| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
(Received for publication, September 13, 1996, and in revised form, January 9, 1997)
From the Departments of ‡ Vascular Biology and
ABSTRACT Integrin signaling is mediated by interaction of
integrin cytoplasmic domains with intracellular signaling molecules.
Recently, we identified a novel 111-amino acid polypeptide, termed
INTRODUCTION Integrins are heterodimeric adhesion receptors composed of Integrin signaling and the interaction of integrin cytoplasmic domains
with intracellular signaling molecules are still poorly understood. For
example, inside-out signaling is believed to involve interactions of
integrin cytoplasmic domains with specific cytoplasmic elements.
Studies of patients with rare defects in platelet aggregation or of
recombinant human integrins expressed in various mammalian cells are
consistent with a role for the A few proteins have been found to interact directly with integrin
cytoplasmic domains, and most of these studies have been performed
in vitro (13). The Recently, we identified a novel 111-amino acid polypeptide called
MATERIALS AND METHODS Monoclonal antibodies against the extracellular
domain of the human CHO1 cells stably
expressing Bacterial expression
of The yeast vector,
pGBT9, was used to construct in frame fusions of integrin cytoplasmic
domains (see Table I) with the GAL4 DNA binding domain (22).
Truncations and point mutations in the carboxyl terminus of the
Amino acid sequences of selected integrin cytoplasmic domains used in
the yeast two-hybrid system
Volume 272, Number 12,
Issue of March 21, 1997
pp. 7693-7698
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
3
Cytoplasmic Domain Is Required for Its Specific Interaction with
3-Endonexin*
and
Molecular and Experimental Medicine, The Scripps Research
Institute, La Jolla, California 92037
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
FOOTNOTES
Acknowledgments
REFERENCES
3-endonexin, which interacts selectively with the
integrin 3 cytoplasmic domain. In the present study we
conducted a systematic mutational analysis of both the integrin
3 cytoplasmic domain and 3-endonexin to map sites required for interaction. The interaction of the full-length 3 integrin subunit with 3-endonexin
in vitro required the 3 cytoplasmic domain.
In a yeast two-hybrid system, both membrane-proximal and
membrane-distal residues of the 3 cytoplasmic domain
were necessary for interaction with 3-endonexin. In
particular, the membrane-distal NITY motif at 3 756-759
was critical for the interaction. Exchange of 3 residues
756-759 (NITY) for the corresponding residues in 1
(NPKY) endowed the 1 cytoplasmic domain with the ability
to interact with 3-endonexin. Conversely, exchange of the NPKY motif at 1 772-775 for the NITY motif in
3 abolished interaction of this chimeric cytoplasmic
domain with 3-endonexin. Because the NITY motif is
present in the 3 but not the 1
cytoplasmic domain, these results explain the selective interaction of
this cytoplasmic domain with 3-endonexin. In addition,
deletional analysis suggested that a core 91-residue sequence of
3-endonexin is sufficient for specific binding to the
3 cytoplasmic domain. These studies have identified a
cytoplasmic domain sequence motif that specifies an integrin-specific
protein-protein interaction.
and
transmembrane subunits (1). The 3 integrin subfamily includes IIb3 and
v3. IIb3 is
largely specific for cells of the megakaryocytic lineage and is
required for platelet aggregation (2). v3
is found in a number of cell types, including endothelial cells,
vascular smooth muscle cells, and monocytes, where it is involved in
the regulation of cell adhesion, migration, proliferation, and cell
survival (2-4). The adhesive function of the integrin can be regulated
by the cell (inside-out signaling), and the ligand-bound and clustered
form of the integrin triggers cellular responses (outside-in signaling)
(5).
3 cytoplasmic domain in
inside-out and outside-in signaling (6-9). In addition, the over-expression of isolated cytoplasmic domains can disrupt or
promote integrin signaling, conceivably by binding to factors that
interact with the cytoplasmic domain (10-12).
