JBC Origene Your Gene Company

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Eigenthaler, M.
Right arrow Articles by Ginsberg, M. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Eigenthaler, M.
Right arrow Articles by Ginsberg, M. H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 12, Issue of March 21, 1997 pp. 7693-7698
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

A Conserved Sequence Motif in the Integrin beta 3 Cytoplasmic Domain Is Required for Its Specific Interaction with beta 3-Endonexin*

(Received for publication, September 13, 1996, and in revised form, January 9, 1997)

Martin Eigenthaler §, Liane Höfferer , Sanford J. Shattil par and Mark H. Ginsberg **

From the Departments of  Vascular Biology and par  Molecular and Experimental Medicine, The Scripps Research Institute, La Jolla, California 92037

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
FOOTNOTES
Acknowledgments
REFERENCES


ABSTRACT

Integrin signaling is mediated by interaction of integrin cytoplasmic domains with intracellular signaling molecules. Recently, we identified a novel 111-amino acid polypeptide, termed beta 3-endonexin, which interacts selectively with the integrin beta 3 cytoplasmic domain. In the present study we conducted a systematic mutational analysis of both the integrin beta 3 cytoplasmic domain and beta 3-endonexin to map sites required for interaction. The interaction of the full-length beta 3 integrin subunit with beta 3-endonexin in vitro required the beta 3 cytoplasmic domain. In a yeast two-hybrid system, both membrane-proximal and membrane-distal residues of the beta 3 cytoplasmic domain were necessary for interaction with beta 3-endonexin. In particular, the membrane-distal NITY motif at beta 3 756-759 was critical for the interaction. Exchange of beta 3 residues 756-759 (NITY) for the corresponding residues in beta 1 (NPKY) endowed the beta 1 cytoplasmic domain with the ability to interact with beta 3-endonexin. Conversely, exchange of the NPKY motif at beta 1 772-775 for the NITY motif in beta 3 abolished interaction of this chimeric cytoplasmic domain with beta 3-endonexin. Because the NITY motif is present in the beta 3 but not the beta 1 cytoplasmic domain, these results explain the selective interaction of this cytoplasmic domain with beta 3-endonexin. In addition, deletional analysis suggested that a core 91-residue sequence of beta 3-endonexin is sufficient for specific binding to the beta 3 cytoplasmic domain. These studies have identified a cytoplasmic domain sequence motif that specifies an integrin-specific protein-protein interaction.


INTRODUCTION

Integrins are heterodimeric adhesion receptors composed of alpha  and beta  transmembrane subunits (1). The beta 3 integrin subfamily includes alpha IIbbeta 3 and alpha vbeta 3. alpha IIbbeta 3 is largely specific for cells of the megakaryocytic lineage and is required for platelet aggregation (2). alpha vbeta 3 is found in a number of cell types, including endothelial cells, vascular smooth muscle cells, and monocytes, where it is involved in the regulation of cell adhesion, migration, proliferation, and cell survival (2-4). The adhesive function of the integrin can be regulated by the cell (inside-out signaling), and the ligand-bound and clustered form of the integrin triggers cellular responses (outside-in signaling) (5).

Integrin signaling and the interaction of integrin cytoplasmic domains with intracellular signaling molecules are still poorly understood. For example, inside-out signaling is believed to involve interactions of integrin cytoplasmic domains with specific cytoplasmic elements. Studies of patients with rare defects in platelet aggregation or of recombinant human integrins expressed in various mammalian cells are consistent with a role for the beta 3 cytoplasmic domain in inside-out and outside-in signaling (6-9). In addition, the over-expression of isolated beta  cytoplasmic domains can disrupt or promote integrin signaling, conceivably by binding to factors that interact with the beta  cytoplasmic domain (10-12).

A few proteins have been found to interact directly with integrin cytoplasmic domains, and most of these studies have been performed in vitro (13). The alpha IIb cytoplasmic domain has been reported to interact with calreticulin through a membrane-proximal GFFKR sequence that is highly conserved among all integrin alpha  subunits (14). Cytohesin-1 has recently been identified as a specific integrin beta 2 cytoplasmic domain binding protein (15), and direct interaction of filamin with this tail has been described (16). Other beta  cytoplasmic domains have been found to interact with alpha -actinin, talin, pp125FAK, and integrin-linked kinase (17-21). However, these latter interactions may not be specific for one particular beta  cytoplasmic domain. Because most cells contain many different integrins, it is possible that cytoplasmic domain-specific binding proteins may exist that play a role in determining the specificity of integrin responses.

Recently, we identified a novel 111-amino acid polypeptide called beta 3-endonexin, which is present in platelets, mononuclear lymphocytes, and several tissues, which interacts selectively with the beta 3 cytoplasmic domain in a yeast two-hybrid system (22). As a first step in assessing the potential biological functions of beta 3-endonexin, we have conducted a systematic mutational analysis of both the beta 3 cytoplasmic domain and beta 3-endonexin to identify amino acid residues required for this unique interaction.


