![]()
|
|
||||||||
in Reciprocal
and
Chimeras Mediates Phorbol Ester-induced Macrophage
Differentiation of Mouse Promyelocytes*
(Received for publication, August 13, 1996, and in revised form, October 11, 1996)
,
¶,
,
and
**
From the
Laboratory of Genetics and the
§ Laboratory of Cellular Carcinogenesis and Tumor Promotion
of the National Cancer Institute, Bethesda, Maryland 20892-4255
The overexpression of protein kinase C-
(PKC-
), but not PKC-
, enables the mouse myeloid cell line 32D to
differentiate into macrophages when treated with phorbol esters such as
12-O-tetradecanoylphorbol-13-acetate (TPA). To determine
the domain of PKC-
that is responsible for this isotype-specific
function, cDNAs that encode reciprocal chimeras of PKC-
and -
(PKC-
and PKC-
) were constructed by exchanging regulatory
and kinase domains using polymerase chain reaction technology. Both
chimeras were stably expressed in 32D cells using the pLTR expression
vector and displayed protein kinase activity upon TPA treatment. TPA
treatment of L
, cells that overexpressed the PKC-
chimera,
induced a dramatically increased cell volume, surface adherence,
surface expression of Mac-1 and Mac-3, lysozyme production, and
phagocytosis. These are the characteristics of the macrophage phenotype
found in TPA-treated 32D cells that overexpressed PKC-
. In contrast,
little effect was seen in L
, 32D cells that overexpressed
PKC-
, with or without TPA treatment. A PKC inhibitor directed
toward the catalytic domain of PKC, GF109203X, and a selective
inhibitor of PKC-
, Rottlerin, blocked the TPA-induced differentiation of PKC-
-overexpressing 32D cells. These results demonstrate that the catalytic domain of PKC-
contains the primary determinants for its activity in phorbol ester-induced macrophage differentiation.
Protein kinase C (PKC)1 comprises a
group of cellular Ser/Thr kinases that have been implicated in
regulation of cellular differentiation and proliferation. There are at
least 11 closely related PKC isozymes that are encoded by different
genes (except PKC-
I and-
II, which are the
products of alternative splicing (1)). Phorbol esters, such as
12-O-tetradecanoylphorbol-13-acetate (TPA), are potent activators of most isozymes, and TPA acts at the same site on PKC as
the endogenous activator, sn-1,2-diacylglycerol (2).
The structure of all PKC isoforms can be functionally divided roughly
in halves comprising a regulatory (N-terminal) and a catalytic
(C-terminal) domain connected by a flexible hinge region that contains
the primary site of protein degradation (Fig. 1). Four evolutionarily
conserved domains (C1-C4) are interspersed among variable regions
(V1-V5) that appear to determine the isozyme-specificity (3). The C3-V5
region has been defined as the catalytic domain, because C3 contains
the ATP-binding site and C4 contains the substrate-binding site and the
phosphate-transfer region. Sequences N-terminal of C3 are called the
regulatory domain. C1 contains the pseudosubstrate domain and the
sn-1,2-diacylglycerol- and phorbol ester-binding region. C2
contains the Ca2+-binding domain, present in the
"conventional" isozymes, PKC-
, -
and -
, but not in the
"novel" isozymes, PKC-
, -
, -
and -
, or the
"atypical" isozymes, PKC-
, -
, and -
(2).
and PKC-
, respectively. C1, 3, and
4 are constant domains and V1-V5 are variable domains. PS is the
"pseudosubstrate" region. Panel b, Western blots of total cell lysates of wild-type 32D cells and stable transfectants of
32D that overexpress PKC-
(L
), -
(L
), -
(L
),
and -
(L
). Lanes 1-5 were probed with a mixture
of monoclonal anti-PKC-
N-terminal antibody plus a monoclonal
anti-PKC-
N-terminal antibody, and lane 6 was probed with
anti-PKC-
C-terminal antibody. Lane 6 represents an
early, unstable population of L
with high expression. Lanes
7-11 were probed with a mixture of anti-PKC-
and -
C-terminal antibodies. The strong upper band in lane 4 represents the chimeric molecule, and the lower band represents the
endogenous PKC-
. Lane 11 represents the stable population
of L
, that was used for studying macrophage characteristics.
Positions of molecular mass markers are shown on the
left.
