JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liao, D.-F.
Right arrow Articles by Berk, B. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liao, D.-F.
Right arrow Articles by Berk, B. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 10, Issue of March 7, 1997 pp. 6146-6150
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Protein Kinase C-zeta Mediates Angiotensin II Activation of ERK1/2 in Vascular Smooth Muscle Cells*

(Received for publication, October 21, 1996, and in revised form, December 30, 1996)

Duan-Fang Liao , Brett Monia Dagger , Nicholas Dean Dagger and Bradford C. Berk §

From the Department of Medicine, Division of Cardiology, University of Washington, Seattle, Washington 98195 and Dagger  ISIS Pharmaceuticals, Carlsbad, California 92008

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
Acknowledgments
REFERENCES


ABSTRACT

Activation of 44 and 42 kDa extracellular signal-regulated kinases (ERK)1/2 by angiotensin II (angII) plays an important role in vascular smooth muscle cell (VSMC) function. The dual specificity mitogen-actived protein (MAP) kinase/ERK kinase (MEK) activates ERK1/2 in response to angII, but the MEK activating kinases remain undefined. Raf is a candidate MEK kinase. However, a kinase other than Raf appears responsible for angII-mediated signal transduction because we showed previously that treatment with 1 µM phorbol 12,13-dibutyrate (PDBU) for 24 h completely blocked Raf-Ras association in VSMC but did not inhibit activation of MEK and ERK1/2 by angII. We hypothesized that an atypical protein kinase C (PKC) isoform, which lacks a phorbol ester binding domain, mediated ERK1/2 activation by angII. Western blot analysis of rat aortic VSMC with PKC isoform-specific antibodies showed PKC-alpha , -beta 1, -delta , -epsilon , and -zeta in relative abundance. All isoforms except PKC-zeta were down-regulated by 1 µM PDBU for 24 h suggesting that PKC-zeta was responsible for angII-mediated ERK1/2 activation. In response to angII, PKC-zeta associated with Ras as shown by co-precipitation of PKC-zeta with anti-H-Ras antibody. To characterize further the role of PKC-zeta , PKC-zeta protein was depleted specifically by transfection with antisense PKC-zeta oligonucleotides. Antisense PKC-zeta oligonucleotide treatment significantly decreased PKC-zeta protein expression (without effect on other PKC isoforms) and angII-mediated ERK1/2 activation in a concentration-dependent manner. In contrast, ERK1/2 activation by platelet-derived growth factor and phorbol ester was not significantly inhibited. These results demonstrate an important difference in signal transduction by angII compared with PDGF and phorbol ester in VSMC, and suggest a critical role for PKC-zeta and Ras in angII stimulation of ERK1/2.


INTRODUCTION

Angiotensin II (angII)1 plays an important role in hypertrophic and hyperplastic growth of vascular smooth muscle cells (VSMC) (1, 2). It not only rapidly increases intracellular calcium and activates protein kinase C (PKC) but also stimulates many of the same signal transduction events as growth factors, including protein-tyrosine phosphorylation (3), stimulation of c-fos (4), and activation of mitogen-activated protein (MAP) kinases or extracellular-regulated signal kinases (ERK) (5). ERK1/2 are a family of serine/threonine protein kinases activated as an early response to a variety of stimuli involved in cellular growth, transformation, and differentiation. It appears likely that ERK1/2 activation is required for many of the effects of angII on gene expression, such as induction of c-fos and c-myc (6). Stimulation of ERK1/2 requires phosphorylation of a dual specific protein kinase, MAP kinase kinase or MEK, which is itself regulated by MEK kinase and/or Raf kinase. It has been suggested that Raf is phosphorylated in response to angII in mesangial cells (7), and Raf phosphorylation is potentially regulated by PKC (8). However, our previous experiments strongly indicated that Raf may not be the predominant MEK kinase responsible for angII stimulation of ERK1/2 (9). Specifically, we showed that angII-stimulated ERK1/2 activation was not inhibited by PKC down-regulation (1 µM PDBU for 24 h) while both Raf association with Ras, and Raf activation by angII, were inhibited by PKC down-regulation. In addition, angII-stimulated MEK kinase activity was significantly greater in Ras immunoprecipitates than in Raf immunoprecipitates. These results imply that a kinase other than Raf may be required for angII-mediated signal transduction via ERK1/2.

Several findings suggest that PKC-zeta may act as a MEK kinase. PKC-zeta has been shown to activate MEK kinase and ERK1/2 in vitro (10) and in vivo (11). In addition, PKC isoforms are serine/threonine kinases like Raf, and the protein structure of PKC-zeta closely resembles c-Raf-1 (12). Within the PKC family, PKC-zeta represents an atypical PKC isoform in that it lacks the C2 domain making its kinase activity Ca2+-independent, and it possesses only one zinc finger region in its regulatory domain (12). Consequently, PKC-zeta does not bind Ca2+ and cannot be activated by diacylglycerol or phorbol esters (13). In addition, prolonged treatment with phorbol esters does not down-regulate PKC-zeta (12, 14), and most PKC inhibitors do not decrease PKC-zeta activity (15).

In the present study, we investigated the role of PKC-zeta in agonist-mediated ERK1/2 activation. The results show that PKC-zeta associates with Ras in response to angII, and PDGF. Antisense PKC-zeta oligonucleotides decreased ERK1/2 activation by angII but had no significant effect on ERK1/2 activation by PDGF and PMA. These findings demonstrate for the first time a novel pathway for angII stimulation of ERK1/2 that is separate from PDGF and PMA, defined by a requirement for PKC-zeta association with Ras.


