|
Volume 272, Number 10,
Issue of March 7, 1997
pp. 6799-6804
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
Cytokinin Induction of RNA Polymerase I Transcription in
Arabidopsis thaliana*
(Received for publication, August 26, 1996, and in revised form, November 20, 1996)
Reginald J.
Gaudino
and
Craig S.
Pikaard
From the Biology Department, Washington University, St.
Louis, Missouri 63130
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
Acknowledgments
REFERENCES
ABSTRACT
RNA polymerase I (pol I) transcribes the repeated
genes that encode the precursor of 17-18, 5.8, and 25-28 S ribosomal
RNA (rRNA). Pol I transcription is up-regulated in growing cells and down-regulated in quiescent cells, presumably reflecting the demand for
ribosomes and protein synthesis. However, the signal transduction pathways responsible for pol I regulation are poorly understood. We
tested the effects of exogenously applied plant hormones on promoter-dependent rRNA transcription in Arabidopsis
thaliana. Gibberellic acid, abscisic acid, auxin, and ethylene
had no detectable effect on rRNA transcription, but kinetin (a
cytokinin) stimulated rRNA transcription within 1 h of treatment.
Increased steady-state levels of accurately initiated rRNA transcripts,
detected by S1 nuclease protection, were paralleled by increased levels
of nascent rRNA transcripts in isolated nuclei. Therefore, the primary
effect of cytokinin appears to be at the level of transcription
initiation rather than rRNA stability. Pol I accounts for ~34% of
total nuclear transcription in untreated plants and ~60% following
cytokinin treatment. The specific responsiveness of pol I transcription to kinetin suggests that cytokinins may act as general regulators of
protein synthetic capacity and growth status in plant cells.
INTRODUCTION
Eukaryotes have evolved three nuclear RNA polymerases with
specialized functions. RNA polymerase I transcribes the tandemly repeated genes encoding the precursor of 17-18, 5.8, and 25-28 S
ribosomal RNA (1-3) (rRNA size varies with species).
Pol1 II transcribes protein-coding genes
and most small nuclear RNAs (4-6), and pol III transcribes 5 S rRNA,
tRNAs, and one or more small nuclear RNAs (6-8). All three polymerases
are needed to produce the rRNAs and proteins of a functional ribosome
(9, 10), although the rRNAs transcribed by pol I are thought to comprise the ribosome's catalytic core (11).
Ribosomal RNA transcription and cell growth rate tend to be positively
correlated (12-16). In Escherichia coli and other
prokaryotes, the cellular concentration of guanosine tetraphosphate
(ppGpp), reflects the level of rRNA transcription, although cause and
effect are unclear (17). In eukaryotes, there is no strong evidence for
an analogous compound. However, as in prokaryotes, rRNA transcription is down-regulated upon nutritional challenge (amino acid, carbon, or
nitrogen limitation; serum starvation), cycloheximide treatment, or
upon reaching stationary phase (18-24; recently reviewed in Ref. 12).
Glucocorticoid hormones have also been shown to stimulate or repress
pol I transcription in different tissues (25-28). These physiological
responses appear to be brought about by phosphorylation or other
modifications of the polymerase or its auxiliary transcription factors
(21, 22, 29-31), but the causative signal transduction pathways remain
obscure.
Using the model plant species, Arabidopsis thaliana, we have
begun to define the rRNA gene loci and cis-acting DNA sequences essential for accurate pol I transcription initiation (32-36). Recent
progress toward dissecting hormone signaling pathways in A. thaliana prompted us to investigate reports that plant hormones such as auxin and cytokinin affect pol I activity in cell-free extracts, isolated chromatin, or nuclei (37-41). Consequently, we
examined hormonal effects on transcription initiation at the rRNA gene
promoters as well as elongation of nascent rRNA transcripts. We show
that exogenous cytokinin induces pol I transcription within 1 h of
treatment, and the stimulatory effect persists for at least 24 h.
The effect of cytokinin on rRNA transcription is consistent with its
role in growth regulation and cell division.
EXPERIMENTAL PROCEDURES
Sterile Growth of Arabidopsis Seedlings
A.
thaliana Columbia seeds were sterilized in 95% ethanol (five
washes, 5 min each), followed by 3% sodium hypochlorite wash (10 min)
and three washes in sterile distilled water (5 min each). Seeds were
recovered by filtration (Nalgene sterile filter unit) and dried for 2 days in a desiccator containing sterile Dri-Rite. Approximately 100 seeds were sprinkled onto semisolid germination medium (42) in 75-mm
diameter Petri dishes. Seeds were germinated and plantlets grown for
14-21 days in a growth chamber (16 h day length, 22 °C, 70%
relative humidity) prior to hormone treatment.
Hormone Treatment of Plants
Plant hormones were purchased
from Sigma and dissolved as 0.1 M - 0.2 M
stocks. Kinetin was initially dissolved in 1 N NaOH then
diluted with water to 0.1 M. Stocks of abscisic acid,
gibberellic acid, and 2,4-dichlorophenoxyacetic acid were prepared in
100% ethanol. All hormone stocks were made just prior to use and
filter-sterilized. Plants were sprayed to run-off with a fine mist,
essentially according to Guilfoyle (37) and harvested by pulling them
from the agar with forceps. Plantlets were frozen in liquid nitrogen
for RNA isolation or homogenized immediately for nuclei isolation.
RNA Isolation
For S1 nuclease assays, RNA was isolated
according to Chirgwin et al. (43) with minor modifications.