IIb cytoplasmic domain has
been reported to interact with calreticulin through a membrane-proximal GFFKR sequence that is highly conserved among all integrin subunits (14). Cytohesin-1 has recently been identified as a specific integrin
2 cytoplasmic domain binding protein (15), and direct interaction of filamin with this tail has been described (16). Other
cytoplasmic domains have been found to interact with -actinin, talin, pp125FAK, and integrin-linked kinase (17-21).
However, these latter interactions may not be specific for one
particular cytoplasmic domain. Because most cells contain many
different integrins, it is possible that cytoplasmic domain-specific
binding proteins may exist that play a role in determining the
specificity of integrin responses.
3-endonexin, which is present in platelets, mononuclear lymphocytes, and several tissues, which interacts selectively with the
3 cytoplasmic domain in a yeast two-hybrid system (22). As a first step in assessing the potential biological functions of
3-endonexin, we have conducted a systematic mutational
analysis of both the 3 cytoplasmic domain and
3-endonexin to identify amino acid residues required for
this unique interaction.
3 integrin subunit (monoclonal
antibody 15) or the extracellular domain of the hamster
1 integrin subunit (monoclonal antibody 7E2) have been
described (23, 24). A monoclonal antibody against the extracellular
domain of human 1 (antibody B-D15) was purchased from
BioSource International (Camarillo, CA). A monoclonal antibody against
the GAL4 DNA binding domain was purchased from Clontech Laboratories (Palo Alto, CA).
IIb3 or
IIb3
717 (a 3 truncation
mutant lacking the cytoplasmic domain) have been described (25). CHO
cells stably expressing human integrin 1 paired with endogenous hamster subunits were obtained by transfecting
1 cDNA in pCDM8 using neomycin resistance as a
selectable marker. Expression of human 3 or
1 integrins was quantified by Western blot technique
using monoclonal antibodies 15 (5 µg/ml) or B-D15 (1:400),
respectively (22). The intensity of the bands of the subunits on
scanned images of these Western blots was quantified by densitometry on
a MacIntosh computer using NIH Image software (version 1.55). All
labeled bands were analyzed within the linear range for the
chemiluminescence reaction.
3-Endonexin Affinity Matrix
3-endonexin as an amino-terminal histidine-tagged
protein and preparation of a Nickel-agarose 3-endonexin affinity resin were performed as described (22). Stably transfected CHO
cell lines expressing approximately equivalent amounts of the indicated
human integrins were lysed in 0.4 ml of lysis buffer containing 50 mM Tris, pH 7.2, 0.9% NaCl, 1 mM
CaCl2, 1% Triton X-100, and protease inhibitors (100 units/ml aprotinin, 0.5 mM leupeptin, 4 mM
Pefabloc, 0.1 mM E64) at 4 °C for 30 min while shaking.
Cell lysates were spun in a microfuge at 14,000 rpm for 20 min at
4 °C. Then 0.35 ml of each supernatant were added to 0.35 ml of the
lysis buffer containing no Triton, such that the final concentration of
Triton was 0.5%. Each diluted lysate was batch-incubated with 1 ml of
packed volume of 3-endonexin affinity resin for 12 h at 4 °C while shaking. Resins were then packed in columns and
washed with 15 ml of lysis buffer, and bound proteins were eluted into
0.7-ml fractions of lysis buffer after the addition of 1 M
imidazole. Fractions were collected and run on SDS-PAGE gels under
nonreducing conditions. After electro-transfer to nitrocellulose, Western blotting was performed with monoclonal antibody 15 for 3 and B-D15 for 1.
3 cytoplasmic domain were constructed by PCR using a
common 5
primer (CGGAAGAGAGTAGTAACAAAG) and a 3 primer encoding an
appropriate stop codon or an amino acid change and a PstI
restriction site. PCR products were cut with BamHI and
PstI and cloned into BamHI- and
PstI-cut pGBT9. cDNAs containing truncations in the
amino terminus of the 3 cytoplasmic domain were
constructed by PCR using a 5 primer encoding a BamHI restriction site and a 3 primer encoding the last seven residues of
the 3 cytoplasmic domain, a stop codon and a
PstI restriction site
(GCTACTGCAGGTTAAGTGCCCCGGTACGTGATATTG). Resulting PCR products were cut
with BamHI and PstI and ligated into pGBT9.