MATERIALS AND METHODS

Cell Culture

VSMC were isolated from 200-250 g male Harlan Sprague Dawley rats and maintained in 10% calf serum/Dulbecco's modified Eagle's medium (DMEM) as described previously (16). Passage 5 to 13 VSMC at 70-80% confluence in 100-mm dishes were growth arrested by incubation in 0.1% calf serum/DMEM for 48 h prior to use. Neonatal human VSMC, kindly provided by Drs. E. Raines and R. Ross at the University of Washington, were maintained in DMEM/F-12 supplemented with 10 µM TES, 50 µg/ml ascorbic acid, 10 µg/ml insulin, 10 µg/ml transferrin, 10 ng/ml sodium selenite, 30 µg/ml endothelial cell growth supplement, and 10% fetal bovine serum. Cells were growth arrested by incubation in DMEM medium with 1% platelet-depleted serum for 48 h.

Western Blot Analysis

After treatment, the cells were washed with phosphate-buffered saline (PBS), and 0.5 ml of TME lysis buffer (10 mM Tris, pH 7.5, 5 mM MgCl2, 1 mM EDTA, 25 mM NaF) containing fresh 100 µM Na3VO4, 20 µg/ml leupeptin, 1 µg/ml pepstatin A, 4 µg/ml aprotinin, and 1 mM DTT was added (17). Cell lysates were prepared by freezing, thawing on ice, scraping, Dounce homogenization (30 strokes), sonication for 1 s, and centrifugation for 30 min at 15,000 × g. Protein concentration in the supernatant was determined by Bradford protein assay, and the samples were stored at -80 °C. For Western blot analysis, 20 µg of protein was subjected to SDS-PAGE under reducing conditions, and proteins were then transferred to nitrocellulose (HybondTM-ECL, Amersham) as described previously (18). The membrane was blocked for 2 h at room temperature with a commercial blocking buffer from Life Technologies, Inc. The blots were incubated for 1 h at room temperature with the primary antibodies (PKC isoform-specific and c-Raf-1 antibodies from Santa Cruz Biotechnology, and H-Ras antibody from Boehringer Mannheim) followed by incubation for 1 h with secondary antibody (horseradish peroxidase-conjugated). Immunoreactive bands were visualized using chemiluminescence (ECL, Amersham International plc., United Kingdom).

Analysis of PKC-zeta Association with Ras

VSMC were lysed with TME lysis buffer, and the lysates were subjected to immunoprecipitation with anti-H-Ras antibody. Immune complexes were recovered by the addition of protein A-agarose (Life Technologies, Inc.), incubation overnight at 4 °C, and centrifugation. The beads were washed once with TME buffer, twice with TTBS buffer (20 mM Tris, pH 7.5, 500 mM NaCl, 1% Triton X-100, and 0.1% beta -mercaptoethanol), and once with TME buffer. Immunoprecipitated proteins were then electrophoresed on a 9% SDS-polyacrylamide gel, transferred to nitrocellulose, and proteins identified by ECL.

Transfection Protocol for Antisense PKC-zeta Oligonucleotides

Human vascular smooth muscle cells were plated in 6-well tissue culture dishes with DMEM/F-12 containing 10 µM TES, 50 µg/ml ascorbic acid, 10 µg/ml insulin, 10 µg/ml transferrin, 10 ng/ml sodium selenite, 30 µg/ml endothelial cell growth supplement, and 10% fetal bovine serum at 5 × 105 cells/well and grown overnight in a CO2 incubator at 37 °C to 70% confluence. Cells were washed once with pre-warmed PBS solution and once with Opti-MEM medium (Life Technologies, Inc.). A series of antisense oligonucleotides directed against the PKC-zeta were screened, and the most active sequences were identified as described (19). The PKC-zeta antisense oligonucleotide sequence was GACGCACGCGGCCTCACACC, and the scrambled oligonucleotide sequence was AAGCGCGCACCAGCGCCTCC. A complex of LipofectAMINE and oligonucleotides (2.5 µg/100 nM) in Opti-MEM was added directly to cells at a final concentration of 1000 nM oligonucleotide and incubated for 6 h at 37 °C (18). The transfection media was removed, and cells were washed once with PBS and refed with complete media. The cells were growth arrested by incubation in DMEM with 1% platelet-depleted serum for 48-96 h prior to agonist stimulation and prepared as described above for measuring protein expression and ERK1/2 activity. Preliminary experiments demonstrated that maximal depletion of PKC isoforms occurred at 96 h, consistent with the half-life of PKC (about 24 h) (20) and previous studies with antisense PKC oligonucleotides (21).

ERK 1/2 Kinase Assays

A myelin basic protein in-gel-kinase assay to measure ERK1/2 phosphotransferase activity was performed exactly as described previously (18). ERK1/2 activity was measured by densitometry of autoradiograms (in the linear range of film exposure) using NIH Image Version 1.59.

Statistical Analysis

Data are presented as mean ± S.E. for all experiments that were performed at least three times. Significant differences were determined by Student's t test (p < 0.05).