RNA was resuspended in 400 µl of diethyl pyrocarbonate-treated water
and extracted twice with an equal volume of phenol:chloroform:isoamyl
alcohol (25:24:1; v/v) followed by extraction with 1 volume of
chloroform:isoamyl alcohol (24:1, v/v). Sodium acetate (pH 5.2) was
added to 0.25 M and nucleic acids precipitated by addition
of 2.5 volumes of 100% ethanol and centrifugation at 14,000 × g for 20 min (4 °C). Pellets was resuspended in 300 µl
of diethyl pyrocarbonate-treated water followed by addition of 600 µl
of ice-cold 4 M lithium chloride to precipitate RNA. Tubes
were vortexed and incubated overnight on ice. Following centrifugation
as above, pellets were resuspended in 100 µl of diethyl
pyrocarbonate-treated water and quantified by absorbance at 260 nm. All
RNA samples were also checked by agarose gel electrophoresis and
ethidium bromide staining to verify their quality and equivalent
concentrations.
S1 Nuclease Protection
rRNA transcripts were detected using
S1 nuclease protection (44) and 5 end-labeled probes as described
previously (32, 33). Ribulose-1,5-bisphosphate
carboxylase/oxygenase (Rubisco) small subunit mRNAs were detected
using an oligonucleotide perfectly complementary to the A. thaliana Ats3B clone, but capable of hybridizing to transcripts of
all four (known) genes (45). The sequence of the oligonucleotide is 5
CCACAGCGGCGGAGGAGAGCATAGAGGAAGCCATTACTACTTCTTGTTG 3 ;
the underlined nucleotides at the 3 end are not homologous to any
Rubisco mRNAs and are removed by S1 nuclease, discriminating the
longest protected fragments from undigested probe.
Nuclei Isolation
Nuclei were isolated according to Feinbaum
and Ausubel (46, 47) with modifications. Arabidopsis plants
(~800) were harvested from 8 to 10 agar plates, washed in ice-cold
sterile water, and kept at 4 °C. Plants were submerged in cold
diethyl ether for 5 min, then washed twice (5 min each) in ice-cold
sterile water. Plants were homogenized in 100 ml (approximately 3 volumes) of nuclei isolation buffer (1 M sucrose, 50 mM Tris-HCl (pH 7.2), 5 mM MgCl2, 5 mM KCl2, 10 mM 2-mercaptoethanol,
0.2 mM PMSF) with a motorized homogenizer (Fisher
Scientific Powergen 700). The homogenate was filtered through eight
layers of cheesecloth, one layer of Miracloth (Calbiochem), and one
layer of 50-µm nylon mesh. The filtrate was centrifuged at
14,000 × g for 15 min at 4 °C. The pellet was
resuspended in 10 ml of nuclei isolation buffer using a 15-ml Dounce
homogenizer (A pestle), and the final volume was measured. One volume
of "100%" Percoll solution (34.23 g of sucrose, 5 ml of 1 M Tris-HCl (pH 7.2), 0.5 ml of 1 M
MgCl2, 0.5 ml 1 M KCl, 34 µl of
2-mercaptoethanol, 100 µl of 2 mM PMSF, and Percoll to
100 ml) was added to 19 volumes of nuclei. 7 ml of crude nuclei in 5%
Percoll solution was then layered onto a four-step discontinuous
Percoll gradient with 5-ml layers of 15, 30, 45, and 60% Percoll
solutions (diluted from the 100% Percoll solution using nuclei
isolation buffer). Gradients were centrifuged at 2000 rpm for 10 min,
then 8000 rpm for 20 min in a Beckman SW 28 rotor at 4 °C. Nuclei
were harvested from the 30%/45% and 45%/60% boundaries and pooled
as both were found to be transcriptionally equivalent. Nuclei were
diluted with 5 volumes of nuclei isolation buffer, mixed by inversion,
and collected by centrifugation at 1500 × g, 10 min,
4 °C in a clinical centrifuge (Beckman). Nuclei were resuspended
gently in 50 ml (approximately 25 volumes) of nuclei isolation buffer
and again collected by centrifugation. Final resuspension was in 1 ml
of nuclei storage buffer (50 mM HEPES (pH 7.2), 5 mM MgCl2, 5 mM KCl, 2 mM dithiothreitol, 0.2 mM PMSF, 50% glycerol).
Aliquots were transferred to prechilled 1.5-ml microcentrifuge tubes,
frozen in liquid nitrogen, and stored at 80 °C.
Nuclear Run-on
Frozen nuclei were thawed on ice, stained
with 4 ,6-diamidino-2-phenylindole, and counted in a hemacytometer
using fluorescence microscopy. Nuclear run-ons for filter
hybridizations involved 1 × 106 nuclei; for total
incorporation experiments, 1 × 105 nuclei were used.
All nuclear run-on reactions were for 10 min (unless otherwise stated)
at 30 °C in a final volume of 50 µl (40 µl of run-on reaction
buffer, 10 µl of nuclei). Nuclear run-on reaction buffer was: 50 mM Tris-HCl (pH 7.2), 5 mM MgCl2, 5 mM KCl, 75 mM
(NH4)2SO4, 1 mM
MnCl2, 300 µM each ATP, GTP, and UTP, 4.5 µM CTP, 0.5 µM [ -32P]CTP,
5 mM dithiothreitol, 0.2 mM PMSF, 2 units of
RNasin RNase inhibitor (Promega), 10% glycerol, and 150 µg/ml
-amanitin (increasing the amanitin level to 500 µg/ml was found to
have no additional effect). 5 units of RNase-free DNase (Promega RQ1
DNase) was then added and the incubation continued 10 min. 250 µl of
2 mg/ml Pronase, 1% SDS was added, and reactions were incubated for 30 min at 55 °C. Reactions were extracted twice with phenol/chloroform
and once with chloroform. Ammonium acetate was added to a final
concentration of 2 M, and RNA was precipitated with 2.5 volumes of ice-cold 100% ethanol. Following centrifugation, RNA was
pelleted and washed twice with 70% ethanol. Dried pellets were
resuspended in filter hybridization solution, formamide RNA loading
buffer, or TE (10 mM Tris-HCl, 0.1 mM EDTA) (pH
7.2) for hybridization, polyacrylamide gel electrophoresis, or
scintillation counting, respectively.
