![]()
|
|
||||||||
2,6-Sialyltransferase Forms with a
Single Amino Acid Change in the Catalytic Domain Differ in Their
Catalytic Activity and Proteolytic Processing*
(Received for publication, September 23, 1996, and in revised form, October 29, 1996)

From the University of Illinois College of Medicine, Chicago, Illinois 60612
The
2,6-sialyltransferase (ST) is a Golgi
glycosyltransferase that adds sialic acid residues to glycoprotein
N-linked oligosaccharides. Here we show that two forms of
2,6-sialyltransferase are expressed by the liver and are encoded by
two different RNAs that differ by a single nucleotide. The ST tyr
possesses a Tyr at amino acid 123, whereas the ST cys possesses a Cys
at this position. The ST tyr is more catalytically active than the ST
cys; however, both are functional when introduced into tissue culture
cells. The proteolytic processing and turnover of the ST tyr and ST cys proteins differ dramatically. The ST cys is retained intact in COS-1
cells, whereas the ST tyr is rapidly cleaved and secreted. Analysis of
the N-linked oligosaccharides of these proteins
demonstrates that both proteins enter the late Golgi. However,
differences in ST tyr and ST cys proteolytic processing may be related
to differences in their localization, because ST tyr but not ST cys is
expressed at low levels on the cell surface. The possibility that the
ST tyr is cleaved in a post-Golgi compartment is supported by the
observation that a 20 °C temperature block, which stops protein
transport in the trans Golgi network, blocks both cleavage and
secretion of the ST tyr.
It is now more widely appreciated that oligosaccharide structures of glycoproteins and glycolipids play pivotal roles in a number of biological processes (reviewed in Ref. 1). Sialylated terminal oligosaccharide structures are receptors for bacterial toxins, parasites, and viruses. In addition, these structures both mediate and modulate cell-cell and cell-matrix interactions (2, 3, 4). For example, sialylated and fucosylated terminal polylactosamine structures interact with selectin proteins to mediate a series of cell-cell interactions including those involved in inflammation and lymphocyte homing (4). In addition, increases in sialylation and branching of oligosaccharide structures expressed by cancer cells has been correlated with increases in the metastatic capacity of these cells (5, 6). Finally, the presence of terminal sialic acid residues on the oligosaccharides of circulating glycoproteins prevents their rapid uptake by the hepatic asialoglycoprotein receptor and their ultimate degradation in lysosomes (7).
The increasing importance of sialylated oligosaccharide structures in a variety of biological events in the normal cell and during development and disease has led to an increased interest in how the process of glycoprotein sialylation is controlled. Generally, it is accepted that the expression of specific glycosyltransferases in a particular cell will determine the types of oligosaccharide structures made by that cell (8, 9, 10, 11, 12). However, in some circumstances the presence or the absence of a particular glycosyltransferase cannot explain the types of oligosaccharide structures expressed by a cell (13, 14). In these cases, other mechanisms of control must be evoked. One likely mechanism of controlling glycosyltransferase activity is to ensure the specific compartmentation of these enzymes with their appropriate sugar nucleotide donors and glycoconjugate acceptors in the cisternae of the Golgi. Recently, we have described another mechanism that may control ST1 activity. We found a ST disulfide-bonded dimer that comprises one-third of the total enzyme in liver Golgi membranes (15). This ST dimer possesses little to no catalytic activity due to a weak affinity for its sugar nucleotide donor, CMP-NeuAc; however, it retains the ability to bind galactose-terminated asialoglycoprotein substrates. We predict that it may be acting as a galactose-specific lectin in the late Golgi, where it prevents the premature secretion of unsialylated glycoproteins and consequently increases the efficiency of terminal sialylation.
In this work we describe a third mechanism that could control the sialylation of glycoproteins by different cell types. We have identified two forms of the ST, which differ in catalytic activity, proteolytic processing, and turnover. The high activity ST tyr form has a Tyr residue at amino acid 123 in the catalytic domain, whereas the low activity ST cys form has a Cys residue at this position. Only the ST tyr form is encoded by genomic DNA, whereas both forms are encoded by liver RNA. In addition, although the ST cys form is retained in the Golgi for long periods of time, the ST tyr form is cleaved and secreted from a variety of cell types with half-times of 3-6 h. Initial experiments suggest that ST tyr cleavage is occurring in a post-Golgi compartment and that the difference in proteolytic processing and secretion of the ST tyr and ST cys may be related to differences in the localization of these two proteins.
Materials
Tissue culture media and reagents, including minimal essential
medium, Dulbecco's modified Eagle's medium (DMEM), Lipofectin, Lipofectamine, and Geneticin (G418) and the SuperScriptTM II
preamplification system were purchased from Life Technologies, Inc.