MATERIALS AND METHODS

Antibodies

Monoclonal antibodies against the extracellular domain of the human beta 3 integrin subunit (monoclonal antibody 15) or the extracellular domain of the hamster beta 1 integrin subunit (monoclonal antibody 7E2) have been described (23, 24). A monoclonal antibody against the extracellular domain of human beta 1 (antibody B-D15) was purchased from BioSource International (Camarillo, CA). A monoclonal antibody against the GAL4 DNA binding domain was purchased from Clontech Laboratories (Palo Alto, CA).

Cell Culture and Transfection

CHO1 cells stably expressing alpha IIbbeta 3 or alpha IIbbeta 3Delta 717 (a beta 3 truncation mutant lacking the cytoplasmic domain) have been described (25). CHO cells stably expressing human integrin beta 1 paired with endogenous hamster alpha  subunits were obtained by transfecting beta 1 cDNA in pCDM8 using neomycin resistance as a selectable marker. Expression of human beta 3 or beta 1 integrins was quantified by Western blot technique using monoclonal antibodies 15 (5 µg/ml) or B-D15 (1:400), respectively (22). The intensity of the bands of the beta  subunits on scanned images of these Western blots was quantified by densitometry on a MacIntosh computer using NIH Image software (version 1.55). All labeled bands were analyzed within the linear range for the chemiluminescence reaction.

Binding of Integrin Cytoplasmic Domains to a beta 3-Endonexin Affinity Matrix

Bacterial expression of beta 3-endonexin as an amino-terminal histidine-tagged protein and preparation of a Nickel-agarose beta 3-endonexin affinity resin were performed as described (22). Stably transfected CHO cell lines expressing approximately equivalent amounts of the indicated human integrins were lysed in 0.4 ml of lysis buffer containing 50 mM Tris, pH 7.2, 0.9% NaCl, 1 mM CaCl2, 1% Triton X-100, and protease inhibitors (100 units/ml aprotinin, 0.5 mM leupeptin, 4 mM Pefabloc, 0.1 mM E64) at 4 °C for 30 min while shaking. Cell lysates were spun in a microfuge at 14,000 rpm for 20 min at 4 °C. Then 0.35 ml of each supernatant were added to 0.35 ml of the lysis buffer containing no Triton, such that the final concentration of Triton was 0.5%. Each diluted lysate was batch-incubated with 1 ml of packed volume of beta 3-endonexin affinity resin for 12 h at 4 °C while shaking. Resins were then packed in columns and washed with 15 ml of lysis buffer, and bound proteins were eluted into 0.7-ml fractions of lysis buffer after the addition of 1 M imidazole. Fractions were collected and run on SDS-PAGE gels under nonreducing conditions. After electro-transfer to nitrocellulose, Western blotting was performed with monoclonal antibody 15 for beta 3 and B-D15 for beta 1.

cDNA Constructs in Yeast Vectors

The yeast vector, pGBT9, was used to construct in frame fusions of integrin cytoplasmic domains (see Table I) with the GAL4 DNA binding domain (22). Truncations and point mutations in the carboxyl terminus of the beta 3 cytoplasmic domain were constructed by PCR using a common 5' primer (CGGAAGAGAGTAGTAACAAAG) and a 3' primer encoding an appropriate stop codon or an amino acid change and a PstI restriction site. PCR products were cut with BamHI and PstI and cloned into BamHI- and PstI-cut pGBT9. cDNAs containing truncations in the amino terminus of the beta 3 cytoplasmic domain were constructed by PCR using a 5' primer encoding a BamHI restriction site and a 3' primer encoding the last seven residues of the beta 3 cytoplasmic domain, a stop codon and a PstI restriction site (GCTACTGCAGGTTAAGTGCCCCGGTACGTGATATTG). Resulting PCR products were cut with BamHI and PstI and ligated into pGBT9. Chimeras of the beta 3 and beta 1 cytoplasmic domains were constructed by splice overlap PCR mutagenesis and cloned into pGBT9 at the BamHI and PstI sites (26).

Table I.

Amino acid sequences of selected integrin cytoplasmic domains used in the yeast two-hybrid system


 beta 3716 beta 3762
|  |
 beta 3 wild type KLLITI HDRKE FAKFEEERARAKWDTAN NPLY KEATSTFT NITY RGT
 beta 3 Delta 759 KLLITI HDRKE FAKFEEERARAKWDTAN NPLY KEATSTFT NIT
 beta 3 Delta 755 KLLITI HDRKE FAKFEEERARAKWDTAN NPLY KEATSTF
 beta 3 717-755/beta 1 772-778 KLLITI HDRKE FAKFEEERARAKWDTAN NPLY KEATSTFT <UNL><B>NPKY:EGK</B></UNL>
 beta 3I757P KLLITI HDRKE FAKFEEERARAKWDTAN NPLY KEATSTFT N<UNL><B>P</B></UNL>TY RGT
 beta 1732  beta 1778
|  |
 beta 1 wild type KLLMII HDRRE FAKFEKEKMNAKWDTGE NPIY KSAVTTVV NPKY EGK
 beta 1 732-771/beta 3 756-762 KLLMII HDRRE FAKFEKEKMNAKWDTGE NPIY KSAVTTVV <UNL><B>NITY:RGK</B></UNL>
 beta 1 P7731 KLLMII HDRRE FAKFEKEKMNAKWDTGE NPIY KSAVTTVV N<UNL><B>I</B></UNL>KY EGK
 alpha IIb 989-1008/beta 3 756-762 KVGFFKRNRPPLEEDDEEGQ  <UNL><B>NITY:RGT</B></UNL>