Marked differences have been found in the distribution of PKC isozymes
in tissues and organs. PKC-
, -
, -
, and -
are nearly ubiquitously expressed, while PKC-
, -
, and -
are more
restricted to certain tissues. PKC-
is abundant in most
hematopoietic cells, but PKC
is expressed only in occasional B and
T cell lines (4). In addition, PKC-
is expressed at very low levels
in many normal murine tissues except for the brain, which is also the
richest source of PKC-
(5, 6). These differences imply a divergence in functions. This was borne out by experiments in which we showed that
PKC-
and -
had different effects in the murine myeloid progenitor
cell line 32D: the overexpression of PKC-
induced macrophage
differentiation of 32D cells upon stimulation with TPA, but
overexpression of PKC-
had no such effect (7). What is more, the
overexpression of PKC-
and -
has been shown to generate opposite
effects on growth, morphology, and tumorigenicity in mouse, rat, and
human fibroblasts (8, 9, 10). In addition, we and others showed that when
individual PKC isozymes were activated in a single cell type,
e.g. NIH 3T3 cells, different isozymes translocated to
different subcellular locations, presumably their unique sites of
action (11, 12).
In the interest of understanding the structural basis for the
differences in isozyme function, we wanted to determine whether the
"regulatory" or the "catalytic" region of PKC-
and -
contained the chief determinants for specificity of isoenzyme action.
There are reports that parts of the regulatory domains of PKC-
,
-
, and -
play a role in determining their substrate specificity (13, 14, 15, 16). On the other hand, the catalytic domains of PKC-
,
-
I, -
II, and -
have been implicated in
their isozyme-specific functions (1, 17, 18). We wished to determine
directly which of these two domains of the novel PKCs, PKC-
and
-
, contributed to their differences in biological function.
Therefore, we constructed reciprocal chimeric molecules of PKC-
and
-
and expressed them in 32D cells to determine which domain of
PKC-
was responsible for its ability to confer TPA-induced
differentiation on this myeloid cell line.
and -
Chimeras
Before generating
the PKC chimeras, we separately amplified the regulatory and catalytic
domains of PKC-
and -
from their cDNAs using polymerase chain
reaction (PCR) and a series of oligonucleotide primer pairs each of
which includes a 21-mer that is present in the C3 region of both
PKC-
and -
. The location and use of these pairs are shown
diagrammatically in Fig. 1A and the sequences are as
follows: 5
-reg, GAATTCTCCATCATGGCACCC, and the C3-antisense primer, CTTGCCAAAGCTGCCTTTGCC; C3-sense, GGCAAAGGCAGCTTTGGCAAG, and 3
-kin, GAATTCCTTAATTAAATGTCC; 5
-reg,
GAATTCACCATGGTAGTGTTCAAT, and the C3-antisense primer; C3-sense, and 3
-kin, GAATTCTGAAGCAGTTTCTCA. A PCR Optimizer kit (Promega, Madison,
WI) was used to find the optimal pH and Mg2+ concentrations
for each reaction, and Taq polymerase (Perkin Elmer) was
employed. 1 µg of the cloned mouse PKC-
and -
cDNAs (5, 9)
were used as templates. PCR conditions were: 30 cycles of 15 s at 94 °C, 30 s at 58 °C, 1.5 min at 72 °C. Reciprocal chimeras of PKC-
and -
were generated using an overlap from the
21-base pair region in C3 that is identical in the two isoforms and
present in each of the first round PCR products. The PKC-
was
generated by a second round of PCR amplification using 5
-reg plus
3
-kin primers and
regulatory domain and
catalytic domain
templates that were generated in the first round of PCR and the same
PCR conditions as above. The PKC-
was generated in an analogous
fashion using 5
-reg plus 3
-kin primers and the PCR products
corresponding to the
regulatory and
catalytic domains as
templates. PCR products were initially cloned into a pBluescript SK±
vector, sequenced (U. S. Biochemical Corp.), and finally recloned
into a mammalian pLTR expression vector at the EcoRI
cloning site. pLTR is a mammalian expression vector based on the Harvey
sarcoma virus long terminal repeat which contains the selectable marker
xanthine-guanine phosphoribosyltransferase (19). M
, a previously
reported PKC-
overexpresser that uses the pMTH vector (7), which
expresses lower levels of PKC-
protein, was also used for comparison
in Fig. 1.