Chimeras of the 3 and 1 cytoplasmic
domains were constructed by splice overlap PCR mutagenesis and cloned
into pGBT9 at the BamHI and PstI sites (26).
3716 3762
| |
3 wild typeKLLITI HDRKE FAKFEEERARAKWDTAN NPLY
KEATSTFT NITY RGT
3 759KLLITI HDRKE
FAKFEEERARAKWDTAN NPLY KEATSTFT NIT
3
755KLLITI HDRKE FAKFEEERARAKWDTAN NPLY KEATSTF
3 717-755/1 772-778KLLITI HDRKE
FAKFEEERARAKWDTAN NPLY KEATSTFT
3I757PKLLITI HDRKE FAKFEEERARAKWDTAN NPLY
KEATSTFT N
TY RGT
1732 1778
| |
1 wild
typeKLLMII HDRRE FAKFEKEKMNAKWDTGE NPIY KSAVTTVV NPKY EGK
1 732-771/3 756-762KLLMII HDRRE
FAKFEKEKMNAKWDTGE NPIY KSAVTTVV
1 P7731KLLMII HDRRE FAKFEKEKMNAKWDTGE NPIY
KSAVTTVV N
KY EGK
IIb
989-1008/3
756-762KVGFFKRNRPPLEEDDEEGQ
The yeast vector, pACT, was used to construct fusions of wild-type or
truncated forms of 3-endonexin cDNAs with the
GAL4 activation domain (22, 27). Amino-terminal truncations
of 3-endonexin were cloned into pACT by PCR using a 5
primer containing a BamHI restriction site and a common 3
primer (GATGCACAGTTGAAGTGAACTTGC). PCR products were cut with
BamHI and XhoI and cloned into pACT. Carboxyl-terminal truncated forms of 3-endonexin were
constructed by splice overlap PCR, and the PCR products were cut with
BamHI and XhoI and ligated into BamHI-
and XhoI-cut pACT.
Yeast strain maintenance and
transformation have been described (22). The yeast two-hybrid system
was used to quantify the extent of binary interactions between
3-endonexin and integrin cytoplasmic domains.
Protein expression in transformed yeast was analyzed by SDS-PAGE and
Western blotting using a specific monoclonal antibody for the
GAL4 DNA binding domain (28). The extent of expression of
the reporter gene, lacZ, was determined by quantitative
liquid -galactosidase assay (29) and taken as an indicator of the
strength of interaction between the two fusion proteins (29-32). A
one-tailed Student's t test for unpaired samples was used
for statistical calculations.
RESULTS AND DISCUSSION
3 Integrin Subunit with
3-Endonexin Requires the Integrin Cytoplasmic
Domain
Previous studies have shown that
3-endonexin binds to the cytoplasmic domain of the
3 integrin subunit when the isolated cytoplasmic domain
is expressed in a yeast two-hybrid system (22). This interaction is
structurally specific, because it was not observed with the cytoplasmic
domains of the integrin IIb, 1, or
2 subunits. Therefore, we conducted a mutational
analysis using the yeast two-hybrid system to identify sites within
these two proteins that are necessary for this binary interaction.
Prior to undertaking such an analysis, experiments were performed to assess the specificity with which 3-endonexin binds to
the 3 cytoplasmic domain in the context of an intact
integrin.
CHO cell lines were prepared that stably expressed the human
IIb subunit paired with either human 3 or
3717, a truncated form of 3 missing
the entire cytoplasmic domain except for a putative membrane-proximal
lysine residue (3 Lys716) (33). As an
additional control, a CHO cell line expressing human 1
paired with endogenous hamster subunits was prepared. Analyzing
these cell lines by SDS-PAGE and Western blotting using antibodies
specific for the extracellular portion of human 3 or
1 showed that they expressed similar levels of their
respective subunits (data not shown). As a source of
3-endonexin for in vitro binding studies, a
histidine-tagged form of 3-endonexin was expressed in
bacteria and coupled noncovalently to a metal chelation affinity resin.