The yeast vector, pACT, was used to construct fusions of wild-type or truncated forms of beta 3-endonexin cDNAs with the GAL4 activation domain (22, 27). Amino-terminal truncations of beta 3-endonexin were cloned into pACT by PCR using a 5' primer containing a BamHI restriction site and a common 3' primer (GATGCACAGTTGAAGTGAACTTGC). PCR products were cut with BamHI and XhoI and cloned into pACT. Carboxyl-terminal truncated forms of beta 3-endonexin were constructed by splice overlap PCR, and the PCR products were cut with BamHI and XhoI and ligated into BamHI- and XhoI-cut pACT.

Yeast Two-hybrid System

Yeast strain maintenance and transformation have been described (22). The yeast two-hybrid system was used to quantify the extent of binary interactions between beta 3-endonexin and integrin beta  cytoplasmic domains. Protein expression in transformed yeast was analyzed by SDS-PAGE and Western blotting using a specific monoclonal antibody for the GAL4 DNA binding domain (28). The extent of expression of the reporter gene, lacZ, was determined by quantitative liquid beta -galactosidase assay (29) and taken as an indicator of the strength of interaction between the two fusion proteins (29-32). A one-tailed Student's t test for unpaired samples was used for statistical calculations.


RESULTS AND DISCUSSION

Interaction of the beta 3 Integrin Subunit with beta 3-Endonexin Requires the Integrin Cytoplasmic Domain

Previous studies have shown that beta 3-endonexin binds to the cytoplasmic domain of the beta 3 integrin subunit when the isolated cytoplasmic domain is expressed in a yeast two-hybrid system (22). This interaction is structurally specific, because it was not observed with the cytoplasmic domains of the integrin alpha IIb, beta 1, or beta 2 subunits. Therefore, we conducted a mutational analysis using the yeast two-hybrid system to identify sites within these two proteins that are necessary for this binary interaction. Prior to undertaking such an analysis, experiments were performed to assess the specificity with which beta 3-endonexin binds to the beta 3 cytoplasmic domain in the context of an intact integrin.

CHO cell lines were prepared that stably expressed the human alpha IIb subunit paired with either human beta 3 or beta 3Delta 717, a truncated form of beta 3 missing the entire cytoplasmic domain except for a putative membrane-proximal lysine residue (beta 3 Lys716) (33). As an additional control, a CHO cell line expressing human beta 1 paired with endogenous hamster alpha  subunits was prepared. Analyzing these cell lines by SDS-PAGE and Western blotting using antibodies specific for the extracellular portion of human beta 3 or beta 1 showed that they expressed similar levels of their respective beta  subunits (data not shown). As a source of beta 3-endonexin for in vitro binding studies, a histidine-tagged form of beta 3-endonexin was expressed in bacteria and coupled noncovalently to a metal chelation affinity resin. Then equal aliquots of affinity resin were incubated with equal volumes of detergent extracts from each of the three CHO cell lines, and the amount of human integrin beta  subunit retained on the beta 3-endonexin resin was determined by Western blotting (Fig. 1). Approximately 53% of the full-length beta 3 integrin subunit that was applied to the beta 3-endonexin affinity matrix was retained, compared with only 14% of beta 3Delta 717 and 5% of the beta 1 integrin subunit. The differences between beta 3 and beta 3Delta 717 and between beta 3 and beta 1 were significant (p < 0.006). In contrast, the difference between beta 3Delta 717 and beta 1 was not (p > 0.05) (Fig. 1). Furthermore, using a monoclonal antibody specific for hamster beta 1 (monoclonal antibody 7E2) to detect beta 1 in CHO cell lysates, no significant binding of endogenous hamster beta 1 integrin to beta 3-endonexin could be detected by Western blotting (data not shown). These results demonstrate that interaction of the full-length beta 3 integrin subunit with beta 3-endonexin is mediated by the integrin cytoplasmic domain.