RESULTS

Effects of PDBU Treatment on ERK1/2 Activation and PKC Isoform Expression in VSMC

The goal of this study was to determine the role of specific PKC isoforms in activation of ERK1/2 by angII compared with PMA and PDGF. PKC has been suggested to be both "upstream" and "downstream" of ERK1/2 in signal transduction cascades (22, 23). To investigate which PKC isoforms were required for agonist-mediated activation of ERK1/2, phorbol ester-responsive PKC isoforms were down-regulated by PDBU (1 µM for 24 h), cells were stimulated for 5 min with 100 nM angII, 10 ng/ml PDGF, and 200 nM PMA, and ERK1/2 activity was determined by in-gel-kinase assay. All three agonists increased ERK1/2 activity (Fig. 1A, left). PDBU treatment caused no significant decrease in angII-stimulated ERK1/2 activity (Fig. 1A, right; 89 ± 11% of control at 5 min, n = 11, p > 0.1 versus control). In contrast, there was >70% inhibition of PDGF- and PMA-stimulated ERK1/2 activity (n = 5 and 8, respectively, p < 0.01). These results suggest that the classical and novel PKC isoforms, which are phorbol ester-responsive, are required for PDGF- and PMA-mediated ERK1/2 activation in VSMC. In contrast, if a PKC isoform is required for angII-mediated ERK1/2 activation, it must be an atypical isoform which is phorbol ester-unresponsive.


Fig. 1. PDBU treatment effect on ERK1/2 activity and expression of PKC isoforms. A, growth-arrested VSMC were stimulated with 10 ng/ml PDGF, 100 nM angII, or 200 nM PMA for 5 min, cells were harvested, and lysates were analyzed for ERK1/2 activity by in-gel-kinase assay. Arrows indicate the molecular masses of ERK1/2 (44 and 42 kDa, respectively). To down-regulate PKC, cells were treated with 1 µM PDBU for 24 h prior to stimulation (right lanes). B, growth-arrested VSMC were exposed to 1 µM PDBU for 24 h (or vehicle) to down-regulate PKC. Cells were harvested with TME buffer, and Western blot analysis was performed on whole cell lysates using PKC isoform-specific antibodies. Care was taken to ensure equal loading of cell protein, antibody dilutions, and ECL exposure. Asterisks indicate the position of the correct PKC isoform band based on molecular mass.
[View Larger Version of this Image (36K GIF file)]


To determine which PKC isoforms are expressed in VSMC, Western blot analysis with PKC isoform-specific antibodies was performed on whole cell lysates. VSMC express 5 different PKC isoforms in relative abundance, PKC-alpha , -beta 1, -delta , -epsilon , and -zeta (Fig. 1B). No significant immunoreactive PKC-beta 2, -gamma , -theta , -eta , or -lambda isoforms were detected. The upper band in the PKC-zeta Western blot is actually PKC-alpha that cross-reacts with the PKC-zeta antibody (24). Treating cells with PDBU (1 µM for 24 h) caused PKC-alpha , -beta 1, -delta , and -epsilon to be down-regulated completely while PKC-zeta was unaffected (Fig. 1B). Note that the PKC-alpha detected by the PKC-zeta antibody was completely down-regulated. These results are consistent with the described phorbol ester binding characteristics of the different PKC isoforms (25).

PDBU Treatment Inhibits angII-stimulated Ras-Raf Association but Not Ras-PKC-zeta Association

Activation of ERK1/2 by growth factors has been shown to require Raf interaction with membrane-bound Ras (26). We and other investigators have previously demonstrated that angII activates Ras (27), stimulates Raf association with Ras (27), and activates Raf in VSMC (9). In previous work (9), however, we showed that angII-stimulated association of Raf with Ras was blocked by PDBU treatment while ERK1/2 activation was not blocked. These results suggested that ERK1/2 activation occurred via a Raf-independent pathway as observed by other investigators for different agonists and cells (28-31). PKC-zeta is a candidate protein to mediate the Raf-independent pathway because PKC-zeta has recently been shown to stimulate MEK in vitro (10), to associate with Ras (32), and it is not down-regulated by PDBU treatment (Fig. 1B). To study the association of Ras with PKC-zeta , growth-arrested VSMC were stimulated with 100 nM angII, 200 nM PMA, and 10 ng/ml PDGF, H-Ras was immunoprecipitated, and Western blot analysis was performed with PKC-zeta antibody. Minimal amounts of PKC-zeta associated with H-Ras in unstimulated cells (Fig. 2A and B, Control). Treatment for 5 min with angII and PDGF caused PKC-zeta to associate with Ras. There was a dramatic increase in the association of PKC-zeta with Ras in response to angII as shown by Western blot analysis (Fig. 2A, compare lanes 1 and 2). PMA alone occasionally (1 of 3 experiments) caused a small increase in association. Treatment with 1 µM PDBU for 24 h completely depleted PKC-alpha but had no effect on PKC-zeta (Fig. 2A, compare lanes 5 and 6). In addition, it is clear that PKC-zeta , but not PKC-alpha , associated with Ras in response to agonists as only the lower immunoreactive band was observed in H-ras immunoprecipitates. This finding was confirmed by Western blot analysis of H-Ras immunoprecipitates with antibodies against the other four PKC isoforms present in VSMC (not shown).


Fig. 2. Effect of PDBU on association of PKC-zeta with Ras stimulated by angII, PMA, and PDGF. Growth-arrested VSMC were exposed to 100 nM angII, 200 nM PMA, or 10 ng/ml PDGF for 5 min and harvested with TME buffer. A, Ras was immunoprecipitated with anti-H-Ras antibody, the immunoprecipitates were size-fractionated by SDS-PAGE, and Western blot analysis was performed with anti-PKC-zeta antibody (left 4 lanes). Total cell lysates (TCL) were analyzed similarly but without immunoprecipitation. The upper band is cross-reacting PKC-alpha , which is down-regulated by PDBU treatment. B, to down-regulate PKC, cells were treated with 1 µM PDBU for 24 h. Ras was immunoprecipitated with anti-H-Ras antibody, the immunoprecipitates were size-fractionated by SDS-PAGE, and Western blot analysis was performed with anti-PKC-zeta antibody. C, growth-arrested cells were treated with PDBU or vehicle to down-regulate PKC and then exposed for 5 min to angII or PDGF. Cell lysates were prepared, Ras was immunoprecipitated with anti-H-Ras antibody, the immunoprecipitates were size-fractionated by SDS-PAGE, and Western blot analysis was performed with anti-c-Raf-1 antibody. D, to down-regulate PKC, cells were treated with 1 µM PDBU for 24 h. Cells were exposed to angII or PDGF, lysates were prepared, proteins were size-fractioned by SDS-PAGE, and Western blot analysis was performed with anti-c-Raf-1 antibody.
[View Larger Version of this Image (52K GIF file)]


