31-30-2541797; E-mail:
strous{at}med.ruu.nl.
1
The abbreviations used are: GH, growth hormone;
GHR, growth hormone receptor; CHO, Chinese hamster ovary; PBS,
phosphate-buffered saline; PY, phosphotyrosine; SIE,
c-sis-inducible element.
2
R. Govers and G. J. Strous, unpublished
observation.
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  X. Zhang, J. Zhou, A. F. Fernandes, J. R. Sparrow, P. Pereira, A. Taylor, and F. Shang The Proteasome: A Target of Oxidative Damage in Cultured Human Retina Pigment Epithelial Cells Invest. Ophthalmol. Vis. Sci., August 1, 2008; 49(8): 3622 - 3630. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Kenth, J. A M. Mergelas, and C. G. Goodyer Developmental changes in the human GH receptor and its signal transduction pathways J. Endocrinol., July 1, 2008; 198(1): 71 - 82. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Pilecka, C. Patrignani, R. Pescini, M.-L. Curchod, D. Perrin, Y. Xue, J. Yasenchak, A. Clark, M. C. Magnone, P. Zaratin, et al. Protein-tyrosine Phosphatase H1 Controls Growth Hormone Receptor Signaling and Systemic Growth J. Biol. Chem., November 30, 2007; 282(48): 35405 - 35415. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. P. Comellas, L. A. Dada, E. Lecuona, L. M. Pesce, N. S. Chandel, N. Quesada, G. R. S. Budinger, G. J. Strous, A. Ciechanover, and J. I. Sznajder Hypoxia-Mediated Degradation of Na,K-ATPase via Mitochondrial Reactive Oxygen Species and the Ubiquitin-Conjugating System Circ. Res., May 26, 2006; 98(10): 1314 - 1322. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Staub and D. Rotin Role of Ubiquitylation in Cellular Membrane Transport Physiol Rev, April 1, 2006; 86(2): 669 - 707. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Pasquali, M.-L. Curchod, S. Walchli, X. Espanel, M. Guerrier, F. Arigoni, G. Strous, and R. H. van Huijsduijnen Identification of Protein Tyrosine Phosphatases with Specificity for the Ligand-Activated Growth Hormone Receptor Mol. Endocrinol., November 1, 2003; 17(11): 2228 - 2239. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. B. Cook, C.-C. Zhu, and P. M. Hinkle Thyrotropin-Releasing Hormone Receptor Processing: Role of Ubiquitination and Proteasomal Degradation Mol. Endocrinol., September 1, 2003; 17(9): 1777 - 1791. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Duan, Y. Miura, M. Dimri, B. Majumder, I. L. Dodge, A. L. Reddi, A. Ghosh, N. Fernandes, P. Zhou, K. Mullane-Robinson, et al. Cbl-mediated Ubiquitinylation Is Required for Lysosomal Sorting of Epidermal Growth Factor Receptor but Is Dispensable for Endocytosis J. Biol. Chem., August 1, 2003; 278(31): 28950 - 28960. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Gent, M. van den Eijnden, P. van Kerkhof, and G. J. Strous Dimerization and Signal Transduction of the Growth Hormone Receptor Mol. Endocrinol., May 1, 2003; 17(5): 967 - 975. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Du, G. P. Frick, L.-R. Tai, A. Yoshimura, and H. M. Goodman Interaction of the Growth Hormone Receptor with Cytokine-Induced Src Homology Domain 2 Protein in Rat Adipocytes Endocrinology, March 1, 2003; 144(3): 868 - 876. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. J. Kopchick, C. Parkinson, E. C. Stevens, and P. J. Trainer Growth Hormone Receptor Antagonists: Discovery, Development, and Use in Patients with Acromegaly Endocr. Rev., October 1, 2002; 23(5): 623 - 646. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Q. Gao, A. Kumar, L. Singh, J. M. Huibregtse, S. Beaudenon, S. Srinivasan, D. E. Wazer, H. Band, and V. Band Human Papillomavirus E6-induced Degradation of E6TP1 Is Mediated by E6AP Ubiquitin Ligase Cancer Res., June 1, 2002; 62(11): 3315 - 3321. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. van Kerkhof, M. Smeets, and G. J. Strous The Ubiquitin-Proteasome Pathway Regulates the Availability of the GH Receptor Endocrinology, April 1, 2002; 143(4): 1243 - 1252. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Buttner, S. Sadtler, A. Leyendecker, B. Laube, N. Griffon, H. Betz, and G. Schmalzing Ubiquitination Precedes Internalization and Proteolytic Cleavage of Plasma Membrane-bound Glycine Receptors J. Biol. Chem., November 9, 2001; 276(46): 42978 - 42985. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K.-H. Baek, M. A. Mondoux, R. Jaster, E. Fire-Levin, and A. D. D'Andrea DUB-2A, a new member of the DUB subfamily of hematopoietic deubiquitinating enzymes Blood, August 1, 2001; 98(3): 636 - 642. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-M. Galan, A. Wiederkehr, J. H. Seol, R. Haguenauer-Tsapis, R. J. Deshaies, H. Riezman, and M. Peter Skp1p and the F-Box Protein Rcy1p Form a Non-SCF Complex Involved in Recycling of the SNARE Snc1p in Yeast Mol. Cell. Biol., May 1, 2001; 21(9): 3105 - 3117. [Abstract] [Full Text]
|
|
|
|
 |
|
 C. Pitcher, S. Höning, A. Fingerhut, K. Bowers, and M. Marsh Cluster of Differentiation Antigen 4 () Endocytosis and Adaptor Complex Binding Require Activation of the Endocytosis Signal by Serine Phosphorylation Mol. Biol. Cell, March 1, 1999; 10(3): 677 - 691. [Abstract] [Full Text]
|
|
|
|
|
|
C. A. Gebert, S.-H. Park, and D. J. Waxman Down-Regulation of Liver JAK2-STAT5b Signaling by the Female Plasma Pattern of Continuous Growth Hormone Stimulation Mol. Endocrinol., February 1, 1999; 13(2): 213 - 227. [Abstract] [Full Text]
|
|
|
|
|
|
C. A. Gebert, S.-H. Park, and D. J. Waxman Termination of Growth Hormone Pulse-Induced STAT5b Signaling Mol. Endocrinol., January 1, 1999; 13(1): 38 - 56. [Abstract] [Full Text]
|
|
|
|
|
|
T. Kamitani, K. Kito, H. P. Nguyen, T. Fukuda-Kamitani, and E. T. H. Yeh Characterization of a Second Member of the Sentrin Family of Ubiquitin-like Proteins J. Biol. Chem., May 1, 1998; 273(18): 11349 - 11353. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. A. Callus and B. Mathey-Prevot Interleukin-3-Induced Activation of the JAK/STAT Pathway Is Prolonged by Proteasome Inhibitors Blood, May 1, 1998; 91(9): 3182 - 3192. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. M. A. dos Santos, P. van Kerkhof, and G. J. Strous The Signal Transduction of the Growth Hormone Receptor Is Regulated by the Ubiquitin/Proteasome System and Continues After Endocytosis J. Biol. Chem., March 30, 2001; 276(14): 10839 - 10846. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. van Kerkhof, M. Sachse, J. Klumperman, and G. J. Strous Growth Hormone Receptor Ubiquitination Coincides with Recruitment to Clathrin-coated Membrane Domains J. Biol. Chem., February 2, 2001; 276(6): 3778 - 3784. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. H. Keller, J. Lindstrom, M. Ellisman, and P. Taylor Adjacent Basic Amino Acid Residues Recognized by the COP I Complex and Ubiquitination Govern Endoplasmic Reticulum to Cell Surface Trafficking of the Nicotinic Acetylcholine Receptor alpha -Subunit J. Biol. Chem., May 18, 2001; 276(21): 18384 - 18391. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. M. Alves dos Santos, T. ten Broeke, and G. J. Strous Growth Hormone Receptor Ubiquitination, Endocytosis, and Degradation Are Independent of Signal Transduction via Janus Kinase 2 J. Biol. Chem., August 24, 2001; 276(35): 32635 - 32641. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Verdier, P. Walrafen, N. Hubert, S. Chretien, S. Gisselbrecht, C. Lacombe, and P. Mayeux Proteasomes Regulate the Duration of Erythropoietin Receptor Activation by Controlling Down-regulation of Cell Surface Receptors J. Biol. Chem., June 9, 2000; 275(24): 18375 - 18381. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
ABSTRACT