Fetal bovine serum was obtained from Atlanta Biologicals (Norcross,
GA). Male Sprague-Dawley rats were obtained from Harlan (Indianapolis,
IN). Sequenase enzyme was obtained from U. S. Biochemical Corp.
(Cleveland, OH). RNAzoleTMand DNA STAT-60 were purchased from TelTest,
Inc. (Friendswood, TX). QIAquick PCR Purification Kit was purchased from Qiagen Inc. (Chatsworth, CA). Vent DNA polymerase was purchased from New England Biolabs (Beverly, MA). Fluorescein isothiocyanate (FITC)-conjugated goat anti-rabbit IgG, all immobilized lectins (concanavalin A, wheat germ agglutinin, Erythina cristagalli
agglutinin, Limulus polyphemus agglutinin (LPA), and
Limax flavus agglutinin) were purchased from EY Laboratories
(San Mateo, CA). FITC-conjugated Sambucas nigra agglutinin
(SNA) lectin was purchased from Vector Laboratories (Burlingame, CA).
Protein A-Sepharose Fast Flow was purchased from Pharmacia Biotech,
Inc. Protein molecular weight standards were purchased from Bio-Rad.
Endo-
-acetylglucosaminidase H (Endo H) was purchased from Boehringer
Mannheim. 35S-Express Protein Labeling Mix and
CMP-[14C]NeuAc were purchased from DuPont NEN.
35S-dATP for DNA sequencing was purchased from Amersham
Corp. Oligonucleotides were purchased from Genosys Biotechnologies,
Inc. (The Woodlands, TX) and Life Technologies, Inc. Iodoacetamide,
-mercaptoethanol, asialofetuin, and all other chemicals were
purchased from Sigma.
Methods
Genomic DNA and RNA Isolation, PCR Amplification, and Nucleic Acid SequencingGenomic DNA and tissue RNA isolations were performed using RNAzolTM and STAT-60 according to the protocols provided by Tel-Test Inc. Reverse transcription-PCR was performed essentially according to the protocol provided in the SuperScriptTM II preamplification system (Life Technologies, Inc.). The oligonucleotides used for amplification of reverse transcribed RNA were 94 sense (TATGAGGCCCTTACACTG) and 943A antisense (GCCGGAGGATGGGGGATTTGG). The oligonucleotides used for genomic DNA amplification were 94 sense (TATGAGGCCCTTACACTG) and 573A (GAATCTCTCGACCAAFCTGGGAGTT). An aliquot of each genomic PCR and reverse transcription-PCR product was analyzed by agarose gel electrophoresis. The rest of the reverse transcription-PCR products were incubated at 37 °C in the presence of RNase A for 3 h and purified by using QIAquick PCR Purification Kit (Qiagen) to remove oligonucleotide primers prior to sequencing. DNA sequencing was performed using the Sequenase, version 2.0 DNA Sequencing Kit (U. S. Biochemical Corp.) and sequencing primer 315 (CTGCTGAAGATCTGGAGAACC).
Transfections and Generation of Stably Expressing Cell LinesCOS-1 and Chinese hamster ovary (CHO) cells maintained in DMEM, 10% fetal bovine serum (COS-1), or minimal essential medium, 10% fetal bovine serum (CHO) were plated on 100-mm tissue culture dishes and grown in a 37 °C, 5% CO2 incubator until 50-70% confluent. Lipofectin or Lipofectamine transfections were performed according to protocols provided by Life Technologies, Inc. using 30 µl of Lipofectin or Lipofectamine and 20 µg of DNA in 3 ml of Opti-MEM/100-mm tissue culture plate or 2 µl of Lipofectin or Lipofectamine and 500 ng of DNA in 250 µl of Opti-MEM/coverslip. For stably expressing cell lines, ST tyr and ST cys cDNA subcloned into the pcDNA3neo expression vector were transfected into CHO cells using Lipofectamine (Life Technologies). Following 48 h of expression, CHO cells were split 1:15 into minimal essential medium, 10% fetal bovine serum containing 1 mg/ml Geneticin (G418, Life Technologies). Surviving cell colonies were maintained in the same selection medium and pooled prior to lectin staining.
Sialyltransferase AssaysSialyltransferase assays were
performed as described previously (15, 16).
CMP-[14C]NeuAc was used as a donor substrate and
asialo-
1 acid glycoprotein or asialofetuin as the acceptor
substrate. Free CMP-[14C]NeuAc was separated from
[14C]NeuAc-labeled glycoprotein substrate by G-50 gel
filtration. Picomoles of NeuAc transferred per h/ml of membrane
preparation were calculated based on a specific activity of 7200 cpm/nmol CMP-[14C]NeuAc.