PKC down-regulation by treatment with 1 µM PDBU did not prevent the association of PKC-zeta with H-Ras in cells stimulated by angII and PDGF (Fig. 2B, compare lanes 2 and 3 with lanes 5 and 6). In contrast, the association of Raf with Ras stimulated by angII and PDGF was significantly inhibited after treatment with PDBU (Fig. 2C), as previously reported (9). AngII-stimulated phosphorylation of Raf, which is reflected as the retardation of Raf electrophoretic mobility ("band shift") (3), was also blocked by PDBU treatment for 24 h (Fig. 2D, compare lanes 2 and 3 with lanes 5 and 6). These findings suggest that PKC-zeta may serve as the Ras-associated MEK kinase stimulated by angII in VSMC.

Antisense PKC-zeta Oligonucleotides Specifically Reduce PKC-zeta Protein Expression

To demonstrate further the role of PKC-zeta in ERK1/2 activation by angII, antisense PKC-zeta oligonucleotides and their corresponding scrambled controls were employed. Human VSMC were chosen for these experiments because the efficacy of antisense PKC-zeta oligonucleotides was defined based on human PKC-zeta mRNA and protein expression.2 Human VSMC were exposed to antisense PKC-zeta oligonucleotides for 6 h, and Western blot analyses for PKC-alpha , -delta , -epsilon , and -zeta were performed four days later. Protein levels for PKC-zeta were reduced in a concentration-dependent manner with reductions of 20%, 55%, and 70% at 100, 300, and 1,000 nM antisense PKC-zeta oligonucleotide, respectively (Fig. 3A). Scrambled PKC-zeta oligonucleotides had no effect on PKC-zeta expression at 1,000 nM. Expression of the PKC-alpha , -delta , and -epsilon isoforms was not affected by antisense or scrambled PKC-zeta oligonucleotides, indicating that the antisense PKC-zeta oligonucleotides were specific for PKC-zeta (Fig. 3B-D). Treatment with angII for 5 min had no effect on protein levels of PKC-alpha , -delta , -epsilon , and -zeta (compare lanes 1 and 2 in Fig. 3A-D).


Fig. 3. Antisense PKC-zeta oligonucleotides specifically decrease PKC-zeta expression. Human VSMC were treated with 100 nM angII for 5 min, with 1,000 nM scrambled PKC-zeta oligonucleotides, or with 100, 300, and 1,000 nM antisense PKC-zeta oligonucleotides as described under "Materials and Methods." Western blot analysis was then performed on whole cell lysates using PKC-alpha , -delta , epsilon , and -zeta antibodies.
[View Larger Version of this Image (52K GIF file)]


Antisense PKC-zeta Oligonucleotides Block angII-stimulated ERK1/2 Activation in Human VSMC

To determine the role of PKC-zeta in ERK1/2 activation by agonists, human VSMC treated with antisense or scrambled PKC-zeta oligonucleotides were exposed to angII, PDGF, and PMA 4 days after transfection. All three agonists stimulated ERK1/2 activity in these rapidly growing cells (Fig. 4A, compare lanes 2-4 with lane 1). The increase in ERK1/2 activity by the agonists ranged from 8- to 10-fold (Fig. 4C; n = 4). Scrambled PKC-zeta oligonucleotides had no apparent effect on ERK1/2 activity in either control unstimulated cells (Fig. 4A, compare lanes 1 and 5) or ang II-stimulated cells (Fig. 4A, compare lanes 3 and 6). Scrambled PKC-zeta oligonucleotides also had no effect on PKC-zeta protein expression (Fig. 4B). Analysis of multiple experiments showed that there was no significant effect of scrambled PKC-zeta oligonucleotides on angII-stimulated ERK1/2 activity (Fig. 4C; 9.1 ± 2.3-fold versus 8.6 ± 1.8-fold, n = 3, p > 0.1). Antisense PKC-zeta oligonucleotide treatment had no significant effect on ERK1/2 activity in control, unstimulated cells (Fig. 4A, compare lanes 1 and 7, and Fig. 4C). It should be noted that, at 1,000 nM antisense PKC-zeta oligonucleotides, there was significant but not complete inhibition of PKC-zeta expression (Fig. 4B). Higher oligonucleotide concentrations were not used because of cell toxicity. Antisense PKC-zeta oligonucleotide treatment did not significantly inhibit ERK1/2 activity in cells stimulated by PDGF and PMA (Fig. 4A, compare lanes 2 and 4 with lanes 8 and 10). However, ERK1/2 activity stimulated by angII was clearly inhibited by antisense PKC-zeta oligonucleotides (Fig. 4A, compare lanes 3 and 9). Analysis of multiple experiments indicated that ERK1/2 activation by angII was significantly inhibited by 48% (from 9.1 ± 2.3-fold to 4.5 ± 1.1-fold, p < 0.05, n = 3), respectively, while PDGF and PMA were not significantly inhibited (Fig. 4C). The extent to which antisense PKC-zeta oligonucleotides inhibited ang II-mediated ERK1/2 activation correlated well with the extent to which treatment inhibited PKC-zeta protein expression: reductions of 40%, 56%, and 66% in PKC-zeta expression resulted in inhibition of angII-stimulated ERK1/2 activity of 37%, 46%, and 61%, respectively. Additional controls for the specificity of the antisense PKC-zeta oligonucleotides were the findings that the activity of a 90-kDa kinase (Fig. 4A) and the expression of PKC-alpha (Fig. 4B) remained unaffected. These findings indicate that PKC-zeta is required for ERK1/2 activation by angII, but not by PDGF and PMA, in VSMC.