Fig. 1. The cytoplasmic domain of the integrin beta 3 subunit is required for interaction with beta 3-endonexin. As described under "Materials and Methods," an affinity matrix was prepared with histidine-tagged beta 3-endonexin bound noncovalently to a metal chelation resin. CHO cell lysates (0.7 ml) containing the full-length beta 3 integrin subunit (A), the beta 3 Delta 717 subunit (B), or the full-length beta 1 subunit (C) were incubated with the affinity resin for 12 h at 4 °C. After washing, proteins were eluted from the resin in 0.7 ml of lysis buffer containing 1 M imidazole. Lysate (lanes 1), last column wash (lanes 2), and resin eluate (lanes 3) were then analyzed by SDS-PAGE under nonreducing conditions, transferred to nitrocellulose, and immunoblotted with monoclonal antibodies specific for the extracellular domain of beta 3 (A and B) or beta 1 (C). beta 1 integrins appear as a double band representing beta 1 and a precursor form of this integrin subunit. The autoradiographs shown are representative for three separate experiments. Integrin bands on the Western blots were analyzed by densitometry. Integrins in the elution fraction were expressed as percentages of integrins in the lysate (which was defined as 100%). The data represent the means ± S.E. of three separate experiments.
[View Larger Version of this Image (14K GIF file)]


Both Membrane-proximal and Membrane-distal Residues of the beta 3 Cytoplasmic Domain Are Necessary for Interaction with beta 3-Endonexin

To study the structural basis for the interaction between the beta 3 cytoplasmic domain and beta 3-endonexin in more detail, a series of truncation mutants of the beta 3 cytoplasmic domain (Table I) were fused in-frame to the carboxyl terminus of the GAL4 DNA binding domain and co-expressed in yeast with beta 3-endonexin fused to the GAL4 DNA activation domain. In this system, the extent of expression of the reporter gene, lacZ, can be taken as an indication of the strength of interaction between the two fusion proteins (29-32). Deletion of the carboxyl-terminal 1-3 amino acids from the cytoplasmic domain of beta 3 (beta 3Delta 762, beta 3Delta 761, or beta 3Delta 760) caused no significant reduction in its interaction with beta 3-endonexin (Fig. 2). In fact, deletion of the carboxyl-terminal threonine residue actually increased apparent binding (p < 0.0002) (Fig. 2). However, deletion of the carboxyl-terminal 4 residues from the beta 3 cytoplasmic domain (beta 3Delta 759) reduced binding to beta 3-endonexin, whereas deletion of 8 residues from the carboxyl terminus of the beta 3 cytoplasmic domain (beta 3Delta 755) virtually abolished binding (Fig. 2). This result was not due to lack of expression of any of the GAL4 DNA binding domain fusion proteins (Fig. 3).


Fig. 2. Binding of beta 3-endonexin to truncated forms of the integrin beta 3 cytoplasmic domain. Binary interactions between pairs of fusion proteins were studied in yeast using a liquid beta -galactosidase assay as described under "Materials and Methods." On the left side of the figure, the position of the stop codon within the integrin beta 3 cytoplasmic domain is indicated by the number of the corresponding amino acid. The chimera of the integrin alpha IIb and beta 3 cytoplasmic domain contains the complete alpha IIb cytoplasmic domain and beta 3 residues 756-762. For clarity, only the carboxyl-terminal amino acid sequences of the beta 3 cytoplasmic domain or the truncated forms are shown. beta -Galactosidase activity is represented by the bar graphs. The data represent the means ± S.E. of a minimum of six single colonies from two independent transformations.
[View Larger Version of this Image (26K GIF file)]



Fig. 3. Expression of integrin cytoplasmic domain constructs as GAL4 DNA binding domain fusion proteins in yeast. Yeast cells were transfected with cDNAs encoding integrin cytoplasmic domain constructs in pGBT9 vector as described under "Materials and Methods." Expression of GAL4 DNA binding domain fusion proteins was assessed by SDS-PAGE and Western blot analysis using a monoclonal antibody against the GAL4 DNA binding domain. Each lane contains the protein derived from 2.0 A600 units of yeast cells. Ab, antibody.
[View Larger Version of this Image (28K GIF file)]


To further elucidate the role of the carboxyl terminus of the beta 3 cytoplasmic domain for interaction with beta 3-endonexin, we attached the carboxyl-terminal 7 residues of beta 3 to the alpha IIb cytoplasmic domain (alpha IIb989-1008/beta 3756-762) (Table I). Although expressed in yeast, this construct did not interact with beta 3-endonexin (Figs. 2 and 3), indicating that the carboxyl-terminal region of the integrin beta 3 cytoplasmic domain is necessary but not sufficient for the interaction with beta 3-endonexin.

To determine whether residues in the membrane-proximal region of the beta 3 cytoplasmic domain are necessary for the interaction with beta 3-endonexin, the effects of amino-terminal truncations of the beta 3 cytoplasmic domain were assessed. Deletion of even a single residue from the amino terminus (Lys716) caused a more than 92% reduction in binding to beta 3-endonexin (p < 0.0001). Additional constructs containing deletions of 3, 6, or 11 residues from the amino terminus of the beta 3 cytoplasmic domain also failed to interact (data not shown).

Taken together with the results of the carboxyl-terminal cytoplasmic domain truncations, these data indicate that both the amino and carboxyl termini of the beta 3 cytoplasmic domain are required for the interaction with beta 3-endonexin. This could mean that both membrane-proximal and membrane-distal regions of the beta 3 cytoplasmic domain are directly involved in binding and/or that overall folding of the cytoplasmic domain is a critical determinant of its interaction with beta 3-endonexin.