Then equal aliquots of affinity resin were incubated with equal volumes
of detergent extracts from each of the three CHO cell lines, and the
amount of human integrin subunit retained on the
3-endonexin resin was determined by Western blotting
(Fig. 1). Approximately 53% of the full-length 3 integrin subunit that was applied to the
3-endonexin affinity matrix was retained, compared with
only 14% of 3717 and 5% of the 1
integrin subunit. The differences between 3 and
3717 and between 3 and
1 were significant (p < 0.006). In
contrast, the difference between 3717 and
1 was not (p > 0.05) (Fig. 1).
Furthermore, using a monoclonal antibody specific for hamster 1 (monoclonal antibody 7E2) to detect 1
in CHO cell lysates, no significant binding of endogenous hamster
1 integrin to 3-endonexin could be
detected by Western blotting (data not shown). These results
demonstrate that interaction of the full-length 3
integrin subunit with 3-endonexin is mediated by the
integrin cytoplasmic domain.
3 subunit is required for interaction with
3-endonexin. As described under "Materials and
Methods," an affinity matrix was prepared with histidine-tagged
3-endonexin bound noncovalently to a metal chelation resin. CHO cell lysates (0.7 ml) containing the full-length
3 integrin subunit (A), the 3
717 subunit (B), or the full-length 1
subunit (C) were incubated with the affinity resin for
12 h at 4 °C. After washing, proteins were eluted from the
resin in 0.7 ml of lysis buffer containing 1 M imidazole.
Lysate (lanes 1), last column wash (lanes 2), and
resin eluate (lanes 3) were then analyzed by SDS-PAGE under
nonreducing conditions, transferred to nitrocellulose, and
immunoblotted with monoclonal antibodies specific for the extracellular
domain of 3 (A and B) or
1 (C). 1 integrins appear as a
double band representing 1 and a precursor form of this
integrin subunit. The autoradiographs shown are representative for
three separate experiments. Integrin bands on the Western blots were
analyzed by densitometry. Integrins in the elution fraction were
expressed as percentages of integrins in the lysate (which was defined
as 100%). The data represent the means ± S.E. of three separate
experiments.
Both Membrane-proximal and Membrane-distal Residues of the
3 Cytoplasmic Domain Are Necessary for Interaction with
3-Endonexin
To study the structural basis for the
interaction between the 3 cytoplasmic domain and
3-endonexin in more detail, a series of truncation
mutants of the 3 cytoplasmic domain (Table
I) were fused in-frame to the carboxyl terminus of the
GAL4 DNA binding domain and co-expressed in yeast with
3-endonexin fused to the GAL4 DNA activation
domain. In this system, the extent of expression of the reporter gene,
lacZ, can be taken as an indication of the strength of
interaction between the two fusion proteins (29-32). Deletion of the
carboxyl-terminal 1-3 amino acids from the cytoplasmic domain of
3 (3762, 3761, or
3760) caused no significant reduction in its
interaction with 3-endonexin (Fig. 2). In
fact, deletion of the carboxyl-terminal threonine residue actually
increased apparent binding (p < 0.0002) (Fig. 2).
However, deletion of the carboxyl-terminal 4 residues from the
3 cytoplasmic domain (3759) reduced
binding to 3-endonexin, whereas deletion of 8 residues from the carboxyl terminus of the 3 cytoplasmic domain
(3755) virtually abolished binding (Fig. 2). This
result was not due to lack of expression of any of the GAL4
DNA binding domain fusion proteins (Fig. 3).
3-endonexin to
truncated forms of the integrin 3 cytoplasmic
domain. Binary interactions between pairs of fusion proteins were
studied in yeast using a liquid -galactosidase assay as described
under "Materials and Methods." On the left side of the
figure, the position of the stop codon within the integrin
3 cytoplasmic domain is indicated by the number of the corresponding amino acid. The chimera of the integrin
IIb and 3 cytoplasmic domain contains the
complete IIb cytoplasmic domain and 3
residues 756-762. For clarity, only the carboxyl-terminal amino acid
sequences of the 3 cytoplasmic domain or the truncated forms are shown. -Galactosidase activity is represented by the bar graphs. The data represent the means ± S.E. of a
minimum of six single colonies from two independent
transformations.