COS-1 and CHO cells were plated onto glass coverslips
and transfected with ST tyr or ST cys cDNAs subcloned into either
the pSVL (Pharmacia) or pcDNA3neo (Invitrogen) expression vectors and processed for immunofluorescence microscopy, as described previously (17, 18). In each experiment we used either a
20 °C methanol fixation/permeabilization for internal staining or a 3%
paraformaldehyde fixation step for cell surface staining. Affinity purified anti-ST antibody and FITC-conjugated goat anti-rabbit IgG
antibody were diluted 1:100 in 5% goat serum, phosphate-buffered saline blocking buffer prior to use. The affinity purified anti-ST antibody was generated as described previously (15). For SNA staining,
cells were blocked as described above and incubated with a 1:100
dilution of FITC-conjugated SNA in Tris-buffered saline, 10 mM CaCl2 for 1 h at room temperature
followed by four Tris-buffered saline, 10 mM
CaCl2 washes. Cells were visualized and photographed using
a Nikon Axiophot microscope equipped with epifluorescence illumination
and a 60× oil emersion Plan Apochromat objective.
Pulse-chase analysis and immunoprecipitation were
performed as described previously (18). ST proteins were
immunoprecipitated from both cell lysates and medium using the anti-ST
antibody and protein A-Sepharose, and immunoprecipitated proteins were
analyzed by SDS-polyacrylamide gel electrophoresis and fluorography
(18). Bio-Rad prestained broad range gel standards were used to
estimate molecular mass: myosin, 203 kDa;
-galactosidase, 118 kDa;
bovine serum albumin, 86 kDa; ovalbumin, 50.3-51.6 kDa; carbonic
anhydrase, 33.3-34.1 kDa; soybean trypsin inhibitor, 29 kDa; lysozyme,
19.2 kDa; and aprotinin, 7.5 kDa.
-acetylglucosaminidase H Digestions
Endo H digestions were performed, and Endo H-digested samples and untreated controls were analyzed by SDS-polyacrylamide gel electrophoresis and fluorography as described previously (16, 17).
Lectin Affinity ChromatographyMetabolically labeled ST
proteins were immunoprecipitated as described above and analyzed by
lectin chromatography according to the method of Low et al.
(19). Immunoprecipitated proteins were eluted from protein A-Sepharose
beads by boiling 5 min in 100 µl of 10 mM Tris-HCl, pH
7.5, 0.1% SDS followed by dilution in 1 ml of lectin binding buffer
(40 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.5%
Triton X-100, 1 mM CaCl2, 1 mM
MgCl2, and 1 mM MnCl2). 100 µl of
a 50% slurry of lectin-conjugated agarose was incubated with above
diluted immunoprecipitates for 2 h at room temperature. The
agarose beads were washed three times with buffer A (25 mM Tris-HCl, pH 7.8, 500 mM NaCl, 0.5% Triton X-100, and 1 mM phenylmethylsulfonyl fluoride) and three times with
buffer B (10 mM Tris-HCl, pH 7.8, and 150 mM
NaCl). After washing, the bound material was eluted by boiling in 100 µl of SDS sample buffer (10% glycerol, 65 mM Tris, pH
6.8, 2% SDS, 0.15% bromphenol blue, 10%
-mercaptoethanol) and
analyzed by SDS-polyacrylamide gel electrophoresis and
fluorography.
Weinstein et
al. (20) originally cloned two forms of the rat liver ST that
differed in a single nucleotide and thus a single amino acid in the
catalytic domain. The ST tyr possesses a Tyr (nucleotide sequence, TAC)
at amino acid 123, whereas the ST cys possesses a Cys (nucleotide
sequence, TGC) at this position (Fig. 1). The sequencing
of 10 random clones suggested that the ST tyr was the most predominant
enzyme form (7 out of 10 clones) (20). To rule out the possibility that
the ST cys was an artifact generated during the amplification of the
gt11 cDNA library used for cloning, we analyzed both rat genomic
DNA and rat liver RNA for the presence of these two ST forms. Genomic
DNA and liver RNA were isolated from several rats, the RNA was reverse
transcribed, and the ST sequences surrounding the altered nucleotide
were amplified using the primers shown in Fig. 1. Direct sequencing of
amplified DNA and reverse transcribed cDNA showed that only the ST
tyr form was encoded by rat genomic DNA, whereas both the ST tyr and ST cys forms were encoded by rat liver RNA (Fig. 2). In all
PCR amplifications, no DNA bands were observed in control reactions
lacking template DNA, suggesting that the PCR reagents were not
contaminated with laboratory ST plasmids. In addition, we obtained
similar results when PCR amplified fragments were subcloned into the
Bluescript+ (KS) plasmid (Stratagene) prior to sequencing (data not
shown). In this case we used internal EcoRI and
PstI sites for the subcloning (Fig. 1). The EcoRI
site was originally mutated in the all the plasmid forms used in the
laboratory in order to simplify
subcloning.2 This insured that only
amplified fragments from reverse transcribed RNA or genomic DNA could
be cut with EcoRI and subcloned into the Bluescript+ (KS)
plasmid for sequencing. These results demonstrate that both the ST tyr
and ST cys forms are naturally found in liver RNA and suggest that the
ST cys form may be generated from the ST tyr form by a
post-transcriptional event.