The NITY Motif at beta 3 756-759 Is Critical for Interaction of the beta 3 Cytoplasmic Domain with beta 3-Endonexin

Despite the fact that the beta 3 and beta 1 cytoplasmic domains exhibit high overall similarity (60% identical; 68% identical plus conservative substitutions) only the beta 3 cytoplasmic domain interacts with beta 3-endonexin (Fig. 1) (22). It is therefore of particular interest to identify the residues within the beta 3 cytoplasmic domain that account for the specific binding to beta 3-endonexin. Because the region of greatest dissimilarity between these two cytoplasmic domains is at the extreme carboxyl terminus (Table I), we wondered if exchange of certain residues in this region would influence the ability of these domains to interact with beta 3-endonexin. Indeed, exchange of carboxyl-terminal 7 residues of the beta 3 cytoplasmic domain amino acids 756-762) for the corresponding region of the beta 1 cytoplasmic domain resulted in a strong interaction of the new chimeric beta 1/beta 3 cytoplasmic domain with beta 3-endonexin (Fig. 4). In fact, exchange of only 4 beta 3 residues 756-759 (NITY) for the corresponding residues in beta 1 (NPKY) or exchange of even a single amino acid of beta 3 (Ile757) for Pro773 in beta 1 (beta 1P773I) now endowed the beta 1 cytoplasmic domain with the ability to interact with beta 3-endonexin (Fig. 4). Conversely, swapping the carboxyl-terminal 7 residues of the beta 1 cytoplasmic domain into the corresponding region of beta 3 or exchange of the NPKY motif at beta 1 772-775 for the NITY motif in beta 3 abolished interaction of these chimeric cytoplasmic domains with beta 3-endonexin. Moreover, introduction of Pro773 of beta 1 into the beta 3 cytoplasmic domain, resulting in beta 3I757P, decreased binding to beta 3-endonexin by more than 70% (p < 0.004) (Fig. 4). These data could not be accounted for by differences in levels of expression of the beta 3I757P and beta 1P773I fusion proteins (Fig. 3). These data indicate that the beta 3 linear sequence, 756NITY, is critical for the interaction of the beta 3 cytoplasmic domain with beta 3-endonexin.


Fig. 4. Binding of beta 3-endonexin to chimeras of integrin beta 3 and beta 1 cytoplasmic domains. Interactions between beta 3-endonexin and integrin beta 3 or beta 1 cytoplasmic domain chimeras were studied in yeast. Carboxyl-terminal amino acid sequences of the cytoplasmic domain constructs are shown. Residues from beta 3 are indicated by white boxes, and residues from beta 1 by filled boxes. The data represent the means ± S.E. of a minimum of six single colonies from two independent transformations.
[View Larger Version of this Image (37K GIF file)]


To examine the importance of individual components of the NITY motif further, alanine was substituted individually for each amino acid in this motif. Alanine substitution at Ile757 (beta 3I757A) or Tyr759 (beta 3Y759A) in beta 3 resulted in a 75 or 92% reduction in interaction of the beta 3 cytoplasmic domain with beta 3-endonexin, respectively (Fig. 5). On the other hand, more conservative substitutions of Ile757 (beta 3 I757L) or Tyr759 (beta 3Y759F) or alanine substitutions of Asn756 (beta 3N756A) or Thr758 (beta 3T758A) had little or no effect on binding (Fig. 5). This demonstrates that Ile757 and Tyr759 in beta 3 are critical residues for interaction with beta 3-endonexin. As shown in Fig. 6, despite its dissimilarity with the corresponding region in several other human beta  cytoplasmic domains, the NITY motif is highly conserved among beta 3 integrins of various species. Thus, we propose that this motif is responsible for the beta  subunit specificity of beta 3-endonexin.


Fig. 5. The NITY motif at beta 3 756-759 is a critical motif for interaction of the beta 3 cytoplasmic domain with beta 3-endonexin. Binding of beta 3-endonexin to integrin beta 3 cytoplasmic domains containing mutations of the NITY motif was analyzed in yeast. The data represent the means ± S.E. of a minimum of five single colonies from two independent transformations.
[View Larger Version of this Image (32K GIF file)]



Fig. 6. Comparison of the carboxyl termini of various integrin beta  cytoplasmic domains.
[View Larger Version of this Image (30K GIF file)]


Given the key role of the NITY motif in this interaction, it should be noted that this motif is also important for localization of beta 3 integrins to focal adhesions and for integrin signaling (34). For example, deletion of beta 3 residues 759YRGT (beta 3Delta 759) significantly reduced cell spreading and recruitment of beta 3 integrins to focal adhesion sites, whereas deletion of beta 3 residues 757ITYRGT (beta 3Delta 757) totally abolished cell spreading and formation of focal contacts (34). Retaining Ile757 partially preserved these functions. The point mutation beta 3 Y759A also significantly reduced cell spreading and beta 3 integrin recruitment to focal adhesions (34). Thus, the region of the beta 3 cytoplasmic domain that is necessary for interaction with beta 3-endonexin also is necessary for post-adhesive functions of beta 3 integrins. Whether beta 3-endonexin modulates the adhesive or post-adhesive functions of beta 3 integrins remains to be determined. In this context, preliminary studies show that over-expression of beta 3-endonexin in an alpha IIbbeta 3/CHO cell model system increases the affinity state of integrin alpha IIbbeta 3 (35).