To further elucidate the role of the carboxyl terminus of the
3 cytoplasmic domain for interaction with
3-endonexin, we attached the carboxyl-terminal 7 residues of 3 to the IIb cytoplasmic domain (IIb989-1008/3756-762) (Table
I). Although expressed in yeast, this construct did not interact with
3-endonexin (Figs. 2 and 3), indicating that the
carboxyl-terminal region of the integrin 3 cytoplasmic
domain is necessary but not sufficient for the interaction with
3-endonexin.
To determine whether residues in the membrane-proximal region of the
3 cytoplasmic domain are necessary for the interaction with 3-endonexin, the effects of amino-terminal
truncations of the 3 cytoplasmic domain were assessed.
Deletion of even a single residue from the amino terminus
(Lys716) caused a more than 92% reduction in binding to
3-endonexin (p < 0.0001). Additional
constructs containing deletions of 3, 6, or 11 residues from the amino
terminus of the 3 cytoplasmic domain also failed to
interact (data not shown).
Taken together with the results of the carboxyl-terminal cytoplasmic
domain truncations, these data indicate that both the amino and
carboxyl termini of the 3 cytoplasmic domain are
required for the interaction with 3-endonexin. This
could mean that both membrane-proximal and membrane-distal regions of
the 3 cytoplasmic domain are directly involved in
binding and/or that overall folding of the cytoplasmic domain is a
critical determinant of its interaction with
3-endonexin.
3 756-759 Is Critical for
Interaction of the 3 Cytoplasmic Domain with
3-Endonexin
Despite the fact that the
3 and 1 cytoplasmic domains exhibit high
overall similarity (60% identical; 68% identical plus conservative
substitutions) only the 3 cytoplasmic domain interacts with 3-endonexin (Fig. 1) (22). It is therefore of
particular interest to identify the residues within the
3 cytoplasmic domain that account for the specific
binding to 3-endonexin. Because the region of greatest
dissimilarity between these two cytoplasmic domains is at the extreme
carboxyl terminus (Table I), we wondered if exchange of certain
residues in this region would influence the ability of these domains to
interact with 3-endonexin. Indeed, exchange of
carboxyl-terminal 7 residues of the 3 cytoplasmic domain
amino acids 756-762) for the corresponding region of the 1 cytoplasmic domain resulted in a strong interaction of
the new chimeric 1/3 cytoplasmic domain
with 3-endonexin (Fig. 4). In fact,
exchange of only 4 3 residues 756-759 (NITY) for the
corresponding residues in 1 (NPKY) or exchange of even a single amino acid of 3 (Ile757) for
Pro773 in 1 (1P773I) now
endowed the 1 cytoplasmic domain with the ability to
interact with 3-endonexin (Fig. 4). Conversely, swapping the carboxyl-terminal 7 residues of the 1 cytoplasmic
domain into the corresponding region of 3 or exchange of
the NPKY motif at 1 772-775 for the NITY motif in
3 abolished interaction of these chimeric cytoplasmic
domains with 3-endonexin. Moreover, introduction of
Pro773 of 1 into the 3
cytoplasmic domain, resulting in 3I757P, decreased binding to 3-endonexin by more than 70%
(p < 0.004) (Fig. 4). These data could not be
accounted for by differences in levels of expression of the
3I757P and 1P773I fusion proteins (Fig. 3). These data indicate that the 3 linear sequence,
756NITY, is critical for the interaction of the
3 cytoplasmic domain with
3-endonexin.
3-endonexin to
chimeras of integrin 3 and 1 cytoplasmic
domains. Interactions between 3-endonexin and integrin 3 or 1 cytoplasmic domain
chimeras were studied in yeast. Carboxyl-terminal amino acid sequences
of the cytoplasmic domain constructs are shown. Residues from
3 are indicated by white boxes, and residues
from 1 by filled boxes. The data represent the means ± S.E. of a minimum of six single colonies from two independent transformations.