32D cells were grown in
RPMI 1640 supplemented with 10% fetal bovine serum, 10% conditioned
medium from WEHI 3 cells as source of interleukin-3, 4 mM
L-glutamine, and 100 units/ml penicillin and 100 µg/ml
streptomycin. Cells were transfected with the expression vectors by
electroporation (400 volts, 50 microfarads) and selected for 2 weeks in
medium supplemented with HAT (0.2 mM hypoxanthine, 0.4 mM aminopterin, and 16 mM thymidine) and 80 µM mycophenolic acid. This yielded the cell lines L
,
L
, L
, and L
that overexpressed PKC-
, -
, and the
PKC chimeras, respectively. The presence of the PKC proteins and the
levels of their expression were determined by Western blot
analysis.
8 × 106 cells were
pelleted and lysed in 400 µl of lysis buffer (10 mM
Tris-HCl, pH 7.5, 1 mM EGTA, 1 mM
phenylmethylsulfonyl fluoride, and 1% Triton X-100) followed by
10 s sonication. Protein content was monitored by a micro-protein
assay using the BCA protein assay kit (Pierce, Rockford, IL).
Approximately 20 µg of lysates were mixed with equal volumes of
2 × SDS sample loading buffer (60 mM Tris-HCl, pH
7.5, 2 mM EDTA, 10 mM 2-mercaptoethanol, 20% glycerol, and 2% SDS), size-fractionated by electrophoresis on 1%
SDS-10% polyacrylamide gels at 100 volts for 3 h followed by electrotransfer onto a nitrocellulose membrane at 100 volts for 30 min.
Nonspecific antibody binding was blocked by incubating the membrane in
a 5% solution of dry-milk in TBS (50 mM Tris-HCl, 150 mM NaCl, pH 7.5) at room temperature for 1 h. The
blots were probed with rabbit antisera raised against the C terminus of
PKC-
(Research and Diagnostic Antibody, Berkeley, CA) and against
the C terminus of PKC-
(Life Technologies, Inc., Gaithersburg, MD) or with mouse monoclonal antibodies against the N terminus of PKC-
or PKC-
(both from Signal Transduction Laboratories, Lexington, KY).
A mouse monoclonal antibody raised against PKC-
(UBI, Lake Placid,
NY) was used to detect the endogenous PKC-
in 32D cells. Goat
anti-rabbit IgG and goat anti-mouse IgG, coupled to alkaline phosphatase were used as the secondary antibodies (Accurate Chemical and Scientific Corp., Westbury, NY). The immunoreactive bands were
visualized using 5-bromo-4-chloro-3-indolylphosphate
p-toluidine salt and nitro blue tetrazolium chloride
(Kirkegaard and Perry Laboratories, Gaithersburg, MD).
4-8 × 106 32D cells grown with or without 10 ng/ml TPA for 10 h were harvested in 100 µl of lysis buffer without Triton X-100, sonicated, and centrifuged at 100,000 × g for 1 h at 4 °C. The supernatants were collected as the "cytosolic" fractions. The pellets were solubilized in 100 µl of lysis buffer containing 0.1% Triton X-100 and centrifuged again at 100,000 × g for 1 h at 4 °C. These supernatants were harvested as the "membrane" fractions. The remaining pellets were resuspended in 100 µl of 2 × SDS sample loading buffer as "Triton-insoluble" fractions (20). Equal loading of each fraction was verified by staining duplicate gels with Coomassie Brilliant Blue R-250 (Life Technologies, Inc.).