Recent studies have demonstrated tyrosine phosphorylation of the integrin beta 3 cytoplasmic domain as well as calpain-induced cleavage at various sites within the beta 3 cytoplasmic domain during thrombin-induced activation of platelets (36, 37). Although the latter might be expected to cause release of beta 3-endonexin from the beta 3 cytoplasmic domain, we cannot predict the effects of tyrosine phosphorylation on the binding of beta 3-endonexin, and we have not observed tyrosine phosphorylation of the beta 3 cytoplasmic domain in the yeast system.2

Both Amino- and Carboxyl-terminal Residues of beta 3-Endonexin Are Required for Interaction with the beta 3 Cytoplasmic Domain

As a first approach to identify the residues within beta 3-endonexin that are critical for binding to the beta 3 cytoplasmic domain, we investigated the binding of carboxyl-terminal and amino-terminal truncation mutants of beta 3-endonexin to this cytoplasmic domain. The carboxyl terminus of beta 3-endonexin contains three heptad repeats that may form coiled-coil structures (residues 89-111) (38). Removal of part of the last of these repeats by deleting 2 amino acids from the carboxyl terminus of beta 3-endonexin (residues 110 and 111 of beta 3-endonexin, ENDelta 2) decreased binding to the beta 3 cytoplasmic domain more than 80% (Fig. 7). Deletion of 7 or more amino acids (corresponding to at least one heptad repeat) from the carboxyl terminus of beta 3-endonexin abolished binding completely (Fig. 7). Furthermore, deletion of 9 or 20 residues from the amino terminus of beta 3-endonexin had no effect on binding, whereas deletion of 35 or more amino-terminal residues abolished binding (Fig. 7). These results show that a construct containing only beta 3-endonexin residues 21-111 was sufficient for the interaction with the beta 3 cytoplasmic domain (Fig. 7). Thus, the amino terminus of beta 3-endonexin is dispensible for interaction of this polypeptide with the beta 3 cytoplasmic domain, but the carboxyl terminus is not.


Fig. 7. Both amino-terminal and carboxyl-terminal residues of beta 3-endonexin are required for interaction with the beta 3 cytoplasmic domain. Binding of the integrin beta 3 cytoplasmic domain to truncation mutants of beta 3-endonexin was studied in yeast. The number of deleted residues at the carboxyl terminus (C) or amino terminus (N) of beta 3-endonexin (EN) is indicated. The bar graphs in the middle panel represent the residues of beta 3-endonexin that were expressed as a fusion protein in yeast. The histogram in the right panel of the figure shows the corresponding beta -galactosidase activity. The data represent the means ± S.E. of a minimum of six single colonies from two independent transformations.
[View Larger Version of this Image (18K GIF file)]


In addition to determining the basis for the selectivity of beta 3-endonexin for the beta 3 cytoplasmic domain, the present results will prove useful in designing studies aimed at establishing the physiological function of beta 3-endonexin. For example, the established importance of the NITY motif in the beta 3 cytoplasmic domain in certain aspects of integrin signaling and in binding of beta 3-endonexin suggests that over-expression of beta 3-endonexin or incorporation of NITY-containing peptides into cells might disrupt (or promote) beta 3 integrin functions such as ligand binding, cell spreading, or modulation of gene expression (39). These effects could be specific for beta 3 integrins. If so, this would support the idea that the specificity of cellular responses to integrin ligands is determined by several factors, including the composition of the extracellular matrix, the integrin repertoire of the cell, and the intracellular complement and function of integrin cytoplasmic domain-binding proteins.


FOOTNOTES

*   This work was supported by Grants HL 48728, AR 27214, and HL 56595 from the National Institutes of Health and by grants from Cor Therapeutics, Inc. This is publication 10305 from the Scripps Research Institute.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§   Supported by postdoctoral fellowships from the Deutsche Forschungsgemeinschaft and the American Heart Association (California affiliate). Present address: Medical Clinic, University of Würzburg, D-97080 Würzburg, Germany.
   Supported by postdoctoral fellowships from the Austrian Fonds zur Förderung der wissenschaftlichen Forschung and the Swiss Nationalfonds.
**   To whom correspondence should be addressed: Dept. of Vascular Biology, Scripps Research Inst., 10550 North Torrey Pines Rd., La Jolla, CA 92037. Tel.: 619-784-7118; Fax: 619-784-7343; E-mail: ginsberg{at}scripps.edu.
1   The abbreviations used are: CHO, Chinese hamster ovary; PAGE, polyacrylamide gel electrophoresis; PCR, polymerase chain reaction.
2   H. Kashiwagi and S. J. Shattil, unpublished data.

Acknowledgments

We thank J. C. Loftus for many helpful discussions and suggestions.