Fig. 4. Antisense PKC-zeta oligonucleotides inhibit ERK1/2 activation by angII but not by PMA and PDGF. A, human VSMC were grown in DMEM/F-12 for 24 h to 70% confluence and then transfected with 1,000 nM antisense or scrambled PKC-zeta oligonucleotides as described under "Materials and Methods." After transfection, the cells were growth-arrested in DMEM supplemented with 1% platelet-depleted serum for 48 h and then treated with 10 ng/ml PDGF, 100 nM angII, or 200 nM PMA for 5 min. Cells were harvested, and cell lysates were analyzed for ERK1/2 activity by an in-gel-kinase assay. Arrows indicate the position of 44 and 42 kDa bands identified as ERK1/2. As a control for protein loading and nonspecific effects of oligonucleotides, an unidentified myelin basic protein kinase of ~90 kDa is also indicated. B, the same cell lysates used for in-gel-kinase assay were analyzed by Western blot with PKC-zeta antibody. C, the effect of antisense PKC-zeta oligonucleotides on ERK1/2 activation by AngII, PDGF, and PMA was determined on a relative basis. ERK1/2 activity was measured by densitometry of autoradiograms in the linear range of film development. The densities of 42 and 44 kDa ERK were measured together. The results for each experiment were normalized to the density of the control (1% serum) sample, which was arbitrarily adjusted to 1.0. Results are the mean ± S.E. of three to five determinations. *, p < 0.05 versus scrambled or without antisense.
[View Larger Version of this Image (40K GIF file)]



DISCUSSION

The major finding of this study is that PKC-zeta associates with Ras in an agonist-dependent manner and is required for activation of ERK1/2 by angII in VSMC. Data that support an essential role for PKC-zeta in angII-mediated signaling include the following. 1) PKC-zeta association with Ras was unaffected by PKC down-regulation (PDBU treatment for 24 h) as was ERK1/2 activation. 2) In contrast, translocation and association of Raf with Ras was inhibited by PKC down-regulation (9). 3) Specific depletion of PKC-zeta protein with antisense PKC-zeta oligonucleotides inhibited angII-mediated activation of ERK1/2, while scrambled PKC-zeta oligonucleotides showed no effect. 4) Work from the laboratory of Moscat has shown that PKC-zeta may function as a MEK kinase in vitro. Our results are the first to show that PKC-zeta , which is structurally related to Raf (12), may substitute functionally for Raf in vivo and suggest that PKC-zeta is a Ras-associated MEK kinase in VSMC.

Several investigators have showed that Raf phosphorylation is rapidly stimulated by angII, suggesting an important role for Raf in angII signal transduction (3, 7) (33). However, our previous investigations (9) indicate that angII stimulation of ERK1/2 occurs via a c-Raf-1 independent pathway as discussed above. In addition, we previously found that the magnitude of MEK kinase activity was significantly greater in Ras immunoprecipitates than in Raf immunoprecipitates. These findings suggested that MEK kinases other than Raf were stimulated by angII. We cannot be more definitive regarding the role of PKC-zeta as a MEK kinase because experiments in which PKC-zeta was immunoprecipitated after angII stimulation failed to show an increase in activity.3 The inability to demonstrate increased PKC-zeta activity is not unexpected given that its activation requires interactions with various phosphoinositides (13) and possible protein mediators (34) that may be removed during immunoprecipitation.

The mechanisms of PKC-zeta regulation are unclear (35). Phosphatidylinositol 3-kinase (PI 3-K) may regulate PKC-zeta by generation of activating molecules (e.g. PIP3) and/or by acting as a "linker" protein to bring PKC-zeta in contact with other activating molecules. It has been shown that PIP3, a PI 3-K product, is a PKC-zeta activator. Nakanishi et al. (13) showed that PIP3 potently and selectively activated PKC-zeta in the absence of phosphatidylserine and/or phosphatidylethanolamine but was much less effective in activating conventional PKC. PI 3-K consists of an 85-kDa regulatory subunit and a 110-kDa catalytic subunit (36) and interacts directly with Ras through its catalytic subunit and the effector site of Ras in a GTP-dependent manner (37) . Wortmannin has been shown to inhibit PI 3-K activity and block PDGF-mediated activation of ERK1/2 (38, 39), suggesting that PI 3-K activity is required for ERK1/2 activation. However, other investigators (40, 41) have found that PKC-zeta is activated by diacylglycerol and phosphatidylserine, suggesting multiple mechanisms for activation. In future work, we plan to identify the mechanism by which angII activates PKC-zeta , focusing on interactions with PI 3-K.