Protein Kinase C Assay and Phorbol Dibutyrate (PDBu) Binding Assay4 × 106 cells were lysed in 100 µl of
extraction buffer (20 mM Tris-HCl, pH 7.4, 5 mM
EGTA, 0.25 mM phenylmethylsulfonyl fluoride, and 20 µg/ml
leupeptin) followed by sonication for 10 s. 10 µl of the lysates
were added to 30 µl of assay mixture containing 50 mM
Tris-HCl, pH 7.4, 1 mM CaCl2, 50 µM PKC-
substrate peptide (RFARKGSLRQKNV) (Life
Technologies, Inc.), 80 µg/ml phosphatidylcholine, 20 µg/ml
phosphatidylserine, 10 mM MgCl2, 1 µM TPA (LC Laboratories, Woburn, MA), 50 µM
ATP, and 1 µCi/assay [
-32P]ATP (specific activity
6000 Ci/mmol, Amersham). The reactions were incubated at 30 °C for
10 min and chilled on ice. After addition of 10 µl of 40%
trichloroacetic acid (4 °C), the reactions were spun in a
microcentrifuge at 15,000 × g, and 25 µl of each
supernatant was spotted onto phosphocellulose disks (Life Technologies,
Inc.). The disks were washed three times in 0.5% phosphoric acid and three times in distilled water, and were then counted in a liquid scintillation counter. The PKC activity was calculated as the total
kinase activity measured in the presence of TPA minus the activity in
the absence of TPA. Activity was expressed as nanomoles of
32P incorporated into substrate/min/µg of protein.
[3H]PDBu binding was measured using the polyethylene glycol precipitation assay (21). Briefly, crude cell lysates were incubated with 20 nM [3H]PDBu in the presence of 0.5 mM Ca2+ and 100 µg/ml phosphatidylserine. Nonspecific binding was determined in the presence of excess nonradioactive PDBu (30 µM). Specific binding was calculated by subtracting the nonspecific binding from the total binding in the absence of unlabeled PDBu.
Cytostaining, Growth, and Differentiation AssaysCells were treated with TPA (10 ng/ml), PKC inhibitors (GF 109203X, 1 and 10 µM; Rottlerin, 6 and 30 µM; both from LC Laboratories), and TPA plus inhibitors for 10-20 h. For assessment of growth, cells were counted each day for 5 days using a hemocytometer to generate growth curves, and the linear part of each curve was used to determine the doubling time. For analysis of morphology, cytospins of 2-5 × 105 cells were stained with Giemsa (Sigma). Lysozyme activity secreted during a 16-h period of growth in the presence or absence of TPA was determined by mixing 0.4-ml aliquots of culture medium with 0.4 ml of a 10 mg/ml suspension of Micrococcus luteus bacteria (Sigma) in 0.067 M sodium/potassium phosphate, pH 6.25. The rate of decrease in turbidity was measured spectrophotometrically at 450 nm using a standard curve of egg white lysozyme (Sigma) in the concentration range of 0.1-2.0 µg/ml (22). Percent adherence was determined by separately counting the non-adherent and adherent cells (released by treatment with trypsin, EDTA, or cold shock) with a hemocytometer and calculated by dividing the number of adherent cells by the total number of cells. Phagocytosis was studied as described previously (23). Briefly, opsonized zymosan particles (Sigma) were incubated with cells at 37 °C for 30 min. The suspensions were washed and transferred onto microscope slides by cytocentrifugation and subsequently stained with Periodic Acid-Schiff reagents and methyl green.
Flow Cytometry Analysis1 × 106 cells were incubated with anti-Mac-1 (CD11b, M1/70) and anti-Mac-3 (M3/84) antibodies (Pharmingen, San Diego, CA) conjugated with fluorescein isothiocyanate at 4 °C for 30 min. Cells were subsequently analyzed using a Becton Dickinson FACScan. Cells incubated without antibodies and with an irrelevant isotype-matched antibody, fluorescein isothiocyanate anti-mouse CD45R/B220 (Pharmingen, San Diego, CA), were used as negative controls.
Expression, Stability, and Enzyme Activity of Overexpressed PKCs in 32D Cells
The cDNAs for mouse PKC-
and -
and the PKC-
and
-
chimeras were sequenced completely, and the chimeras were found
to have no introduced mutations. They were cloned into the pLTR
expression vector and transfected into 32D cells. The stable
transfectants were selected by growth in HAT medium plus mycophenolic
acid. Western blot analysis (Fig. 1b) showed
that PKC-
, -
, and -
were stably expressed at high levels in
L
, L
, and L
, respectively. Early passages of L
(L
hi) expressed higher levels of PKC-
than the
stable line that emerged later, L
lo. Neither
L
lo (Fig. 3) nor L
hi (not shown)
acquired macrophage morphology when treated with TPA (see below).