Contribution of Pol I to Total Nuclear
Transcription
Nuclear run-ons using 1 × 105
nuclei were performed in the presence of 0 or 150 µg/ml -amanitin
(Sigma). Purified RNA was resuspended in 10 µl of TE
(pH 7.2) and spotted onto DE81 paper (Whatman; ~1 cm2).
Filters were washed five times in 300 ml of 5%
Na2HPO4 and twice with 250 ml of sterile
Milli-Q water. Washes were at room temperature, 5 min each. Filters
were rinsed briefly in 100% ethanol to aid drying. After air-drying,
filters were subjected to liquid scintillation counting.
Filter Hybridizations for Nuclear Run-on Experiments
435
µg of plasmid DNA (with or without cloned rDNA) was denatured for 10 min in 40 ml of boiling 0.4 M NaOH and loaded onto a 44-mm
diameter circle of Zeta-Probe (Bio-Rad) nylon membrane by vacuum
filtration in a Millipore filter apparatus. A wash with 40 ml of 0.4 M NaOH was followed by two washes with 200 ml of sterile
water. DNA was covalently cross-linked to the membrane using UV light
(Bio-Rad Gene Linker GS; program C1). Filters were neutralized with 1.5 M NaCl, 0.5 M Tris-HCl (pH 7.2) and rinsed in
water. Circular filters of ~7-mm diameter were cut from the large
filter using a sterilized hole punch. Each filter contained ~15 µg
of DNA. Filters were coded for later identification and were stored
under vacuum.
Filters were prewetted with sterile water and submerged in 0.4-0.6 ml
of hybridization solution (50% deionized formamide, 5 × Denhardt's solution, 5 × SSC, 10 mM EDTA, 0.25%
SDS, 50 µg/ml yeast tRNA) in 15-ml plastic snap-cap tubes for 1 h at 43 °C. Each 15-ml tube contained a plain filter (no DNA), two
filters with pBluescript (Stratagene) plasmid DNA, and two filters with cloned rRNA gene sequences (essentially a complete gene cloned in
pBluescript). Radioactive RNA from a nuclear run-on reaction was
resuspended in 200 µl of hybridization solution, denatured at
65 °C, 10 min and added to a tube with a set of filters.
Hybridization reactions were incubated overnight at 43 °C. Filters
were rinsed in 2 × SSC, incubated in 20 µg/ml RNase A (in
2 × SSC) at 30 °C for 30 min to remove unhybridized RNA, then
washed at high stringency (0.2 × SSC, 0.1% SDS, 65 °C, 1 h). Filters were subjected to autoradiography and quantitation by
phosphorimaging (Molecular Dynamics).
RESULTS
The A. thaliana rRNA gene promoter is located within
the intergenic spacer approximately 2 kilobases upstream of the 18 S coding sequences (Fig. 1). Noncoding sequences are
removed in several processing steps, the first involving cleavage
within the external transcribed spacer (ETS) (9, 48, 49). ETS processing occurs rapidly and is thought to be a co-transcriptional event (50-55). The promoter-proximal ETS RNA is then rapidly degraded, unlike coding sequences which can have half-lives longer than a cell
cycle. Because ETS RNA does not accumulate, steady-state levels of
transcripts just downstream of the promoter are expected to closely
reflect rRNA gene transcription activity. Consequently, we measured
transcripts accurately initiated at +1 to initially survey plant
hormones for effects on rRNA gene transcription.
Fig. 1.
Diagram of an A. thaliana rRNA
gene. The gene promoter, spacer promoters, and ETS processing site
are highlighted. The repetitive elements between the gene and spacer
promoters are thought to be transcriptional enhancers (32). The ETS
processing site has been mapped to a position approximately 500 base
pair upstream of the 18 S coding sequences (Z. Ye and C. S. Pikaard, unpublished data.).
[View Larger Version of this Image (11K GIF file)]
Aqueous solutions of gibberellic acid, 2,4-dichlorophenoxyacetic acid,
abscisic acid, and kinetin were sprayed onto 3-week-old A. thaliana plantlets until run-off, according to the experimental protocol of Guilfoyle (37). Concentrations tested ranged from 10 7 to 10 3 M. Ethylene was also
tested by gassing plants at 10-60 ppm in a specially designed chamber
(with the kind assistance of Dr. Harry Klee and the Monsanto Company,
St. Louis, MO). RNA was isolated from control and treated plants at
various times after treatment, and rRNA transcripts were detected using
S1 nuclease protection as described previously (32, 33). Only cytokinin
exerted a response in this initial survey (data not shown).
Cytokinin treatment induced nascent rRNA transcripts in a dose- and
time-dependent manner (Fig. 2). Six hours
after treatment, transcript levels were increased by kinetin at
concentrations of 10 5 M or higher (Fig.
2A, lanes 3-6), reaching their maximum with 10 3 M exogenous hormone (lane 5).
However, if RNA was isolated 12 or 24 h following treatment, an
effect was discerned at concentrations as low as 10 6
M (lane 2). Note that these are the
concentrations sprayed onto the exposed upper surfaces of the plants;
internal concentrations are expected to be at least 100-fold lower
based on surface area to volume estimations. Maximal induction of
accurately initiated rRNA transcripts was approximately 6-fold and was
observed 24 h after treatment at the highest kinetin
concentrations (Fig. 2A, lanes 5 and 6).
Fig. 2.
Steady-state levels of accurately initiated
rRNA transcripts increase in a time- and dosage-dependent
manner following a single kinetin treatment. A,
sterile-grown Arabidopsis plants were sprayed to run-off
with the indicated concentrations of kinetin. Mock-treated plants were
sprayed with a solution lacking hormone. 6, 12, or 24 h later, RNA
was isolated, and nascent rRNA transcripts were detected by S1 nuclease
protection using a 5 end-labeled probe spanning the promoter region
( 520 to +92, labeled at +92; see Fig. 1 for the position of the
probe). The same amount of total RNA (15 µg) was probed for each
treatment. The panels shown are from the same autoradiographic exposure
of the same gel. S1 signals were also quantified by phosphorimaging;
the -fold increase over the mock-treated plants is shown below each
lane. The signal in the 24-h, 10 5 M kinetin
treatment (marked with an asterisk below the lane) is low
due to a pinched well in the acrylamide gel and loss of part of the
sample during loading; no quantitation is provided for this one lane.