The results of the present study strongly support a role for PKC-zeta in angII-stimulated signal transduction. VSMC have been reported to express PKC-alpha , -beta , -delta , -epsilon , and -zeta (42), as confirmed in the present study. Our results are consistent with the reported characteristics of PKC-zeta (43) in that PKC-zeta was not down-regulated by PDBU, and PMA did not stimulate PKC-zeta association with Ras. Previous studies have shown that PKC is required for angII stimulation of Na+/H+ exchange (44), c-fos expression (4), and mitogen-activated protein kinase phosphatase-1 expression (18). Because these experiments used PDBU treatment to down-regulate PKC, it is likely that they were mediated by phorbol ester responsive PKC isoforms (PKC-alpha , -beta , -delta , or -epsilon ). The present study is thus the first to show a role for an atypical PKC isoform in angII signal transduction. Of interest, while angII signal transduction was significantly inhibited by antisense PKC-zeta oligonucleotides, there was only minimal effect on PDGF-stimulated ERK1/2 activity. It is possible that if PKC-zeta expression could have been inhibited by 100% that there may have been a larger effect on PDGF. In fact, Moscat and other laboratories have shown that PKC-zeta is involved in PDGF signal transduction pathway in several cell lines (32). The present findings indicate that, while PDGF stimulates association of PKC-zeta with Ras, PKC-zeta is not required for ERK1/2 activation by PDGF to the same extent as for angII. These results suggest a fundamental difference between the early events stimulated by angII and PDGF. Since angII causes primarily VSMC hypertrophy while PDGF causes primarily hyperplasia (45, 46), understanding differences in activation of PKC-zeta by these agonists may provide important insights into regulation of VSMC growth.


FOOTNOTES

*   This work was supported by grants from the National Institutes of Health.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§   Established Investigator of the American Heart Association.
   To whom correspondence should be addressed: University of Washington, Cardiology, Box 357710, Seattle, WA 98195-7710. Tel.: 206-685-6960; Fax: 206-616-1580; E-mail: bcberk{at}u.washington.edu.
1   The abbreviations used are: angII, angiotensin II; DMEM, Dulbecco's modified Eagle's medium; DTT, dithiothreitol; ERK, extracellular signal-regulated kinase; MAP, mitogen-activated protein; MEK, MAP kinase/ERK kinase; PAGE, polyacrylamide gel electrophoresis; PDBU, phorbol 12,13-dibutyrate; PDGF, platelet-derived growth factor; PKC, protein kinase C; PMA, phorbol 12-myristate 13-acetate; VSMC, vascular smooth muscle cell; TES, 2-{[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]amino}ethanesulfonic acid; PBS, phosphate-buffered saline; PI 3-K, phosphatidylinositol 3-kinase (PI 3-K).
2   B. Monia, unpublished results.
3   D.-F. Liao, B. Monia, N. Dean, and B. C. Berk, unpublished results.

Acknowledgments

We thank Arnold Baas and members of the Berk laboratory for helpful discussions.