L
hi was unstable and could not be tested for kinase
activity or other macrophage markers. Expression of PKC-
in L
was
unusually high, so it was compared to M
, a line of 32D cells bearing
PKC-
in the MTH expression vector (9). The chimeric PKC-
was
identified as a protein with the size of PKC-
that reacted with an
antibody against the C terminus of PKC-
but not with one against the
C terminus of PKC-
(not shown). The PKC-
protein was similar in size to PKC-
, as expected, and was detected with both antibodies against the C terminus of PKC-
and the N terminus of PKC-
.
, -
, -
, and -
. Left
panels show the morphology of the cells in the absence of TPA.
Middle panels show the cells after treatment with TPA (10 ng/ml) for 10 h. Right panels show the morphology of
the cells after treatment with both TPA (10 ng/ml) and GF109203X (1 µM) for 10 h. The cells were applied to uncoated
glass microscope slides using cytocentrifugation and then stained
with Giemsa. Data from one of three similar experiments are
shown.
Protein kinase assays and PDBu binding assays were performed on the overexpressing cell lines and compared with wild-type 32D cells. As expected PKC kinase and PDBu binding activities were elevated in the overexpressers (Table I). Values are similar to those obtained by us (9) and others (24) for PKC overexpressers in other cell lines.
|
|||||||||||||||||||||||||||||||||
As expected, TPA (10 ng/ml) caused down-regulation of the abundant
endogenous PKC-
and the less abundant endogenous PKC-
(Fig.
2A). However, no down-regulation of the
exogenous PKCs was seen in any of the four overexpressing cell lines,
even after 48 h of treatment (Fig. 2B). None of the
overexpressed PKCs abrogated the interleukin-3 dependence of 32D cells
in the presence or absence of TPA (data not shown).
and -
in
32D cells and their down-regulation by TPA (10 ng/ml). PKC-
was
probed with anti-PKC-
catalytic domain antibody and PKC-
with
anti-PKC-
C-terminal antibody. B, cell lysates of L
,
L
, L
, and L
were prepared from parallel cultures of
untreated cells (0 h) or cells that had been treated with 10 ng/ml TPA
for the indicated times. Anti-PKC-
N-terminal antibody was used to
probe L
, anti-PKC-
N-terminal antibody for L
, anti-PKC-
,
C-terminal antibody for L
and L
. C, Western blots
of the fractionated lysates of PKC-overexpressing lines untreated or
treated with TPA (10 ng/ml) for 10 h. PKCs were detected by the
same antibodies used in B. Arrows indicate overexpressed PKC
isoforms. S, soluble fractions; M, membrane fractions; I, Triton-insoluble fractions.
Fractionation studies showed that similar amounts of PKC-
, -
, and
chimeric PKC-
proteins appeared in the membrane and cytosolic
fractions in the absence of TPA (Fig. 2C). In contrast, the
chimeric PKC-
was found in membrane and Triton-insoluble fractions only. Upon TPA treatment, the PKC-
chimera and most of
the overexpressed PKC-
and -
were found to translocate from the
soluble to the membrane fractions, but the pattern of distribution of
PKC-
remained the same. The amount of each construct that was
associated with the Triton-insoluble fractions remained unchanged.
The Effects of Chimeric PKCs on Myeloid Differentiation in 32D Cells
We detected substantial levels of PKC-
, low levels of PKC-
,
but no PKC-
in wild-type 32D cells (Fig. 2). Activation of endogenous PKCs by TPA, however, did not cause differentiation, which
may be due to the low level of expression. Overexpression of PKC-
and -
results in a slowing of cell growth (Table
II), similar to the results reported for overexpression
of PKC-
in NIH3T3 cells (9) and COS cells (8), but macrophage
differentiation required stimulation by TPA. The differentiation of 32D
cells was assessed by several criteria: morphology, surface adherence, lysozyme production, phagocytosis, and macrophage-specific cell surface
markers. 10 ng/ml TPA treatment for 10 h was sufficient to
translocate overexpressed PKC-
, PKC-
, and PKC-
(TPA-treatment had no effect on the distribution of chimeric
PKC-
, since it was absent from the cytosolic fraction),
down-regulate endogenous PKC-
and PKC-
as well as induce myeloid
differentiation, whereas this concentration did not down-regulate the
overexpressed PKCs.
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Wild-type 32D cells displayed the phenotype of
normal myeloid progenitor cells: small cells with well defined membrane
structure and few if any cytoplasmic vacuoles (Fig. 3).