B, ribosomal RNA and Rubisco transcript levels respond
differently to kinetin treatment. Total RNA isolated from plants
12 h after spraying with various kinetin concentrations was
hybridized to the rRNA gene promoter probe or to an oligonucleotide probe designed to hybridize to transcripts of the Rubisco gene family.
The multiple S1 nuclease-protected bands observed with the Rubisco
probe are as expected based on the positions where mRNA sequences
of the different family members diverge from the probe sequence in
their 5 -untranslated region.
[View Larger Version of this Image (41K GIF file)]
The experiment of Fig. 2A showed that pre-rRNA transcripts
increase within a fixed amount of total RNA in response to cytokinin. However, because ~80% of total RNA is ribosomal RNA coding
sequences, our estimates of cytokinin responsiveness would be
underestimates if the total ribosome pool were increased by cytokinin.
At early time points, the ribosome pool is so large that such effects
might not be significant. Nonetheless, we compared transcription
initiation from the rRNA gene promoters to initiation from promoters of
the Rubisco small subunit gene family, among the most highly expressed genes in green leaves. rRNA and ribulose bisphosphate carboxylase gene
promoters showed different responsiveness to kinetin treatment (Fig.
2B). Whereas nascent rRNA transcript levels were increased severalfold per unit of total RNA in response to increased exogenous cytokinin concentrations (lanes 2-6), transcripts from the
Rubisco gene family were unaffected or reduced at high concentrations. The decrease in Rubisco transcripts could be due to a
kinetin-dependent inhibition of transcription, as reported
for phytochrome mRNA (56), or a decrease in Rubisco RNA relative to
the total RNA pool. Nonetheless, the data suggest that increased
steady-state levels of rRNA transcripts is not part of a general
positive response to cytokinin.
Although steady-state levels of nascent rRNA transcripts are thought to
reflect transcription rates, due to the rapid turnover of ETS
sequences, this has not been demonstrated in plants. Therefore, we also
performed transcription run-on assays with nuclei of control and
hormone treated plants (Fig. 3). Plants were again
mock-treated (solution lacking hormone) or sprayed with various
concentrations of cytokinin. Twelve hours later, nuclei were isolated
and treated in four different ways. [32P]GTP was added to
all reactions, but the remaining three nucleotides were withheld from
half of the tubes (reactions 1 and 2, Fig. 3A) to control for possible nontranscriptional incorporation
of the label. The remaining reactions (reactions 3 and
4) were provided with unlabeled ATP, CTP, and UTP to allow
transcript elongation. In half of the reactions, -amanitin was added
to 150 µg/ml to inhibit pol II and pol III transcription, but not pol
I (reactions 2 and 4). After a 10-min period to
allow nascent transcripts to be elongated by template-engaged
polymerases, RNA was purified and hybridized to an excess of DNA
affixed to filters. Duplicate filters (lanes a and
b) were used for each reaction. The DNA bound to the filters
was either a denatured ribosomal gene clone or denatured pBluescript
plasmid DNA, the latter serving as a control for the specificity of the
hybridization conditions. After washing at high stringency, filters
were exposed to x-ray film and were also quantified by phosphorimaging.
As can be seen in Fig. 3, A and B,
reactions 1 and 2, no signal was obtained if only
the labeled nucleotide was provided to the nuclei. In contrast, adding all four nucleotides allowed the synthesis of radioactive transcripts that hybridized to rRNA gene filters (reactions 3 and
4), but not to pBluescript DNA filters (B). Note
that run-on transcription signals were unaffected by -amanitin
(compare reactions 3 and 4), as expected for pol
I transcription of rRNA. Importantly, the amount of run-on
transcription was increased by kinetin treatment prior to nuclei
isolation. Nuclear run-on signals were maximal following
10 3 M kinetin treatment and were 3.8-fold
higher than in mock-treated plants (Fig. 3A). An increase in
the kinetin concentration to 10 2 M decreased
the response, suggesting inhibition at excessive concentrations.
Fig. 3.
Nuclear run-on experiments confirm that
kinetin induces increased rRNA transcription within 1 h of
spraying whole plants. Equal numbers of nuclei isolated from
plants 12 h after treatment at various kinetin concentrations
(A) or harvested at 1 or 6 h following treatment at
10 4 M kinetin (B) were tested in
10-min nuclear-run on reactions. Reactions 1 and
2 were incubated with only [32P]GTP, but not
the remaining nucleotides. Reactions 3 and 4 received all four nucleotides, allowing transcription to occur.
Reactions 2 and 4 included -amanitin at 150 µg/ml to inhibit pol II and pol III transcription. RNA transcripts
synthesized during the 10-min nuclear run-on reaction were hybridized
to duplicate (lanes a and b) nylon filters with
covalently bound denatured rRNA gene DNA or denatured pBluescript
plasmid DNA. Following autoradiography, radioactivity bound to the
filters was quantified by phosporimaging. Average signals from
duplicate filters were compared with nuclei of mock-treated plants; the
-fold increases caused by kinetin are shown.
[View Larger Version of this Image (41K GIF file)]
The agreement between the nuclear run-on results and the S1 protection
results of Fig. 2A is noteworthy (the 12-h time point of
Fig. 2A is the relevant comparison). At 10 6
M kinetin, nuclear run-on assays showed a 1.4-fold increase
over control nuclei (based on the average signals from the duplicate filters quantified by phosphorimaging), whereas S1 protection detected
a 1.5-fold change. Likewise, relative signals at 10 5
M kinetin were 2.1- versus 1.9-fold; at
10 4 M were 2.7- versus 3.5-fold;
and at 10 3 M were 3.8- versus
4.9-fold. For unknown reasons, the only large discrepancy was at the
highest concentration of kinetin tested, 10 2
M, yielding a signal 1.7-fold higher than the control in
the nuclear run-on assay, but 3.8-fold higher in the S1 protection assay. Nonetheless, we conclude that in Arabidopsis, as in
other species, steady-state levels of rRNA transcripts initiated at +1
(detected by S1 protection) closely reflects levels of
transcription.