REFERENCES

  1. Berk, B. C., Vekshtein, V., Gordon, H. M., and Tsuda, T. (1989) Hypertension 13, 305-314 [Abstract/Free Full Text]
  2. Daemen, M. J. A. P., Lombardi, D. M., Bosman, F. T., and Schwartz, S. M. (1991) Circ. Res. 68, 450-456 [Abstract/Free Full Text]
  3. Molloy, C. J., Taylor, D. S., and Weber, H. (1993) J. Biol. Chem. 268, 7338-7345 [Abstract/Free Full Text]
  4. Taubman, M. B., Berk, B. C., Izumo, S., Tsuda, T., Alexander, R. W., and Nadal-Ginard, B. (1989) J. Biol. Chem. 264, 526-530 [Abstract/Free Full Text]
  5. Duff, J. L., Berk, B. C., and Corson, M. A. (1992) Biochem. Biophys. Res. Commun. 188, 257-264 [CrossRef][Medline] [Order article via Infotrieve]
  6. Gille, H., Kortenjann, M., Thomae, O., Moomaw, C., Slaughter, C., Cobb, M. H., and Shaw, P. E. (1995) EMBO J. 14, 951-962 [Medline] [Order article via Infotrieve]
  7. Force, T., Kyriakis, J. M., Avruch, J., and Bonventre, J. V. (1991) J. Biol. Chem. 266, 6650-6656 [Abstract/Free Full Text]
  8. Kolch, W., Heidecker, G., Lloyd, P., and Rapp, U. R. (1991) Nature 349, 426-428 [CrossRef][Medline] [Order article via Infotrieve]
  9. Liao, D.-F., Duff, J. L., Daum, G., Pelech, S. L., and Berk, B. C. (1996) Circ. Res. 79, 1007-1014 [Abstract/Free Full Text]
  10. Diaz-Meco, M. T., Dominguez, I., Sanz, L., Dent, P., Lozano, J., Municio, M. M., Berra, E., Hay, R. T., Sturgill, T. W., and Moscat, J. (1994) EMBO J. 13, 2842-2848 [Medline] [Order article via Infotrieve]
  11. Berra, E., Diaz-Meco, M. T., Lozano, J., Frutos, S., Municio, M. M., Sanchez, P., Sanz, L., and Moscat, J. (1995) EMBO J. 14, 6157-6163 [Medline] [Order article via Infotrieve]
  12. Ono, Y., Fujii, T., Ogita, K., Kikkawa, U., Igarashi, K., and Nishizuka, Y. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 3099-3103 [Abstract/Free Full Text]
  13. Nakanishi, H., Brewer, K. A., and Exton, J. H. (1993) J. Biol. Chem. 268, 13-16 [Abstract/Free Full Text]
  14. Stephens, E. V., Kalinec, G., Brann, M. R., and Gutkind, J. S. (1993) Oncogene 8, 19-26 [Medline] [Order article via Infotrieve]
  15. Martiny-Baron, G., Kazanietz, M. G., Mischak, H., Blumberg, P. M., Kochs, G., Hug, H., Marme, D., and Schachtele, C. (1993) J. Biol. Chem. 268, 9194-9197 [Abstract/Free Full Text]
  16. Duff, J. L., Marrero, M. B., Paxton, W. G., Charles, C. H., Lau, L. F., Bernstein, K. E., and Berk, B. C. (1993) J. Biol. Chem. 268, 26037-26040 [Abstract/Free Full Text]
  17. Stokoe, D., Macdonald, S. G., Cadwallader, K., Symons, M., and Hancock, J. F. (1994) Science 264, 1463-1467 [Abstract/Free Full Text]
  18. Duff, J. L., Monia, B. P., and Berk, B. C. (1995) J. Biol. Chem. 270, 7161-7166 [Abstract/Free Full Text]
  19. Monia, B. P., Johnston, J. F., Ecker, D. J., Zounes, M. A., Lima, W. F., and Freier, S. M. (1992) J. Biol. Chem. 267, 19954-19962 [Abstract/Free Full Text]
  20. Woodgett, J. R., and Hunter, T. (1987) Mol. Cell. Biol. 7, 85-96 [Abstract/Free Full Text]
  21. Coleman, E. S., and Wooten, M. W. (1994) J. Mol. Neurosci. 5, 39-57 [Medline] [Order article via Infotrieve]
  22. Pelech, S. L., and Sanghera, J. S. (1992) Science 257, 1355-1356 [Free Full Text]
  23. Kolch, W., Heidecker, G., Kochs, G., Hummel, R., Vahidi, H., Mischak, H., Finkenzeller, G., Marme, D., and Rapp, U. R. (1993) Nature 364, 249-252 [CrossRef][Medline] [Order article via Infotrieve]
  24. Allen, B. G., Andrea, J. E., and Walsh, M. P. (1994) J. Biol. Chem. 269, 29288-29298 [Abstract/Free Full Text]
  25. Newton, A. C. (1995) J. Biol. Chem. 270, 28495-28498 [Free Full Text]
  26. Stokeo, D., Macdonald, S. G., Cadwallader, K., Symons, M., and Hancock, J. F. (1994) Science 364, 1463-1467
  27. Marrero, M. B., Schieffer, B., Paxton, W. G., Heerdt, L., Berk, B. C., Delafontaine, P., and Bernstein, K. E. (1995) Nature 375, 247-250 [CrossRef][Medline] [Order article via Infotrieve]
  28. Chao, T.-S. O., Foster, D. A., Rapp, U. R., and Rosner, M. R. (1994) J. Biol. Chem. 269, 7337-7341 [Abstract/Free Full Text]
  29. Winston, B. W., Lange, C.-C. A., Gardner, A. M., Johnson, G. L., and Riches, D. W. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 1614-1618 [Abstract/Free Full Text]
  30. Faure, M., and Bourne, H. R. (1995) Mol. Biol. Cell 6, 1025-1035 [Abstract]
  31. Zheng, C. F., Ohmichi, M., Saltiel, A. R., and Guan, K. L. (1994) Biochemistry 33, 5595-5599 [CrossRef][Medline] [Order article via Infotrieve]
  32. Diaz-Meco, M. T., Lozano, J., Municio, M. M., Berra, E., Frutos, S., Sanz, L., and Moscat, J. (1994) J. Biol. Chem. 269, 31706-31710 [Abstract/Free Full Text]
  33. Butcher, R. D., Schollmann, C., and Marme, D. (1993) Biochem. Biophys. Res. Commun. 196, 1280-1287 [CrossRef][Medline] [Order article via Infotrieve]
  34. Dominguez, I., Diaz-Meco, M. T., Municio, M. M., Berra, E., Garcia de Herreros, A., Cornet, M. E., Sanz, L., and Moscat, J. (1992) Mol. Cell. Biol. 12, 3776-3783 [Abstract/Free Full Text]
  35. Berra, E., Diaz-Meco, M. T., Dominguez, I., Municio, M. M., Sanz, L., Lozano, J., Chapkin, R. S., and Moscat, J. (1993) Cell 74, 555-563 [CrossRef][Medline] [Order article via Infotrieve]
  36. Hiles, I. D., Otsu, M., Volinia, S., Fry, M. J., Gout, I., Dhand, R., Panayotou, G., Ruiz-Larrea, F., Thompson, A., Totty, N. F., et al. (1992) Cell 70, 419-429 [CrossRef][Medline] [Order article via Infotrieve]
  37. Rodriguez-Viciana, P., Warne, P. H., Dhand, R., Vanhaesebroeck, B., Gout, I., Fry, M. J., Waterfield, M. D., and Downward, J. (1994) Nature 370, 527-532 [CrossRef][Medline] [Order article via Infotrieve]
  38. Choudhury, G. G., Biswas, P., Grandaliano, G., Fouqueray, B., Harvey, S. A., and Abboud, H. E. (1994) Kidney Int. 46, 37-47 [Medline] [Order article via Infotrieve]