This same morphology characterized L
cells before and after 10 h in 10 ng/ml TPA. Untreated L
cells were slightly larger than
32D cells and had a greater cytoplasm to nucleus ratio. Untreated
L
and L
appeared even larger, with a few more vacuoles.
These minor deviations from wild-type morphology in L
cells were
not intensified by treatment with TPA. In contrast, L
and L
acquired the morphological characteristics of mature macrophages upon
TPA treatment: greatly increased cell volume, increased adherence to
the surface of culture vessels, numerous cytoplasmic vacuoles, and
poorly defined plasma membrane. These morphological changes were even
more pronounced in L
cells than in L
cells (Fig. 3).
L
showed increased adherence 1 h after TPA
treatment. Maximum effects were observed at 4 h. These effects
were observed up to 20 h (Table II), but by 50 h after TPA
addition most cells had detached. The adherence of L
was more
persistent, starting 1 h after the addition of TPA, peaking at
8 h, and continuing for more than 70 h. In contrast, L
exhibited virtually no adherence in the presence of 10 ng/ml TPA.
Untransfected 32D cells, as well as L
cells, transiently adhered to
the surface of the tissue culture dish but without morphological
changes, beginning 30 min after the addition of TPA and lasting no more
than 14 h.
Secretion of lysozyme is another
characteristic of mature macrophages. Lysozyme activity was measured
spectrophotometrically in the medium in which 32D cells and their
PKC-overexpressing derivatives had been cultured for 16 h with or
without TPA. As shown in Table II, wild-type 32D cells produced very
little lysozyme with or without TPA. Low levels of lysozyme production
were observed in all the overexpressing lines, and TPA treatment
induced a 3-6-fold increase in production, except for L
, which
remained unchanged.
Activated macrophages are phagocytic cells, so a
phagocytosis assay was performed on all cell lines before and after TPA
stimulation using opsonized zymosan particles. L
and L
cells
showed 5-15-fold higher ingestion of zymosan particles compared to
L
and L
cells when treated with TPA for 10 h. In the
absence of TPA, however, only L
showed a significant amount of
zymosan intake (Table II and Fig. 4).
, -
, -
, and -
after stimulation with TPA (10 ng/ml) for 10 h. Free zymosan
particles were removed by washing and subsequent centrifugation before
the cells were applied to the uncoated glass microscope slides. The
zymosan particles, stained with periodic acid-Schiff reagents, appeared
as small black particles in the photomicrograph, and the cells were
counterstained with methyl green. The experiment was repeated three
times and a representative result is shown.
Mac-1 and Mac-3 Expression
Macrophage differentiation is
typically accompanied by the appearance of macrophage surface markers
such as Mac-1 and Mac-3. We assayed for these markers by flow cytometry
(Fig. 5) and found that, in the absence of TPA, all
PKC-overexpressing cells as well as wild-type 32D cells, expressed
Mac-1 on the cell surface. As expected (9), L
showed increased
expression of Mac-1, while L
showed no changes in the presence of
TPA (10 ng/ml). L
cells showed elevated levels of Mac-1
expression 10 h after TPA treatment, and this expression peaked
after 50 h of TPA treatment (data not shown). In contrast, there
were no apparent changes of Mac-1 expression in L
. In the case of
Mac-3, only L
cells had a significant level of surface expression,
and only L
and L
cells showed increased Mac-3 expression in
response to TPA treatment, including the appearance of a subpopulation
of cells with a high level of Mac-3. No increase in Mac-3 was induced
in 32D, L
, or L
by TPA (Fig. 5).
,
L
, L
, and L
cells were treated with TPA for various
times and stained with fluorescein isothiocyanate-labeled antibodies
against Mac-1 and Mac-3. The filled peaks are the negative
controls that show the fluorescence in the absence of antibodies. The
gray outlined peaks are the zero time controls,
i.e. fluorescence intensity in the presence of antibody
before TPA treatment. The black outlined peaks show the
fluorescence pattern 10 h after TPA treatment. Data from one of
four similar experiments are shown.