REFERENCES

  1. Hynes, R. O. (1992) Cell 69, 11-25 [CrossRef][Medline] [Order article via Infotrieve]
  2. Shattil, S. J. (1995) Thromb. Haemostasis 74, 149-155 [Medline] [Order article via Infotrieve]
  3. Cheresh, D. A. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 6471-6475 [Abstract/Free Full Text]
  4. Rabinowich, H., Lin, W. C., Amoscato, A., Herberman, R. B., and Whiteside, T. L. (1995) J. Immunol. 154, 1124-1135 [Abstract]
  5. Ginsberg, M. H., Du, X., and Plow, E. F. (1992) Curr. Opin. Cell Biol. 4, 766-771 [CrossRef][Medline] [Order article via Infotrieve]
  6. Chen, Y. P., O'Toole, T. E., Ylanne, J., Rosa, J. P., and Ginsberg, M. H. (1994) Blood 84, 1857-1865 [Abstract/Free Full Text]
  7. O'Toole, T. E., Katagiri, Y., Faull, R. J., Peter, K., Tamura, R., Quaranta, V., Loftus, J. C., Shattil, S. J., and Ginsberg, M. H. (1994) J. Cell Biol. 124, 1047-1059 [Abstract/Free Full Text]
  8. Burridge, K., Petch, L. A., and Romer, L. H. (1992) Curr. Biol. 2, 537-539 [CrossRef][Medline] [Order article via Infotrieve]
  9. Juliano, R. L., and Haskill, S. (1993) J. Cell Biol. 120, 577-585 [Free Full Text]
  10. Chen, Y.-P., O'Toole, T. E., Shipley, T., Forsyth, J., LaFlamme, S. E., Yamada, K. M., Shattil, S. J., and Ginsberg, M. H. (1994) J. Biol. Chem. 269, 18307-18310 [Abstract/Free Full Text]
  11. LaFlamme, S. E., Thomas, L. A., Yamada, S. S., and Yamada, K. M. (1994) J. Cell Biol. 126, 1287-1298 [Abstract/Free Full Text]
  12. Lukashev, M. E., Sheppard, D., and Pytela, R. (1994) J. Biol. Chem. 269, 18311-18314 [Abstract/Free Full Text]
  13. Dedhar, S., and Hannigan, G. E. (1996) Curr. Opin. Cell Biol. 8, 657-669 [CrossRef][Medline] [Order article via Infotrieve]
  14. Leung-Hagesteijn, C. Y., Milankov, K., Michalak, M., Wilkins, J., and Dedhar, S. (1994) J. Cell. Sci. 107, 589-600 [Abstract]
  15. Kolanus, W., Nagel, W., Schiller, B., Zeitlmann, L., Godar, S., Stockinger, H., and Seed, B. (1996) Cell 86, 233-242 [CrossRef][Medline] [Order article via Infotrieve]
  16. Sharma, C. P., Ezzell, R. M., and Arnaout, M. A. (1995) J. Immunol. 154, 3461-3470 [Abstract]
  17. Knezevic, I., Leisner, T. M., and Lam, C.-T. (1996) J. Biol. Chem. 271, 16416-16421 [Abstract/Free Full Text]
  18. Horwitz, A., Duggan, K., Buck, C., Beckerle, M. C., and Burridge, K. (1986) Nature 320, 531-533 [CrossRef][Medline] [Order article via Infotrieve]
  19. Otey, C. A., Vasquez, G. B., Burridge, K., and Erickson, B. W. (1993) J. Biol. Chem. 268, 21193-21197 [Abstract/Free Full Text]
  20. Schaller, M. D., Otey, C. A., Hildebrand, J. D., and Parsons, J. T. (1995) J. Cell Biol. 130, 1181-1187 [Abstract/Free Full Text]
  21. Hannigan, G. E., Leung-Hagesteijn, C., Fitz-Gibbon, L., Coppolino, M. G., Radeva, G., Filmus, J., Bell, J. C., and Dedhar, S. (1996) Nature 379, 91-96 [CrossRef][Medline] [Order article via Infotrieve]
  22. Shattil, S. J., O'Toole, T., Eigenthaler, M., Thon, V., Williams, M., Babior, B. M., and Ginsberg, M. H. (1995) J. Cell Biol. 131, 807-816 [Abstract/Free Full Text]
  23. Brown, P. J., and Juliano, R. L. (1988) Exp. Cell Res. 177, 303-318 [CrossRef][Medline] [Order article via Infotrieve]
  24. Frelinger, A. L., III, Cohen, I., Plow, E. F., Smith, M. A., Roberts, J., Lam, S. C.-T., and Ginsberg, M. H. (1990) J. Biol. Chem. 265, 6346-6352 [Abstract/Free Full Text]
  25. Leong, L., Hughes, P. E., Schwartz, M. A., Ginsberg, M. H., and Shattil, S. J. (1995) J. Cell. Sci. 108, 3817-3825 [Abstract]
  26. Kadowaki, H., Kadowaki, T., Wondisford, F. E., and Taylor, S. I. (1989) Gene (Amst.) 76, 161-166 [CrossRef][Medline] [Order article via Infotrieve]
  27. Elledge, S. J., Mulligan, J. T., Ramer, S. W., Spottswood, M., and Davis, R. W. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 1731-1735 [Abstract/Free Full Text]
  28. Printen, J. A., and Sprague, G. F., Jr. (1994) Genetics 138, 609-619 [Abstract]