To examine the importance of individual components of the NITY motif
further, alanine was substituted individually for each amino acid in
this motif. Alanine substitution at Ile757
(3I757A) or Tyr759 (3Y759A)
in 3 resulted in a 75 or 92% reduction in interaction of the 3 cytoplasmic domain with
3-endonexin, respectively (Fig. 5). On
the other hand, more conservative substitutions of Ile757
(3 I757L) or Tyr759 (3Y759F)
or alanine substitutions of Asn756 (3N756A)
or Thr758 (3T758A) had little or no effect
on binding (Fig. 5). This demonstrates that Ile757 and
Tyr759 in 3 are critical residues for
interaction with 3-endonexin. As shown in Fig.
6, despite its dissimilarity with the corresponding region in several other human cytoplasmic domains, the NITY motif
is highly conserved among 3 integrins of various
species. Thus, we propose that this motif is responsible for the subunit specificity of 3-endonexin.
3 756-759
is a critical motif for interaction of the 3 cytoplasmic
domain with 3-endonexin. Binding of
3-endonexin to integrin 3 cytoplasmic
domains containing mutations of the NITY motif was analyzed in yeast.
The data represent the means ± S.E. of a minimum of five single
colonies from two independent transformations.
cytoplasmic domains.
Given the key role of the NITY motif in this interaction, it should be
noted that this motif is also important for localization of
3 integrins to focal adhesions and for integrin
signaling (34). For example, deletion of 3 residues
759YRGT (3759) significantly reduced cell
spreading and recruitment of 3 integrins to focal
adhesion sites, whereas deletion of 3 residues
757ITYRGT (3757) totally abolished cell
spreading and formation of focal contacts (34). Retaining
Ile757 partially preserved these functions. The point
mutation 3 Y759A also significantly reduced cell
spreading and 3 integrin recruitment to focal adhesions
(34). Thus, the region of the 3 cytoplasmic domain that
is necessary for interaction with 3-endonexin also is
necessary for post-adhesive functions of 3 integrins.
Whether 3-endonexin modulates the adhesive or
post-adhesive functions of 3 integrins remains to be
determined. In this context, preliminary studies show that
over-expression of 3-endonexin in an
IIb3/CHO cell model system increases the
affinity state of integrin IIb3 (35).
Recent studies have demonstrated tyrosine phosphorylation of the
integrin 3 cytoplasmic domain as well as calpain-induced cleavage at various sites within the 3 cytoplasmic
domain during thrombin-induced activation of platelets (36, 37).
Although the latter might be expected to cause release of
3-endonexin from the 3 cytoplasmic
domain, we cannot predict the effects of tyrosine phosphorylation on
the binding of 3-endonexin, and we have not observed
tyrosine phosphorylation of the 3 cytoplasmic domain in
the yeast system.2
3-Endonexin Are Required for Interaction with the
3 Cytoplasmic Domain
As a first approach to
identify the residues within 3-endonexin that are
critical for binding to the 3 cytoplasmic domain, we
investigated the binding of carboxyl-terminal and amino-terminal truncation mutants of 3-endonexin to this cytoplasmic
domain. The carboxyl terminus of 3-endonexin contains
three heptad repeats that may form coiled-coil structures (residues
89-111) (38). Removal of part of the last of these repeats by deleting
2 amino acids from the carboxyl terminus of 3-endonexin
(residues 110 and 111 of 3-endonexin, EN2) decreased
binding to the 3 cytoplasmic domain more than 80% (Fig.
7). Deletion of 7 or more amino acids (corresponding to
at least one heptad repeat) from the carboxyl terminus of
3-endonexin abolished binding completely (Fig. 7). Furthermore, deletion of 9 or 20 residues from the amino terminus of
3-endonexin had no effect on binding, whereas deletion
of 35 or more amino-terminal residues abolished binding (Fig. 7). These
results show that a construct containing only
3-endonexin residues 21-111 was sufficient for the
interaction with the 3 cytoplasmic domain (Fig. 7).
Thus, the amino terminus of 3-endonexin is dispensible
for interaction of this polypeptide with the 3 cytoplasmic domain, but the carboxyl terminus is not.