Inhibition of Myeloid Differentiation by PKC Inhibitors
To confirm that the TPA-induced 32D cell differentiation into
macrophages was mediated by PKC, we treated the cell lines with the PKC
inhibitor GF109203X, that acts competitively at the ATP-binding site of
PKC (25). The changes in morphology observed in TPA-treated L
,
L
, and L
cells were completely blocked by the addition of 1 µM GF 109203X (Fig. 3). What is more, addition of
GF109203X to uninduced overexpressers diminished the cells'
morphological differences from 32D (data not shown), suggesting that
these differences in cell size were mediated by endogenous activation
of a small portion of the overexpressed PKC. Importantly, 1 µM GF109203X significantly reduced the surface adherence
of L
and L
(Table II), and 10 µM completely
inhibited adherence (not shown).
These results were confirmed by experiments with Rottlerin, another PKC
inhibitor that has been shown to have some selectivity for PKC-
and
also inhibit CaM-kinase III (26). Rottlerin showed similar effects on
TPA-induced differentiation as did GF109203X (Table II): partial
inhibition of differentiation was obtained at the concentration of 6 µM, and 30 µM Rottlerin was able to completely block the differentiation.
PKC
and
are members of the family of novel PKCs, but
despite belonging to the same PKC subgroup, PKC-
and -
have
substantial differences in size and significant biochemical and
biological differences. nPKCs exhibit in vitro differences
in phosphorylating myelin basic protein, histones, protamine, and
protamine sulfate (3, 13, 27). In vivo, activated PKC-
and -
have distinct patterns of intracellular localization (11, 12),
and overexpressed PKC-
and -
induce distinct biological responses
in a variety of cell types. Overexpression of PKC-
in Chinese
hamster ovary cells, NIH 3T3 cells and human glioma cells slowed
proliferation while overexpressed PKC-
increased growth (8, 9).
Moreover, overexpression of PKC-
but not PKC-
in mouse or rat
fibroblasts was transforming in vitro and tumorigenic
in vivo (9, 10). In addition, overexpression of PKC-
, but
not PKC-
, could reconstitute PKC-depleted rat basophils' ability to
respond to antigen (28). Of particular relevance to this study, we have
previously shown that PKC-
, but not PKC-
, could endow 32D cells
with the ability to differentiate into macrophages when treated with
TPA (7). The structural basis for these divergent isozyme-specific
functions remains largely unknown.
To approach this issue we sought to assign the 32D-differentiation
ability to either the regulatory or the catalytic half of PKC-
. To
do so, we constructed PKC-
/
chimeras by swapping the regulatory
and catalytic domains of PKC-
and -
cDNAs and stably
expressing them in 32D cells. Both chimeric proteins were overexpressed
in 32D cells as shown by isozyme-specific antisera. The cell lines that
expressed PKC chimeras exhibited increased kinase activity and showed
significant PDBu binding, indicating that the chimeric proteins were
functioning kinases that could be stimulated by phorbol esters.
As expected from previous experiments (7) the overexpression of PKC-
in 32D cells induced all the signs of macrophage differentiation upon
TPA treatment: slower growth rate; flat, vacuolated morphology; surface
adherence; lysozyme production, phagocytic activity, and increased
expression of Mac-1 and Mac-3. Similar results were obtained for
PKC-
overexpresser but not for the reciprocal chimera,
PKC-
. The appearance of the macrophage phenotype could be blocked
by PKC-specific inhibitors: GF 109203X, a competitive inhibitor of the
binding of ATP to nearly all PKCs, and Rottlerin, which shows some
specificity for inhibition of the PKC-
isoform (26, 29). These
results indicated that the PKC-
catalytic domain contains the
crucial determinants for 32D differentiation into mature macrophages.
Overexpressed PKC-
and -
induced differentiation of
TPA-treated 32D cells with different kinetics, however. The effect of
PKC-
lasted for 70 h, whereas PKC-
-overexpresses
retrodifferentiated after 20 h. Neither PKC-
nor -
were
down-regulated after 48 h of TPA treatment, so the reasons for the
more persistent effect of chimeric PKC-
are not clear.
Although neither L
nor L
exhibited all the characteristics of
typical macrophages after TPA treatment, some effects were seen in
these 32D derivatives that overexpressed PKC-
and PKC-
. Like
L
and L
, overexpression of PKC-
induced a slight
macrophage-like morphology in the absence of TPA, which could be
abolished using the PKC inhibitor GF109203X, although unlike L
and
L
, no further changes were seen upon TPA treatment. In contrast,
the morphology of L
, in the presence or absence of TPA, was no
different from that of wild-type 32D cells. This suggests that the
regulatory domain of PKC-
may also make a contribution to the
expression of macrophage differentiation markers, but it is minor
compared to that of the catalytic domain.