2,6-ST gene consists of several exons (shown here as exons II-VI
(EXII-EXVI)) with the enzyme's coding sequence being found
in exons II-VI. The single nucleotide change converting ST tyr (TAC)
to ST cys (TGC) is found in the catalytic domain sequences encoded in
exon II. The 94 sense and 943A antisense primers were used for
amplification of reverse transcribed RNA. The 94 sense and 573A
antisense primers were used for used for amplification of genomic DNA.
DNA sequencing was performed with the 315 sense primer. In some
experiments, amplified DNA was cloned into the Bluescript+ (KS) plasmid
using the EcoRI and PstI sites shown and DNA
sequencing performed using the T7 primer.
The ST tyr Protein Has a Higher Catalytic Activity than Does the ST cys Protein; however, Both Are Functional when Expressed in CHO Cells
To test whether this amino acid change altered enzyme
activity, we analyzed the catalytic activity of both ST forms following expression in COS-1 cells. Lysates from cells transiently expressing either ST tyr or ST cys and mock transfected controls were assayed for
ST activity using asialo-
1 acid glycoprotein as a substrate. We
found that the cellular ST tyr form was approximately 5-6-fold more
active than the ST cys form in two separate experiments (Table I). In each experiment, transfection efficiencies for
the two forms were nearly identical ranging from 25 to 28%,
eliminating the possibility that a low transfection efficiency for the
ST cys-pSVL resulted in its lower relative catalytic activity. In addition, ST cys and ST tyr proteins that were partially purified from
these expressing cells using CDP-hexanolamine agarose affinity chromatography also exhibited similar differences in catalytic activity
(data not shown). We also observed similar differences in activity
using asialofetuin, a more general substrate for both N-linked and O-linked
2,3- and
2,6-sialyltransferases (21) (data not shown). This suggested that
while being somewhat less active than the ST tyr form, the ST cys form
did not differ dramatically from the ST tyr form in general substrate
specificity. To determine whether both ST forms were functional
in vivo, we stably expressed both the ST tyr and ST cys
proteins in CHO cells, and the expression of
2,6-sialylated
glycoconjugates was examined by staining cells with a FITC-conjugated
SNA lectin that specifically recognizes
2,6-linked sialic acid (22,
23). We found that while wild type CHO cells that survived the G418
selection exhibited no staining with the SNA lectin, cells stably
expressing ST tyr and ST cys both exhibited robust SNA staining,
suggesting that both forms of the enzyme are catalytically active and
functional in these cells (Fig. 3).
|
||||||||||||||||||
2,6-linked sialic acid when expressed in CHO cells. CHO
cells were transfected with ST tyr-pcDNA3neo or ST
cys-pcDNA3neo using the Lipofectamine method. Stably expressing
cells were selected in minimal essential medium, 10% fetal bovine
serum containing 1 mg/ml G418. These mixed populations of cells were
stained for
2,6-sialylated glycoconjugate expression using the
FITC-conjugated SNA lectin and immunofluorescence staining visualized
as described under "Experimental Procedures." The top
panels represent the SNA staining of ST tyr and ST cys expressing
cells. The bottom panels represent the corresponding phase
contrast micrographs of these cells. CHO cells surviving the selection
procedure but not expressing either ST form are not stained with
SNA-FITC. Magnification, ×750.
The ST cys Protein Is Retained in the Cell, whereas the ST tyr Is Rapidly Cleaved and Secreted
To investigate the possibility that
this single amino acid change leads to differences in the transport and
intracellular localization of the two ST forms, we expressed both
proteins in COS-1 cells and analyzed their biosynthesis by pulse-chase
analysis. COS-1 cells expressing either ST tyr or ST cys were
metabolically labeled for 30 min and chased for up to 12 h with
medium containing unlabeled amino acids. ST proteins were
immunoprecipitated from both cell lysate and medium fractions and
analyzed by SDS-polyacrylamide gel electrophoresis and fluorography. We
found that the ST cys protein remains cell associated for up to 12 h of chase and even longer in other experiments (17), whereas the ST
tyr protein is rapidly cleaved to a 42-kDa form and secreted into the
cell medium with a half-time of 6 h in COS-1 cells and 3-4 h in
CHO and HeLa cells (Fig. 4 and data not shown). We
cannot rule out that the single amino acid change in the ST cys protein
leads to a conformational change that prevents proteolytic cleavage; however, it is also possible that this single amino acid change leads
to differences in the intracellular localization of these two forms and
thus a difference in their access to proteases.