Using the sensitive nuclear run-on assay, we examined the kinetics of
the cytokinin response. Plants were mock-treated or sprayed with
10 4 M kinetin, and nuclei were isolated 1 or
6 h later (Fig. 3B). One hour after hormone treatment,
rRNA transcription was stimulated 1.8-fold relative to control nuclei.
At 6 h, the response was 2.4-fold in agreement with other
experiments (Figs. 2A and 3A). For technical
reasons, time periods shorter than 1 h were impractical. Nonetheless, these data suggest that induction of rRNA transcription by
cytokinin occurs rapidly.
Increased rRNA synthesis in nuclear run-on assays could be due to
transcription of more rRNA genes, a higher polymerase density on the
same number of genes or more rapid transcript elongation. The latter
possibility seems unlikely given that hormone-induced increases in
transcripts initiated at +1 (detected by S1 protection) were paralleled
by increased transcription throughout the body of the gene (detected by
nuclear run-on). These data are most easily explained by kinetin
affecting the frequency of polymerase I initiation rather than the rate
of elongation. Time courses of nuclear run-on reactions also support
the hypothesis that more RNA polymerase I molecules are engaged in
transcription in hormone-treated plants. In the experiment of Fig.
4, nuclear run-on reactions were performed using our
standard conditions, but early time points in the reaction were
examined. Even at the earliest time point (about 12 s), there is
an approximately 2-fold increase in label incorporated in nuclei of
treated plants. We interpret this to mean that an increased number of
polymerase molecules are stalled on the rDNA of kinetin-treated nuclei.
Upon addition of nucleotides, these resume transcription, the higher
starting level in hormone-treated nuclei presumably reflecting the
increased number of engaged polymerases. In contrast, if the same
number of polymerase molecules were template-engaged but altered in
their transcription rates, total isotope incorporation would be similar
initially but would diverge with time (i.e. the lines
connecting the data points would converge if extrapolated to time 0).
Note that the zero time point provides no data in this assay, because
endogenous transcripts are not labeled until transcripts begin to
elongate. For this reason, there are no time 0 data points in Fig.
4.
Fig. 4.
The kinetics of nuclear run-on transcription
suggests that kinetin increases the number of template-engaged RNA
polymerase I enzymes. The time course of -amanitin-resistant
incorporation of [32P]GTP into RNA is compared for nuclei
of kinetin-treated (10 4 M, nuclei isolated
12 h after treatment), and mock-treated plants. For this
experiment, radioactive RNA was separated from unincorporated GTP by
denaturing gel electrophoresis, and radioactive signals were quantified
by phosphorimaging. Background signals were subtracted for all time
points. The data were fitted to straight lines using CricketGraph
software. As discussed in the text, the higher initial incorporation of
GTP in nuclei of hormone-treated plants suggests that kinetin primarily
affects the number of template-engaged polymerase I molecules rather
than the rate of elongation.
[View Larger Version of this Image (18K GIF file)]
An experiment done in parallel with the one represented by Fig. 4 was
performed to estimate the number of nucleotides incorporated per second
in the nuclear run-on assays; these data are worth mentioning, though
the data are not shown. Nuclei were treated with DNase-free
ribonuclease to digest nascent transcripts protruding from the bound
polymerase molecules. Nuclei were then washed and incubated in run-on
conditions. Aliquots were taken at various intervals (10-300 s), and
labeled transcripts were separated on a sequencing gel and visualized
by phosphorimaging. Despite substantial size heterogeneity, computer
imaging allowed us to identify the average transcript size at each time
point by identifying the size range where the radioactive signal was
highest. Such analyses led to an estimated average elongation rate of
~2 nucleotides/s. This is in the same range as elongation rates of
~5 nucleotides/s within isolated animal nuclei (57). Importantly, we
observed no obvious difference in average transcript size over time in nuclei of hormone-treated and control plants. However, transcription signals were approximately twice as strong in kinetin-treated nuclei.
These data are consistent with those of Figs. 2, 3, 4, suggesting that
kinetin increases the number of polymerase I enzymes engaged in rRNA
transcription.
Because pol I accounts for a large proportion of all nuclear
transcription, we estimated the effect of kinetin on overall transcription by measuring total and -amanitin-resistant
[32P]GTP incorporation in nuclei of control and treated
plants (12 h following 10 4 M treatment).
Radioactive RNA from run-on reactions was purified and bound to
positively charged DE81 filters. These were washed extensively to
remove free nucleotides and quantified by scintillation counting. In
control nuclei of two independent experiments, pol I transcription
accounted for 32 or 36% of total RNA polymerase activity, whereas in
cytokinin-treated plants, pol I activity accounted for 56 or 63% of
the total (Fig. 5). These data are in line with studies
in animal cells showing that rRNA transcription can account for
40-80% of total transcription (12).
Fig. 5.
Polymerase I transcription as a percent of
total transcription nearly doubles in response to kinetin. Total
incorporation of [32P]GTP into RNA (counts/min) in 10-min
nuclear run-on reactions are given for two independent trials in the
absence or presence of 150 µg/ml -amanitin. The effect of kinetin
and the relative proportion of -amanitin-resistant transcription
(polymerase I) in nuclei of control and treated plants is calculated.
The counts/min shown have been adjusted for background, determined by
spotting filters with RNA from reactions containing only the labeled
nucleotide, but not the remaining three nucleotides needed for
transcript elongation.