  39. Escobedo, J. A., Kaplan, D. R., Kavanaugh, W. M., Turck, C. W., and Williams, L. T. (1991) Mol. Cell. Biol. 11, 1125-1132 [Abstract/Free Full Text]
  40. Toker, A., Meyer, M., Reddy, K. K., Falck, J. R., Aneja, R., Aneja, S., Parra, A., Burns, D. J., Ballas, L. M., and Cantley, L. C. (1994) J. Biol. Chem. 269, 32358-32367 [Abstract/Free Full Text]
  41. Gschwendt, M., Leibersperger, H., Kittstein, W., and Marks, F. (1992) FEBS Lett. 307, 151-155 [CrossRef][Medline] [Order article via Infotrieve]
  42. Dixon, B. S., Sharma, R. V., Dickerson, T., and Fortune, J. (1994) Am. J. Physiol. 266, C1406-C1420 [Abstract/Free Full Text]
  43. Ways, D. K., Cook, P. P., Webster, C., and Parker, P. J. (1992) J. Biol. Chem. 267, 4799-4805 [Abstract/Free Full Text]
  44. Berk, B. C. (1996) in J. Biol. Chem.The Na+/H+ Exchanger (Fliegel, L., ed), pp. 47-67, R. G. Landes Company, Austin, TX
  45. Geisterfer, A. A. T., Peach, M. J., and Owens, G. K. (1988) Circ. Res. 62, 749-756 [Abstract/Free Full Text]
  46. Berk, B. C., and Rao, G. N. (1993) J. Cell. Physiol. 154, 368-380 [CrossRef][Medline] [Order article via Infotrieve]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Cardiovasc ResHome page
M. Das, N. Burns, S. J. Wilson, W. M. Zawada, and K. R. Stenmark
Hypoxia exposure induces the emergence of fibroblasts lacking replication repressor signals of PKC{zeta} in the pulmonary artery adventitia
Cardiovasc Res, June 1, 2008; 78(3): 440 - 448.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
F. Xiao, J. R Puddefoot, S. Barker, and G. P Vinson
Changes in angiotensin II type 1 receptor signalling pathways evoked by a monoclonal antibody raised to the N-terminus
J. Endocrinol., April 1, 2008; 197(1): 25 - 33.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
E. R. Olson, P. E. Shamhart, J. E. Naugle, and J. G. Meszaros
Angiotensin II-Induced Extracellular Signal-Regulated Kinase 1/2 Activation Is Mediated by Protein Kinase C{delta} and Intracellular Calcium in Adult Rat Cardiac Fibroblasts
Hypertension, March 1, 2008; 51(3): 704 - 711.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
P. Rose, J. Bond, S. Tighe, M. J. Toth, T. L. Wellman, E. M. B. de Montiano, M. M. Lewinter, and K. M. Lounsbury
Genes overexpressed in cerebral arteries following salt-induced hypertensive disease are regulated by angiotensin II, JunB, and CREB
Am J Physiol Heart Circ Physiol, February 1, 2008; 294(2): H1075 - H1085.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
H. Nakashima, G. D. Frank, H. Shirai, A. Hinoki, S. Higuchi, H. Ohtsu, K. Eguchi, A. Sanjay, M. E. Reyland, P. J. Dempsey, et al.
Novel Role of Protein Kinase C-{delta} Tyr311 Phosphorylation in Vascular Smooth Muscle Cell Hypertrophy by Angiotensin II
Hypertension, February 1, 2008; 51(2): 232 - 238.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. Yogi, G.E. Callera, A.C.I. Montezano, A.B. Aranha, R.C. Tostes, E.L. Schiffrin, and R.M. Touyz
Endothelin-1, but not Ang II, Activates MAP Kinases Through c-Src-Independent Ras-Raf-Dependent Pathways in Vascular Smooth Muscle Cells
Arterioscler. Thromb. Vasc. Biol., September 1, 2007; 27(9): 1960 - 1967.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
M. J. Haurani and P. J. Pagano
Adventitial fibroblast reactive oxygen species as autacrine and paracrine mediators of remodeling: Bellwether for vascular disease?
Cardiovasc Res, September 1, 2007; 75(4): 679 - 689.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
P. K. Mehta and K. K. Griendling
Angiotensin II cell signaling: physiological and pathological effects in the cardiovascular system
Am J Physiol Cell Physiol, January 1, 2007; 292(1): C82 - C97.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
M. D. Godeny and P. P. Sayeski
ANG II-induced cell proliferation is dually mediated by c-Src/Yes/Fyn-regulated ERK1/2 activation in the cytoplasm and PKC{zeta}-controlled ERK1/2 activity within the nucleus
Am J Physiol Cell Physiol, December 1, 2006; 291(6): C1297 - C1307.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J.-H. Parmentier, C. Zhang, A. Estes, S. Schaefer, and K. U. Malik
Essential role of PKC-{zeta} in normal and angiotensin II-accelerated neointimal growth after vascular injury
Am J Physiol Heart Circ Physiol, October 1, 2006; 291(4): H1602 - H1613.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J.-H. Parmentier, Z. Pavicevic, and K. U. Malik
ANG II stimulates phospholipase D through PKC{zeta} activation in VSMC: implications in adhesion, spreading, and hypertrophy
Am J Physiol Heart Circ Physiol, January 1, 2006; 290(1): H46 - H54.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. Tan, X. Xu, M. Ohba, and M.-Z. Cui
Angiotensin II-Induced Protein Kinase D Activation Is Regulated by Protein Kinase C{delta} and Mediated via the Angiotensin II Type 1 Receptor in Vascular Smooth Muscle Cells
Arterioscler. Thromb. Vasc. Biol., December 1, 2004; 24(12): 2271 - 2276.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Lee, J.-Y. Kim, and W. B. Anderson
Src Tyrosine Kinase Inhibitor PP2 Markedly Enhances Ras-independent Activation of Raf-1 Protein Kinase by Phorbol Myristate Acetate and H2O2
J. Biol. Chem., November 19, 2004; 279(47): 48692 - 48701.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Adachi, D. R. Pimentel, T. Heibeck, X. Hou, Y. J. Lee, B. Jiang, Y. Ido, and R. A. Cohen
S-Glutathiolation of Ras Mediates Redox-sensitive Signaling by Angiotensin II in Vascular Smooth Muscle Cells
J. Biol. Chem., July 9, 2004; 279(28): 29857 - 29862.
[Abstract] [Full Text] [PDF]