The ST tyr and ST cys Proteins Are Differently Localized in COS-1 Cells
To determine whether the ST tyr and ST cys are localized
differently in cells, we analyzed their localization in COS-1 cells by
indirect immunofluorescence microscopy using an affinity purified polyclonal anti-ST antibody (Fig. 5). Initial
examination of ST expressing cells suggested that both ST forms were
predominantly localized in the perinuclear Golgi region (Fig. 5,
top panels, ST tyr and ST cys).
However, closer examination of expressing cells demonstrated
differences in the localization of these two proteins. In
overexpressing cells, the ST cys protein was also found in the
endoplasmic reticulum as has been observed for other overexpressed
glycosyltransferases (Fig. 5, bottom panel, ST
cys) (24, 25). In contrast, the ST tyr form exhibited light cell surface staining, suggesting that a portion of this ST form may be
transported past the Golgi to the cell surface (Fig. 5, bottom panel, ST tyr). No cell surface staining was ever
observed for the ST cys form (data not shown). The subtle differences
in the subcellular localization of the two ST forms and specifically the appearance of the ST tyr but not the ST cys at the cell surface suggested that the differences observed in the proteolytic processing of the ST tyr and ST cys may be related to differences in their cellular localization.
20 °C methanol (internal staining, panels A,
C, and D) or with 3% paraformaldehyde (surface
staining, panel B) prior to incubations with primary and
secondary antibodies. No cell surface expression of the ST cys form was
detected in overexpressing COS-1 cells (data not shown). Magnification,
×750.
The ST tyr and ST cys Proteins Are Transported from Endoplasmic Reticulum to Medial Golgi at a Similar Rate
Proteolytic
processing of proteins in the secretory pathway has been observed in
the trans Golgi and/or trans Golgi network, in endosomal compartments,
in the lysosome, and at the cell surface (26, 27, 28, 29, 30, 31, 32). To examine the
possibility that the ST cys protein is retained in the early Golgi
while the ST tyr protein is transported to later Golgi compartments or
post-Golgi compartments where it is proteolytically processed and
secreted, we compared the processing of the oligosaccharides modifying
the two ST forms. COS-1 cells expressing either the ST tyr or ST cys proteins were metabolically labeled for 1 h and chased for 0, 3, and 6 h. The ST proteins from both cell lysates and medium fractions (ST tyr only) were immunoprecipitated and treated with Endo
H, an endoglycosidase that specifically cleaves glycoprotein high
mannose N-linked oligosaccharides but not complex
N-linked oligosaccharides, which are synthesized in the
medial to late Golgi (33). The resistance of a protein's
oligosaccharides to Endo H cleavage is an indication that the protein
has entered or moved past the medial region of the Golgi (34, 35). We found that the same proportion of ST tyr and ST cys proteins were resistant to Endo H at each time point. After a 6-h chase period, the
maximum level of Endo H resistance was attained and was the same for
both ST proteins (Fig. 6, ST cys Cells and
ST tyr Cells). Previous experiments have demonstrated that
the Asn-linked oligosaccharides of the ST expressed in rat liver or in
COS-1 cells are never completely processed to Endo H resistant, complex
forms (15, 17). Therefore, the low level of Endo H-resistant
oligosaccharides observed on these proteins expressed in COS-1 cells
was not surprising. These results suggested that ST cys was not greatly
delayed in its endoplasmic reticulum to Golgi transport relative to ST
tyr and that very slow movement though the secretory pathway or
retention in the cis Golgi could not account for its lack of
proteolytic processing.
) were analyzed by SDS-polyacrylamide gel
electrophoresis and fluorography (18). Protein molecular mass markers
(Bio-Rad): 86 kDa, bovine serum albumin; 51.6 kDa, ovalbumin; 34.1 kDa,
carbonic anhydrase.
The Processing of the Complex Oligosaccharides of the ST tyr Form Is Similar to Those of the ST cys Form and Suggests That Both Enzyme Forms Are Transported to the Late Golgi
To determine whether
differences in the middle to late Golgi localization of the ST cys and
ST tyr forms can explain differences observed in their proteolytic
processing, we further examined the terminal processing of the
oligosaccharides present on both ST forms using lectin chromatography.
ST proteins were expressed in COS-1 cells, metabolically labeled for
1 h, and chased for 6 h as described above, and their binding
to a series of agarose-conjugated lectins was analyzed (Fig.