[View Larger Version of this Image (32K GIF file)]
DISCUSSION
To the best of our knowledge, our study is the first to examine
plant hormone effects on transcription initiation directly at the rRNA
gene promoter. Kinetin-induced increases in steady-state transcript
levels were mirrored by nuclear run-on data, suggesting that cytokinin
elicits a response at the level of gene transcription rather than rRNA
stability. In general, our results support the conclusions of prior
studies using isolated nuclei of detached cotyledons (58). Agreement
between S1 protection and nuclear run-on data also suggests that
transcripts upstream of the ETS processing site are rapidly degraded in
plants, such that steady-state measurement of these unstable RNAs can
essentially substitute for nuclear run-on assays.
Responsiveness of rRNA genes to kinetin is reasonable in light of the
role of cytokinins in cell division (cytokinesis). Dividing cells
partition their ribosomes among daughter cells, thus rRNA synthesis
might need to be up-regulated to replenish the ribosome pool. However,
up-regulation within 1 h of kinetin treatment is unlikely to be a
consequence of cell division. Furthermore, DNA content in total nucleic
acid extracts, detected by Hoechst dye binding and fluorometry, was not
appreciably increased at 1, 6, or 12 h following cytokinin
treatment and was only slightly increased at 24 h (data not
shown). In contrast, if rRNA transcription were up-regulated only as a
consequence of DNA replication and cell division, every 2-fold increase
in rRNA transcription should be paralleled by a 2-fold increase in DNA
content. Other data not shown include our observation that rRNA
transcription is similarly induced in roots, floral tissues, and whole
plants, suggesting that cytokinin responsiveness is not
tissue-specific.
We were surprised that other hormones did not exert an effect on rRNA
gene transcription in our initial screen. In particular, we thought
auxin (specifically 2,4-dichlorophenoxyacetic acid) might elicit a
positive response. Guilfoyle (37) clearly showed that RNA polymerase I
activity on heterologous template DNA (e.g. sheared calf
thymus DNA) was about 10-fold higher in cell-free extracts of soybean
hypocotyl treated with 2.5 × 10 3 M
2,4-dichlorophenoxyacetic acid. Lack of an auxin effect in our
experiments might suggest that pol I levels alone are not limiting for
promoter-dependent rRNA gene transcription within the plant
cell. Perhaps increased levels or modifications of other transcription
factors are also needed to facilitate promoter-dependent rRNA transcription, and these events are affected by cytokinin but not
auxin.
Cytokinins are the least understood class of plant hormones in terms of
their mechanisms of action and signal transduction pathways (59, 60).
Few mutants affecting cytokinin metabolism are available. The A. thaliana mutant, amp1 (61), has endogenous cytokinin
levels six times higher than normal and displays a rapid growth
phenotype. Using the S1 protection assay, we found nascent rRNA
transcripts in amp1 plants to be slightly higher than in wild-type plants (data not shown). However, kinetin responsiveness was
similar in amp1 and wild-type plants. We also tested several mutants we have isolated that are resistant to cytokinin levels that
inhibit seed germination and plantlet growth. Thus far, rRNA transcript
levels are also increased in these lines in response to exogenous
cytokinin treatment, although slight differences relative to control
plants are suggested in some lines.2
Mutants disrupted in cytokinin signaling would clearly be valuable for
future studies.
The specific responsiveness of rRNA gene transcription to kinetin
suggests that in plants, cytokinins may be key signaling molecules
involved in communicating cellular growth status to the transcription
and protein synthetic machinery. It is intriguing that kinetin and
ppGpp (in prokaryotes) are both modified purines. However, at present
it is not clear if this is coincidence or a hint of a functional
similarity.
FOOTNOTES
*
This work was initiated under Grant DMB-9018428 (to C. S. P.) from The National Science Foundation and was completed under postdoctoral research Grant 94-01600 (to R. J. G.) from the United States Department of Agriculture National Research Institute
Competitive Grants Program and by United States Department of
Agriculture National Research Institute Competitive Grant
94-373012-0658 (to C. S. P.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.: 314-935-7569;
Fax: 314-935-4432; E-mail: pikaard{at}biodec.wustl.edu.
1
The abbreviations used are: pol, polymerase;
Rubisco, ribulose-1,5-bisphosphate carboxylase/oxygenase; PMSF,
phenylmethylsulfonyl fluoride; ETS, external transcribed spacer.
2
R. Van Sambeek and R. J. Gaudino,
unpublished.
Acknowledgments
We are grateful to Dr. David Ho (Biology
Department, Washington University, St. Louis) and members of our
laboratory for numerous helpful discussions and constructive
criticisms.
REFERENCES
-
Reeder, R. H.
(1992)
in
Regulation of Transcription by RNA Polymerase I (McKnight, S. L., and Yamamoto, K. R., eds), Vol. 1, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
-
Moss, T., and Stefanovsky, V. Y.
(1995)
Prog. Nucleic Acid Res. Mol. Biol.
50,
25-66
[Medline]
[Order article via Infotrieve]
-
Paule, M. R.
(1994)
in
Transcription: Mechanisms and Regulation (Conaway, R. C., and Conaway, J. W., eds), pp. 83-106, Raven Press, Ltd., New York
-
Serizawa, H., Conaway, J. W., and Conaway, R. C.
(1994)
in
Transcription Mechanisms and Regulation (Conaway, R. C., and Conaway, J. W., eds), Vol. 3, pp. 27-44, Raven Press, Ltd., New York
-
Zawel, L., and Reinberg, D.
(1993)
Prog. Nucleic Acid Res. Mol. Biol.
44,
67-108
[Medline]
[Order article via Infotrieve]
-
Lobo, S. M., and Hernandez, N. T.
(1994)
in
Transcription Mechanisms and Regulation (Conaway, R. C., and Conaway, J. W., eds), Vol. 3, pp. 127-160, Raven Press, Ltd., New York
-
Kassavetis, G. A., Bardeleben, C., Bartholomew, B., Braun, B. R., Joazeiro, C. A. P., Pisano, M., and Geiduschek, E. P.