  29. Bartel, P. L., Chien, C.-T., Sternglanz, R., and Fields, S. (1993) in Cellular Interactions in Development: A Practical Approach (Hartley, D. A., ed), Oxford University Press, Oxford, UK
  30. Estojak, J., Brent, R., and Golemis, E. A. (1995) Mol. Cell. Biol. 15, 5820-5829 [Abstract]
  31. Yang, M., Wu, Z., and Fields, S. (1995) Nucleic Acids Res. 23, 1152-1156 [Abstract/Free Full Text]
  32. Yan, K., Kalyanaraman, V., and Gautam, N. (1996) J. Biol. Chem. 271, 7141-7146 [Abstract/Free Full Text]
  33. Williams, M. J., Hughes, P. E., O'Toole, T. E., and Ginsberg, M. H. (1994) Trends Cell Biol. 4, 109-112 [CrossRef][Medline] [Order article via Infotrieve]
  34. Ylanne, J., Huuskonen, J., O'Toole, T. E., Ginsberg, M. H., Virtanen, I., and Gahmberg, C. G. (1995) J. Biol. Chem. 270, 9550-9557 [Abstract/Free Full Text]
  35. Kashiwagi, H., Eigenthaler, M., Ginsberg, M. H., and Shattil, S. J. (1996) Blood 88, Suppl. 1, 140 (abstr.)
  36. Law, D. A., Nannizzi-Alaimo, L., and Phillips, D. R. (1996) J. Biol. Chem. 271, 10811-10815 [Abstract/Free Full Text]
  37. Du, X., Saido, T. C., Tsubuki, S., Indig, F. E., Williams, M. J., and Ginsberg, M. H. (1995) J. Biol. Chem. 270, 26146-26151 [Abstract/Free Full Text]
  38. Cohen, C., and Parry, D. A. (1990) Trends Biochem. Sci. 11, 245-248 [CrossRef]
  39. Schwartz, M. A., Schaller, M. D., and Ginsberg, M. H. (1995) Annu. Rev. Cell Biol. Dev. Biol. 11, 549-599 [CrossRef][Medline] [Order article via Infotrieve]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Cell Biol.Home page
Y.-Q. Ma, J. Qin, C. Wu, and E. F. Plow
Kindlin-2 (Mig-2): a co-activator of {beta}3 integrins
J. Cell Biol., May 1, 2008; 181(3): 439 - 446.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Larkin, D. Murphy, D. F. Reilly, M. Cahill, E. Sattler, P. Harriott, D. J. Cahill, and N. Moran
ICln, a Novel Integrin {alpha}IIb{beta}3-Associated Protein, Functionally Regulates Platelet Activation
J. Biol. Chem., June 25, 2004; 279(26): 27286 - 27293.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
O. Vinogradova, J. Vaynberg, X. Kong, T. A. Haas, E. F. Plow, and J. Qin
Membrane-mediated structural transitions at the cytoplasmic face during integrin activation
PNAS, March 23, 2004; 101(12): 4094 - 4099.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
D. A. Calderwood
Integrin activation
J. Cell Sci., March 1, 2004; 117(5): 657 - 666.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. S. Roberts, A. J. Woods, P. E. Shaw, and J. C. Norman
ERK1 Associates with alpha vbeta 3 Integrin and Regulates Cell Spreading on Vitronectin
J. Biol. Chem., January 10, 2003; 278(3): 1975 - 1985.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
F. Besta, S. Massberg, K. Brand, E. Muller, S. Page, S. Gruner, M. Lorenz, K. Sadoul, W. Kolanus, E. Lengyel, et al.
Role of {beta}3-endonexin in the regulation of NF-{kappa}B-dependent expression of urokinase-type plasminogen activator receptor
J. Cell Sci., October 15, 2002; 115(20): 3879 - 3888.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. M. Weljie, P. M. Hwang, and H. J. Vogel
Solution structures of the cytoplasmic tail complex from platelet integrin alpha IIb- and beta 3-subunits
PNAS, April 30, 2002; 99(9): 5878 - 5883.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. Zhang, R. E. Clatterbuck, D. Rigamonti, D. D. Chang, and H. C. Dietz
Interaction between krit1 and icap1{alpha} infers perturbation of integrin {beta}1-mediated angiogenesis in the pathogenesis of cerebral cavernous malformation
Hum. Mol. Genet., December 1, 2001; 10(25): 2953 - 2960.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. Hapke, M. Gawaz, K. Dehne, J. Köhler, J. F. Marshall, H. Graeff, M. Schmitt, U. Reuning, and E. Lengyel
{beta}3A-Integrin Downregulates the Urokinase-Type Plasminogen Activator Receptor (u-PAR) through a PEA3/ets Transcriptional Silencing Element in the u-PAR Promoter
Mol. Cell. Biol., March 15, 2001; 21(6): 2118 - 2132.
[Abstract] [Full Text]