7). We found that both the ST tyr and ST cys bound
similarly to concanavalin A, which recognizes mannose residues in the
chitobiose core of high mannose, hybrid, and complex oligosaccharides
(Fig. 7, ConA) (36). A lesser amount of both ST forms bound
to wheat germ agglutinin-agarose demonstrating that less than half of
the ST proteins were modified by complex oligosaccharides containing
terminal GlcNAc residues (37, 38). This was consistent with the results
of the Endo H analysis (Fig. 6). Interestingly, a small amount of both
ST forms bound to E. cristagalli agglutinin-agarose. This
lectin specifically recognizes terminal Gal
1, 4GlcNAc (39), and
suggests that some of each protein possesses complex oligosaccharides
modified by the
1,4-galactosyltransferase, which is generally found
in the trans Golgi and/or trans Golgi network of cells (40, 41). The
secreted form of ST tyr bound only E. cristagalli
agglutinin, and there was no detectable wheat germ agglutinin binding,
suggesting that the ST tyr protein's complex oligosaccharides were
completely galactosylated prior to secretion. Interestingly, little to
no terminally sialylated complex oligosaccharides were detected on
either the ST tyr or ST cys forms expressed in COS-1 cells using either
LPA or L. flavus agglutinin lectin affinity chromatography
(Fig. 7, LPA, and data not shown) (42, 43). A similar
analysis performed with the ST proteins synthesized in HeLa cells
demonstrated that the complex oligosaccharides of both the ST cys and
ST tyr proteins are sialylated to the same extent in these cells (data
not shown). Taken together, these data suggest that both forms of the
ST are capable of being transported to the late Golgi, where they are
equally terminally glycosylated. These data eliminate the possibility
that the ST cys form is retained in an earlier Golgi compartment and
that this prevents its proteolytic cleavage.
The ST tyr Is Proteolytically Processed and Secreted from a Post-Golgi Compartment
The similar terminal processing of the complex oligosaccharides of the ST tyr and ST cys proteins demonstrated that they are not significantly different in their intra-Golgi localization. However, the presence of some ST tyr at the cell surface suggests that this protein is transported past the trans Golgi and trans Golgi network and may be cleaved in a post-Golgi compartment. To test whether the cleavage of the ST tyr takes place in a post-Golgi compartment, we used a 20 °C temperature block that has been shown to stop protein transport at the level of the trans Golgi network and associated vesicles (44, 45, 46, 47). We labeled cells expressing either ST tyr or sp-ST, a soluble, secreted form of the enzyme (16), for 1 h at 37 °C and chased for 6 h at either 37 or 20 °C. After a 6-h chase at 37 °C, one-half of the ST tyr form was found in the medium, whereas nearly all of the sp-ST was found in the medium, consistent with previous results (Ref. 16 and Fig. 4). However, after a 20 °C chase, no ST tyr was observed in the medium, and notably no cleavage had taken place. In addition, sp-ST secretion was essentially blocked at 20 °C, demonstrating that secretory pathway transport was blocked at this temperature. These results suggest that ST tyr cleavage takes place in a post-Golgi compartment. Taken together with the observation that the ST tyr but not the ST cys is observed in small amounts on the cell surface, these results also suggest that the difference in proteolytic processing of the two ST forms is related to their differences in their intracellular localization and access to proteases.
Weinstein et al. (20) originally cloned two forms of
the ST from rat liver
gt11 cDNA libraries. In this study we
characterize these two forms and demonstrate that they do exist
in vivo and that they differ in catalytic activity,
proteolytic processing, and secretion. Direct sequencing of rat liver
genomic DNA and reverse transcription-PCR products demonstrate that
both ST cys and ST tyr forms are encoded by rat liver RNA in
vivo but that only the ST tyr form is detected in rat genomic DNA
(Fig. 2). Analysis of the biosynthesis of the ST tyr and ST cys
proteins revealed that the ST cys form remains intact within the cell
for as long as 12-24 h of chase, whereas the ST tyr form is cleaved and secreted with a half-time of 6 h (Fig. 4). Analysis of the N-linked carbohydrate structures of the ST tyr and ST cys
proteins demonstrate that the carbohydrate structures of both proteins are processed similarly and that some proportion of both proteins is
transported to the late Golgi (Figs. 6 and 7). However,
immunofluorescence microscopic localization of the two ST forms showed
that the ST tyr but not the ST cys moves beyond the Golgi and is
observed at low levels on the cell surface (Fig. 5). These subtle
differences in the localization of the ST tyr and ST cys proteins
suggest that differences in their localization may lead to the observed differences in their proteolytic processing. This idea is supported by
the observation that the cleavage and secretion of the ST tyr is
totally blocked at 20 °C, a temperature that has been shown to halt
protein transport in the trans Golgi network and associated vesicles in
several cell types (44, 45, 46, 47) (Fig. 8). These results
suggest that the ST tyr is cleaved in a post-Golgi compartment and are
consistent with a model that predicts that the ST cys is completely
retained in the Golgi whereas the ST tyr is able to move beyond the
Golgi where it is proteolytically cleaved and secreted.
There are several ways the ST tyr and ST cys forms could be generated.