(1994)
in
Transcription Mechanisms and Regulation (Conaway, R. C., and Conaway, J. W., eds), Vol. 3, pp. 107-126, Raven Press, Ltd., New York
-
Filipowicz, W., Kiss, T., Marshallsay, C., and Waibel, F.
(1990)
Mol. Biol. Rep.
14,
125-129
[CrossRef][Medline]
[Order article via Infotrieve]
-
Warner, J. R.
(1990)
Curr. Opin. Cell Biol.
2,
521-527
[CrossRef][Medline]
[Order article via Infotrieve]
-
Reeder, R. H.
(1974)
in
Ribosomes (Nomura, M., ed), pp. 489-519, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
-
Noller, H. F., Hoffarth, V., and Zimniak, L.
(1992)
Science
256,
1416-1419
[Abstract/Free Full Text]
-
Jacob, S. T.
(1995)
Biochem. J.
306,
617-626
-
Planta, R. J., and Raue, H. A.
(1988)
Trends Genet.
4,
64-68
[CrossRef][Medline]
[Order article via Infotrieve]
-
Raue, H. A., and Planta, R. J.
(1991)
Prog. Nucleic Acid Res. Mol. Biol.
41,
89-129
[Medline]
[Order article via Infotrieve]
-
Mager, W. H., and Planta, R. J.
(1991)
Mol. Cell. Biochem.
104,
181-187
[Medline]
[Order article via Infotrieve]
-
Gourse, R. L., de Boer, H. A., and Nomura, M.
(1986)
Cell
44,
197-205
[CrossRef][Medline]
[Order article via Infotrieve]
-
Condon, C., Squires, C., and Squires, C. L.
(1995)
Microbiol. Rev.
59,
623-645
[Abstract/Free Full Text]
-
Buttgereit, D., Pflugfelder, G., and Grummt, I.
(1985)
Nucleic Acids Res.
13,
8165-8180
[Abstract/Free Full Text]
-
Grummt, I., Smith, V. A., and Grummt, F.
(1976)
Cell
7,
439-445
[CrossRef][Medline]
[Order article via Infotrieve]
-
Grummt, I.
(1981)
Proc. Natl. Acad. Sci. U. S. A.
78,
727-731
[Abstract/Free Full Text]
-
Tower, J., and Sollner-Webb, B.
(1987)
Cell
50,
873-83
[CrossRef][Medline]
[Order article via Infotrieve]
-
Bateman, E., and Paule, M. R.
(1986)
Cell
47,
445-450
[CrossRef][Medline]
[Order article via Infotrieve]
-
Paule, M. R., Bateman, E., Hoffman, L., Iida, C., Imboden, M., Kubaska, W., Kownin, P., Li, H., Lofquist, A., Risi, P., Yang, Q., and Zwick, M.
(1991)
Mol. Cell. Biochem.
104,
119-126
[Medline]
[Order article via Infotrieve]
-
Weber, H. W., Vallett, S., Neilson, L., Grotke, M., Chao, Y., Brudnak, M., Juan, A. S., and Pellegrini, M.
(1991)
Mol. Cell. Biochem.
104,
201-207
[Medline]
[Order article via Infotrieve]
-
Cavanaugh, A. H., and Thompson, E. A.
(1985)
Nucleic Acids Res.
13,
3357-3369
[Abstract/Free Full Text]
-
Gokal, P. K., Mahajan, P. B., and Thompson, E. A.
(1990)
J. Biol. Chem.
265,
16234-16243
[Abstract/Free Full Text]
-
Mahajan, P. B., and Thompson, E. A.
(1990)
J. Biol. Chem.
265,
16225-16233
[Abstract/Free Full Text]
-
Mahajan, P. B., Gokal, P. K., and Thompson, E. A.
(1990)
J. Biol. Chem.
265,
16244-16247
[Abstract/Free Full Text]
-
Paule, M. R., Iida, C. T., Perna, P. J., Harris, G. H., Knoll, D. A., and D'Alessio, J. M.
(1984)
Nucleic Acids Res.
12,
8161-8180
[Abstract/Free Full Text]
-
O'Mahony, D. J., Xie, W., Smith, S. D., Singer, H. A., and Rothblum, L. I.
(1992)
J. Biol. Chem.
267,
35-38
[Abstract/Free Full Text]
-
Schnapp, A., Pfleiderer, C., Rosenbauer, H., and Grummt, I.
(1990)
EMBO J.
9,
2857-2863
[Medline]
[Order article via Infotrieve]
-
Doelling, J. H., Gaudino, R. J., and Pikaard, C. S.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
7528-7532
[Abstract/Free Full Text]
-
Doelling, J. H., and Pikaard, C. S.
(1995)
Plant J.
8,
683-692
[CrossRef][Medline]
[Order article via Infotrieve]
-
Copenhaver, G. P., Doelling, J. H., Gens, J. S., and Pikaard, C. S.
(1995)
Plant J.
7,
273-286
[CrossRef]
-
Copenhaver, G. P., and Pikaard, C. S.
(1996)
Plant J.
9,
273-282
[CrossRef][Medline]
[Order article via Infotrieve]
-
Copenhaver, G. P., and Pikaard, C. S.
(1996)
Plant J.
9,
259-272
[CrossRef][Medline]
[Order article via Infotrieve]
-
Guilfoyle, T. J.
(1980)
Biochemistry
19,
6112-6118
[Medline]
[Order article via Infotrieve]
-
Guilfoyle, T. J.
(1983)
in
Enzymes of Nucleic Acid Synthesis and Modification (Jacob, S. T., ed), Vol. II, pp. 1-42, CRC Press, Boca Raton, FL
-
Mikulovich, T. P., Wollgiehn, R., Khokhlova, V. A., Neumann, D., and Kulaeva, O. N.
(1978)
Biochem. Physiol. Pflanz.
172,
101-110
-
Kinoshita, I., Katagiri, K., and Tsuji, H.
(1979)
Plant Cell Physiol.