3-endonexin are required for interaction
with the 3 cytoplasmic domain. Binding of the
integrin 3 cytoplasmic domain to truncation mutants of
3-endonexin was studied in yeast. The number of deleted residues at the carboxyl terminus (C) or amino terminus
(N) of 3-endonexin (EN) is
indicated. The bar graphs in the middle panel represent the residues of 3-endonexin that were
expressed as a fusion protein in yeast. The histogram in the
right panel of the figure shows the corresponding
-galactosidase activity. The data represent the means ± S.E.
of a minimum of six single colonies from two independent
transformations.
In addition to determining the basis for the selectivity of
3-endonexin for the 3 cytoplasmic domain,
the present results will prove useful in designing studies aimed at
establishing the physiological function of 3-endonexin.
For example, the established importance of the NITY motif in the
3 cytoplasmic domain in certain aspects of integrin
signaling and in binding of 3-endonexin suggests that
over-expression of 3-endonexin or incorporation of
NITY-containing peptides into cells might disrupt (or promote)
3 integrin functions such as ligand binding, cell
spreading, or modulation of gene expression (39). These effects could
be specific for 3 integrins. If so, this would support
the idea that the specificity of cellular responses to integrin ligands
is determined by several factors, including the composition of the
extracellular matrix, the integrin repertoire of the cell, and the
intracellular complement and function of integrin cytoplasmic
domain-binding proteins.
FOOTNOTES
Acknowledgments
We thank J. C. Loftus for many helpful discussions and suggestions.
REFERENCES
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  Y.-Q. Ma, J. Qin, C. Wu, and E. F. Plow Kindlin-2 (Mig-2): a co-activator of {beta}3 integrins J. Cell Biol., May 1, 2008; 181(3): 439 - 446. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Larkin, D. Murphy, D. F. Reilly, M. Cahill, E. Sattler, P. Harriott, D. J. Cahill, and N. Moran ICln, a Novel Integrin {alpha}IIb{beta}3-Associated Protein, Functionally Regulates Platelet Activation J. Biol. Chem., June 25, 2004; 279(26): 27286 - 27293. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Vinogradova, J. Vaynberg, X. Kong, T. A. Haas, E. F. Plow, and J. Qin Membrane-mediated structural transitions at the cytoplasmic face during integrin activation PNAS, March 23, 2004; 101(12): 4094 - 4099. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. A. Calderwood Integrin activation J. Cell Sci., March 1, 2004; 117(5): 657 - 666. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. S. Roberts, A. J. Woods, P. E. Shaw, and J. C. Norman ERK1 Associates with alpha vbeta 3 Integrin and Regulates Cell Spreading on Vitronectin J. Biol. Chem., January 10, 2003; 278(3): 1975 - 1985. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Besta, S. Massberg, K. Brand, E. Muller, S. Page, S. Gruner, M. Lorenz, K. Sadoul, W. Kolanus, E. Lengyel, et al. Role of {beta}3-endonexin in the regulation of NF-{kappa}B-dependent expression of urokinase-type plasminogen activator receptor J. Cell Sci., October 15, 2002; 115(20): 3879 - 3888. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Weljie, P. M. Hwang, and H. J. Vogel Solution structures of the cytoplasmic tail complex from platelet integrin alpha IIb- and beta 3-subunits PNAS, April 30, 2002; 99(9): 5878 - 5883. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Zhang, R. E. Clatterbuck, D. Rigamonti, D. D. Chang, and H. C. Dietz Interaction between krit1 and icap1{alpha} infers perturbation of integrin {beta}1-mediated angiogenesis in the pathogenesis of cerebral cavernous malformation Hum. Mol. Genet., December 1, 2001; 10(25): 2953 - 2960. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Hapke, M. Gawaz, K. Dehne, J. Köhler, J. F. Marshall, H. Graeff, M. Schmitt, U. Reuning, and E. Lengyel {beta}3A-Integrin Downregulates the Urokinase-Type Plasminogen Activator Receptor (u-PAR) through a PEA3/ets Transcriptional Silencing Element in the u-PAR Promoter Mol. Cell. Biol., March 15, 2001; 21(6): 2118 - 2132. [Abstract] [Full Text]
|
|
|
|