First, these ST forms could be encoded by two different genes with a
single nucleotide change. This possibility has been ruled out by our
data (Fig. 2) and the data of Lau and colleagues who have demonstrated
by Southern analysis that the ST is encoded by a single gene in
mouse,3 rat (11), and humans (12). Second,
the splicing of an alternative exon encoding the ST cys change could
generate this form. This possibility has also been ruled out by the
genomic mapping experiments of Svensson et al. (8) and
O'Hanlon et al. (11). Third, allelic variation of a single
gene could lead to the expression of two forms of the enzyme. This type
of mechanism has been shown to determine the blood group ABO antigen(s)
expressed by an individual (48). A fourth possibility is that the A
G change in the nucleotide sequence could be the result of a
post-transcriptional event such as RNA editing (49).
RNA editing has been observed in plants, protozoa, and mammals (49).
Mammalian substitution or modification editing falls into two
categories: C to U and U to C editing as found the apolipoprotein B
mRNA (CAA
UAA) and the Wilms' tumor susceptibility protein (WT1) mRNA (CUC
CCC), and A to I editing as found in the GluR-B subunit of the
-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor, which mediates neurotransmission in the central synapses (49,
50). The replacement of a Gln (C
G) in one of the
transmembrane regions of the GluR-B subunit with a Arg
(C
G) leads to lower calcium ion permeabilitites and ion
conductance in receptor channels formed with this subunit. This change
occurs as the result of modification of the A in the Gln codon to an I
by an adenosine deaminase-like activity that requires specific intron
sequences and secondary structure as well as specific sequences around
the edited site (50, 51). Ultimately, the I is translated as a G
leading to the amino acid change to an Arg. The single amino acid
change that differentiates the ST tyr from the ST cys form is the
result of a single A to G change in the nucleotide sequence (TAC
TGC) and may result from a similar editing event.
Interestingly, Schneikert and Herscovics (52) cloned two naturally
occurring forms of the mouse
1,2-mannosidase IB cDNA that differ
at three nucleotide positions in their coding sequences and thus three
amino acids in their catalytic domains. In each case, a T(U) in clone
16 is replaced by a C in clone 4. The change from a Phe at position 468 (TTC) in clone 16 to a Ser (TCC) at this position in clone 4 is
sufficient to inactivate the enzyme (52). The other two amino acid
changes do not inactivate the enzyme but do appear to alter its folding
and transport since the corresponding soluble, protein A fusion
proteins are not secreted well. Both clone 4 and clone 16 forms are
observed in the RNA of inbred and outbred mouse strains (52), whereas
only clone 16 appears to be encoded by genomic
DNA.4 These changes in the mannosidase IIB
coding sequence could also be the result of a U to C RNA editing event,
and if so, this would be the first example of this type of editing
occurring at multiple locations in an RNA.
Soluble circulating forms of glycosyltransferases, as well as those found at the cell surface, are presumably catalytically inactive due to the lack of sugar nucleotide donors in the extracellular space. Several years ago, soluble forms of glycosyltransferases were detected in and purified from body fluids (53, 54, 55, 56, 57, 58, 59). More recently, expression of recombinant glycosyltransferases in tissue culture cells has again demonstrated that some of these enzymes are proteolytically cleaved and secreted (20, 60, 61, 62, 63, 64, 65). How and why integral membrane glycosyltransferases are proteolytically processed to soluble forms is largely unstudied and it is unclear whether cleavage and secretion reflect enzyme turnover or actually create proteins that function as lectins in the circulation (58, 66). Our data demonstrate that the ST tyr protein is rapidly cleaved and secreted, whereas the ST cys protein is retained for longer times in the Golgi. Although the proteolytic processing of the ST tyr protein could control the release of sialic acid-specific lectin activity into the circulation, it is more likely that it regulates the Golgi residence time of this enzyme and has a greater impact on the efficiency of protein sialylation.
Work by Lammers and Jamieson (26) and Weinstein et al. (20) demonstrated that the ST is readily cleaved to a 42-kDa soluble form in vitro and that the cleavage site is between Asn63 and Ser64. The secreted form of the ST tyr is identical in molecular weight to the cleaved ST forms observed by these researchers, and this suggests that the putative ST tyr cleavage site is ~60 amino acids away from the Tyr to Cys amino acid change. Although we cannot rule out the possibility that the ST cys is not cleaved due to conformational constraints resulting from this single amino acid change, our data more strongly favor the idea that the ST tyr and ST cys are localized differently in the cell and that only the ST tyr has access to proteases that will cleave the ST sequence and allow its secretion. The presence of the ST tyr protein, but not the ST cys protein, on the cell surface suggests that the subtle conformational change induced by the single Tyr to Cys change in the catalytic domain of ST not only results in a small decrease in catalytic activity but also leads to differences in the intracellular localization of the ST cys and ST tyr proteins. This is consistent with previous work from our laboratory that showed that although the transmembrane domain plus flanking sequences and stem region are independent Golgi retention sequences, other luminal sequences, although not sufficient for retention, did appear to influence the efficiency of this retention process and the transport of proteins through the secretory pathway (17, 18).