The slight macrophage morphology noted in both untreated chimeras may
be the result of two different mechanisms. That of L
seems to be
the result of an imperfect fit between the chimeric regulatory and
catalytic domains and the concomitant incomplete inhibition of the
kinase domain of one isozyme by the regulatory domain of another
isozyme, which may also explain the relatively high phagocytic activity
in L
in the absence of TPA treatment. However, this explanation
would not hold for L
, because the kinase domain of PKC-
does
not contribute to 32D differentiation. Instead, it may be that the
regulatory domain contributes to the expression of macrophage
morphology. A similar effect was seen in the lysozyme production by
untreated L
cells, although the level of lysozyme did increase in
the presence of TPA. Curiously, L
had a higher basal level of
lysozyme that did not increase in response to TPA. It is unclear at
present whether this result is unrelated to the overall process of
macrophage differentiation or may be the result of partial
differentiation.
Our experiments with PKC chimeras have demonstrated the predominant
role of the catalytic domain of PKC-
in induction of macrophage
differentiation. Several other studies have used a similar approach to
dissect isotype-specific PKC functions for other biological end points.
Catalytic domains were found to contain the determinants for
isotype-specific function in a study using chimeric proteins of
"classical" isoforms, PKC-
and -
II, in human
erythroleukemia cells (18). In another study, fusion of the regulatory
domain of PKC-
to the catalytic domain of PKC-
gave rise to a
chimera (17). Since the catalytic domain contains the substrate-binding
region, it was reasonable to predict that it may be more important than
the regulatory domain in determining the substrate specificity of
PKC-
, implicating the catalytic domain in this aspect of specifying
PKC isotype-specific functions. Our results are in agreement with this
assumption. However, the regulatory domain may also play important
roles in determining isozyme functions in other contexts. 1) PKC may
regulate signaling events through direct molecular interaction with
downstream effectors in addition to catalytic modification of proteins
by phosphorylation. The PKC-
regulatory domain was found to activate
phospholipase D in vitro through a direct protein-protein
interaction that is independent of the kinase activity of PKC-
(16).
2) A chimeric protein that contains the regulatory domain of PKC-
fused to the catalytic domain of PKC-
showed the substrate
specificity of PKC-
when expressed in COS1 cells (13). 3) Substrate
localization signals are responsible for bringing each PKC to its
appropriate intracellular compartment where different biochemical
events are occurring. Three localization signals have been identified
in the PKC-
regulatory domain that appear to determine whether this isozyme associates with the plasma membrane, the cytoskeleton, or the
Golgi apparatus (30). 4) A tyrosine phosphorylation site (Tyr-52) was
found in the PKC-
regulatory domain, which may be important in
determining isozyme-specific functions (15, 31). In the present 32D
system, lysozyme production and the altered morphology of untreated 32D
cells expressing
/
chimeras may be linked to the regulatory as
well as the catalytic domain of PKC-
. Thus, each isozyme-specific
function in each cell type must be analyzed to identify the structural
element responsible for it.
In conclusion, using chimeric molecules that were constructed by fusing
the regulatory domain and catalytic domain of two novel PKCs, PKC-
and -
, we demonstrated that the catalytic domain determined the bulk
of the ability of the chimeras to enable TPA to cause macrophage
differentiation in 32D cells. Further studies are needed to narrow down
the regions in the catalytic domain of PKC-
involved in regulating
cell differentiation. Moreover, our studies showed that the chimeric
approach remains an important tool in elucidating the structural basis
for isotype-specific functions of PKCs, and reciprocal swapping of
smaller regions may allow us to fine tune our structure/function
analysis.
Present address: Institute of Molecular Biology and Tumor
Genetics, GSF, Marchinioninistrasse 25, D-81377 Munich, Germany.
We thank Dr. Linda Wolff for the interleukin-3-producing WEHI 3 cell line, Drs. Zoltan Szallasi, Jacalyn Pierce, Weiqui Li, and Dr. Larisa Romanova for helpful discussions and Darren Henderson for constructive suggestions concerning lysate production and Western blotting.