20,
707-713
[Abstract/Free Full Text]
-
Schneider, J., and Legocka, J.
(1981)
Physiol. Pflanz.
176,
614-624
-
Valvekens, D., Van Montagu, M., and Van Lijsebettens, M.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
5536-5540
[Abstract/Free Full Text]
-
Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter, W. J.
(1979)
Biochemistry
18,
5294-5299
[CrossRef][Medline]
[Order article via Infotrieve]
-
Berk, A. J., and Sharp, P. A.
(1977)
Cell
12,
721-732
[CrossRef][Medline]
[Order article via Infotrieve]
-
Krebbers, E., Seurinck, J., Herdies, L., Cashmore, A. R., and Timko, M. P.
(1988)
Plant Mol. Biol.
11,
745-759
[CrossRef]
-
Feinbaum, R. L., and Ausubel, F. M.
(1988)
Mol. Cell. Biol.
8,
1985-1992
[Abstract/Free Full Text]
-
Guilfoyle, T. J.
(1995)
Methods Cell. Biol.
50,
101-112
[Medline]
[Order article via Infotrieve]
-
Warner, J.
(1989)
Microbiol. Rev.
53,
256-71
[Abstract/Free Full Text]
-
Paule, M. R.
(1993)
Gene Expr.
3,
1-9
[Medline]
[Order article via Infotrieve]
-
Craig, N., Kass, S., and Sollner-Webb, B.
(1987)
Proc. Natl. Acad. Sci. U. S. A.
84,
629-633
[Abstract/Free Full Text]
-
Craig, N., Kass, S., and Sollner-Webb, B.
(1991)
Mol. Cell. Biol.
11,
458-467
[Abstract/Free Full Text]
-
Kass, S., Craig, N., and Sollner-Webb, B.
(1987)
Mol. Cell. Biol.
7,
2891-2898
[Abstract/Free Full Text]
-
Kass, S., and Sollner-Webb, B.
(1990)
Mol. Cell. Biol.
10,
4920-4931
[Abstract/Free Full Text]
-
Kass, S., Tyc, K., Steitz, J. A., and Sollner-Webb, B.
(1990)
Cell
60,
897-908
[CrossRef][Medline]
[Order article via Infotrieve]
-
Mougey, E. B., O'Reilly, M., Miller, O. L., Beyer, A., and Sollner-Webb, B.
(1993)
Genes Dev.
7,
1609-1620
[Abstract/Free Full Text]
-
Cotton, J. L. S., Ross, C. W., Byrne, D. H., and Colbert, J. T.
(1990)
Plant Mol. Biol.
14,
707-714
[CrossRef][Medline]
[Order article via Infotrieve]
-
Marzluff, W. F.
(1990)
Methods Enzymol.
181,
30-36
[Medline]
[Order article via Infotrieve]
-
Ananiev, E. D., Karagyozov, L. K., and Karanov, E. N.
(1987)
Planta
170,
370-378
-
Hobbie, L., Timpte, C., and Estelle, M.
(1994)
Plant Mol. Biol.
26,
1499-1519
[CrossRef][Medline]
[Order article via Infotrieve]
-
Brzobohaty, B., Moore, I., and Palme, K.
(1994)
Plant Mol. Biol.
26,
1483-1497
[CrossRef][Medline]
[Order article via Infotrieve]
-
Chaudhury, A. M., Letham, S., Craig, S., and Dennis, E. S.
(1993)
Plant J.
4,
907-916
[CrossRef]
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
A.-V. Bohne, S. Ruf, T. Borner, and R. Bock
Faithful transcription initiation from a mitochondrial promoter in transgenic plastids
Nucleic Acids Res.,
December 18, 2007;
35(21):
7256 - 7266.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Beauchemin and J.-F. Laliberte
The Poly(A) Binding Protein Is Internalized in Virus-Induced Vesicles or Redistributed to the Nucleolus during Turnip Mosaic Virus Infection
J. Virol.,
October 15, 2007;
81(20):
10905 - 10913.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. A. Brovko, V. S. Vasil'eva, A. O. Shepelyakovskaya, S. Yu. Selivankina, G. R. Kudoyarova, A. V. Nosov, D. A. Moshkov, A. G. Laman, K. M. Boziev, V. V. Kusnetsov, et al.
Cytokinin-binding protein (70 kDa): localization in tissues and cells of etiolated maize seedlings and its putative function
J. Exp. Bot.,
July 1, 2007;
58(10):
2479 - 2490.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Beauchemin, N. Boutet, and J.-F. Laliberte
Visualization of the Interaction between the Precursors of VPg, the Viral Protein Linked to the Genome of Turnip Mosaic Virus, and the Translation Eukaryotic Initiation Factor iso 4E In Planta
J. Virol.,
January 15, 2007;
81(2):
775 - 782.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Koukalova, M. Fojtova, K. Y. Lim, J. Fulnecek, A. R. Leitch, and A. Kovarik
Dedifferentiation of Tobacco Cells Is Associated with Ribosomal RNA Gene Hypomethylation, Increased Transcription, and Chromatin Alterations
Plant Physiology,
September 1, 2005;
139(1):
275 - 286.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. W.H. Yong, S. C. Wong, D. S. Letham, C. H. Hocart, and G. D. Farquhar
Effects of Elevated [CO2] and Nitrogen Nutrition on Cytokinins in the Xylem Sap and Leaves of Cotton
Plant Physiology,
October 1, 2000;
124(2):
767 - 780.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J. Saez-Vasquez and C. S. Pikaard
Extensive purification of a putative RNA polymerase I holoenzyme from plants that accurately initiates rRNA gene transcription vitro
PNAS,
October 28, 1997;
94(22):
11869 - 11874.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. J. Chen and C. S. Pikaard
Epigenetic silencing of RNA polymerase I transcription: a role for DNA methylation and histone modification in nucleolar dominance
Genes & Dev.,
August 15, 1997;
11(16):
2124 - 2136.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|