Our results suggest that the ST tyr and ST cys proteins are both transported to a late Golgi galactosyltransferase containing compartment and that the ST tyr protein is capable of moving past this compartment and is found in small amounts on the cell surface. These observations suggest at least two possibilities. First, the ST cys could move only as far as the trans cisternae of the Golgi, whereas the ST tyr moves to the trans Golgi network where it is cleaved. Second, the ST cys could move as far as the trans Golgi network, whereas the ST tyr moves past the Golgi into late endosomes or prelysosomal compartments where it is cleaved. Although the appearance of small amounts of the ST tyr on the cell surface could indicate a surface cleavage event, this is unlikely because most proteins that are cleaved at the cell surface are found at much higher levels in this location (28). Consequently, the small amount of the ST tyr observed at the cell surface would reflect material that escaped cleavage and secretion. Because the terminal glycosyltransferases are found both in the trans Golgi and trans Golgi network of tissue culture cells (34, 35, 67, 68, 69, 70), we cannot distinguish between these two possibilities by analysis of the oligosaccharides of these proteins. Differences in the intra-Golgi localization of these two ST forms will require future analysis by immunoelectron microscopy coupled with strategies to distinguish intact and cleaved ST tyr forms.
The proteolytic processing of the ST tyr form in a very late Golgi or post-Golgi compartment is supported by the results of a 20 °C transport block experiment in Fig. 8. Several groups have lowered temperatures to block transport along the secretory pathway (44, 46, 47, 71). Xu and Shields (71) used 20 °C block to determine the site of prosomatostatin proteolytic cleavage. They showed that prosomatostatin transport and proteolytic processing is blocked in the trans Golgi network of GH3 cells at 20 °C. Here we used 20 °C block to determine whether the ST tyr is cleaved in the Golgi. We found that the cleavage and secretion of ST tyr is totally blocked when COS-1 cells expressing this protein are chased for 6 h at 20 °C. Because both the ST tyr and ST cys appear to reach the late Golgi and it is unlikely that a specific protease would be completely inhibited at 20 °C, these results strongly suggest that the ST tyr ultimately moves beyond the late Golgi to a post-Golgi compartment where it is cleaved.
What are the roles of the ST tyr and ST cys proteins in cells?
Sialyltransferase assays using conventional glycoprotein substrates (asialo-
1 acid glycoprotein and asialofetuin) and analysis of
2,6-sialylated glycoconjugate expression in CHO cells by SNA immunofluorescence analysis demonstrate that both the ST tyr and ST cys
proteins are functional sialyltransferases and that the 5-6-fold lower
catalytic activity of the ST cys form does not appear to dramatically
limit its activity (Table I and Fig. 3). It is possible that
differences in the catalytic activity of these two forms are equalized
by differences in their residence times in the Golgi. However, it is
equally possible that these two enzymes sialylate different
glycoproteins and also differ in their efficiency leading to
differences in the levels of sialylated glycoconjugates expressed by
the cell. Another possibility is that the coexpression of the ST tyr
and ST cys proteins in the same cell could lead to a longer residence
time for the ST tyr in that cell. Oligomerization and kin recognition
are popular potential mechanisms for the retention of
glycosyltransferases in the Golgi (72, 73). Preliminary experiments in
our laboratory suggest that the ST does form insoluble oligomers in the
low pH (6.4) of the late Golgi.5 In
addition, coexpression of the ST cys and ST tyr forms in COS-1 cells
does lead to decreased cleavage and an increased retention time for the
ST tyr protein.5 The co-expression of the ST tyr and ST cys
proteins in specific tissues may lead to the formation of mixed ST
oligomers and result in an extended retention of the ST tyr in the late
Golgi with the ST cys protein, thus preventing its rapid cleavage and
secretion. We predict that coexpression of these two ST forms as well
as their individual expression in different tissues and cell types could lead to a variety of expression/localization patterns and thus
subtly control the ST activity levels in a cell.
To whom correspondence should be addressed: Dept. of Biochemistry,
University of Illinois College of Medicine, 1819 W. Polk St. M/C 536, Chicago, IL 60612. Tel.: 312-996-7756; Fax: 312-413-0364; E-mail:
karenc{at}uic.edu.
2,6-sialyltransferase (EC 2.4.99.1); DMEM, Dulbecco's modified
Eagle's medium; LPA, L. polyphemus agglutinin; SNA,
S. nigra agglutinin; Endo H, endoglycosidase H; CHO, Chinese
hamster ovary; FITC, fluorescein isothiocyanate; PCR, polymerase chain
reaction.
We thank Drs. Robert Costa and Joseph Lau for continued support and advice and Dr. Annette Herscovics for sharing unpublished data with us.
This article has been cited by other articles:
![]() |