Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Anjuère, F.
Right arrow Articles by Luescher, I. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Anjuère, F.
Right arrow Articles by Luescher, I. F.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 13, Issue of March 28, 1997 pp. 8505-8514
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Differential Roles of T Cell Receptor alpha  and beta  Chains in Ligand Binding Among H-2Kd-restricted Cytolytic T Lymphocyte Clones Specific for a Photoreactive Plasmodium berghei Circumsporozoite Peptide Derivative*

(Received for publication, October 7, 1996)

Fabienne Anjuère Dagger §, Dmitry Kuznetsov Dagger , Pedro Romero Dagger , Jean-Charles Cerottini Dagger , C. Victor Jongeneel Dagger and Immanuel F. Luescher Dagger par

From the Dagger  Ludwig Institute for Cancer Research, Lausanne Branch, University of Lausanne, 1066 Epalinges, Switzerland

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

To study the interaction of T cell receptor with its ligand, a complex of a major histocompatibility complex molecule and a peptide, we derived H-2Kd-restricted cytolytic T lymphocyte clones from mice immunized with a Plasmodium berghei circumsporozoite peptide (PbCS) 252-260 (SYIPSAEKI) derivative containing photoreactive Nepsilon -[4-azidobenzoyl] lysine in place of Pro-255. This residue and Lys-259 were essential parts of the epitope recognized by these clones. Most of the clones expressed BV1S1A1 encoded beta  chains along with specific complementary determining region (CDR) 3beta regions but diverse alpha  chain sequences. Surprisingly, all T cell receptors were preferentially photoaffinity labeled on the alpha  chain. For a representative T cell receptor, the photoaffinity labeled site was located in the Valpha C-strand. Computer modeling suggested the presence of a hydrophobic pocket, which is formed by parts of the Valpha /Jalpha C-, F-, and G-strands and adjacent CDR3alpha residues and structured to be able to avidly bind the photoreactive ligand side chain. We previously found that a T cell receptor specific for a PbCS peptide derivative containing this photoreactive side chain in position 259 similarly used a hydrophobic pocket located between the junctional CDR3 loops. We propose that this nonpolar domain in these locations allow T cell receptors to avidly and specifically bind epitopes containing non-peptidic side chains.


INTRODUCTION

CD8+ CTL1 recognize peptides bound to MHC class I molecules on the surface of target cells by means of their TCR (1). Crystallographical studies showed that some peptide side chains intrude into allele specific pockets of the MHC molecule, whereas others are surface exposed and may interact with TCR (2, 3). Conversely, crystallographical studies on a BV8S2A1 encoded TCR beta  chain and an AV4S2 TCR alpha  chain fragment confirmed that TCR are folded in an Ig-like manner but also indicated significant structural differences, such as different hinge structures and interstrand hydrogen bond formation (4, 5). Little is still known on how TCR bind their ligand (MHC-peptide complexes). Based on theoretical considerations, it has been proposed that V-encoded complementary regions CDR1 and CDR2 primarily interact with the MHC molecule, such that the junctional CDR3 are located over the MHC peptide binding groove (6). Support for this concept mainly derives from experiments indicating that CDR3 loops interact with residues of MHC bound peptides (7, 8). One study using immunization of single chain TCR transgenic mice with peptide variants suggested that CDR3alpha interacted with an N-terminal residue of an MHC class II bound peptide and CDR3beta with a C-terminal one (9). A more recent study, using a similar strategy, showed that an N-terminal peptide residue interacted with CDR1alpha or CDR2alpha , while a C-terminal one interacted with CDR3beta , implicating a diagonal orientation, e.g. about 30 °C rotated (10). In contrast, analysis of a Kb-restricted OVA-specific TCR indicated that the most C-terminal residue of this epitope interacted with CDR3alpha (11).

While these studies are in accordance with the current concept of TCR-ligand interactions (6), there are observations that are difficult to explain this way. For example, MHC class II-restricted tetanus toxin tt830-844 reactive T cells exhibited preferential BV2S1 usage but lacked junctional sequence conservation on both chains (12). Furthermore, an Ld-restricted arsonate-reactive CTL clone using the same AV3S1 sequence as an I-Ad-restricted arsonate-reactive one, but an unrelated CDR3alpha junction, also recognized this epitope, suggesting that in this system, CDR3 sequences may not be important (13, 14). Moreover, we found that a TCR specific for the Plasmodium berghei circumsporozoite PbCS peptide 252-260 (SYIPSAEKI) conjugated with 4-azidobenzoic acid (ABA) at Lys-259 bound the photoreactive ligand side chain with CDR3alpha and Vbeta C'-strand/CDR2beta residues (15).

In this previous study, we modified the H-2Kd (Kd)-restricted PbCS 252-260 by replacing Ser-252 with photoreactive iodo-4-azidosalicylic acid (IASA) and by conjugating the TCR contact residue PbCS Lys-259 with ABA, to make IASA-YIPSAEK(ABA)I. CD8+ CTL clones were derived from mice immunized with this conjugate. These recognized IASA-YIPSAEK(ABA)I as well as YIPSAEK(ABA)I in a Kd-restricted manner, but not IASA-YIPSAEKI or the parental PbCS peptide. Selective photoactivation of the IASA group allowed covalent attachment of the conjugate to Kd molecules. Incubation of these complexes with cloned CTL and photoactivation of the ABA group resulted in TCR photoaffinity labeling (15). Unlike PbCS-specific CTL, these clones preferentially expressed BV1S1A1 encoded TCR beta  chains that were paired with Jalpha TA28 encoded alpha  chains (15). Sequences encoded by these TCR gene elements formed a hydrophobic pocket, which was structured and located such that it could efficiently accommodate the photoreactive ligand side chain. In the present study, we replaced PbCS Pro-255 with K(ABA) and produced likewise peptide derivative-specific CTL clones. This residue was chosen because it is surface exposed and critical for T cell recognition (16). Here we report that these CTL clones were remarkably different from the ones described previously in terms of antigen recognition, TCR sequences, and binding of the photoreactive ligand side chain. For a representative TCR, we show a novel binding principle by which TCR can efficiently and specifically bind a chemically modified epitope.


EXPERIMENTAL PROCEDURES

Peptide and Conjugate Synthesis and Analysis

Reagents for chemical synthesis were obtained from Bachem Finechemicals (Bubendorf, Switzerland), Pierce, and Sigma. All synthetic and analytical procedures were performed essentially as described (17, 18). In brief, peptides were synthesized on an Applied Biosystem Instruments 431 peptide synthesizer (ABI, Foster City, CA) using Fmoc (N-(9-fluorenyl)methoxycarbonyl) for transient protection. The deprotected peptides and peptide derivatives were purified by HPLC on a C-18 column (1 × 25 cm, Macherey Nagel, Oensingen, CH) using a Waters 600E HPLC system equipped with an in-line 1000 S diode array UV photo-spectrometer (Applied Biosystem Instruments). The column was eluted by a linear gradient of acetonitrile on 0.1% trifluoroacetic acid in water, rising within 1 h from 0 to 75%. All compounds displayed the expected UV spectra (17, 19, 20). ANBA-YIKSAEKI displayed UV absorption maxima at 214 and 280 nm, and the UV absorption at 350 nm was approximately 7% of the one at 280 nm. The mass of all purified compounds were verified by mass spectrometry on an LDI 7000 mass spectrometer (Linear Scientific, Reno, CA). Radiosynthesis of 125IASA-YIK(ABA)SAEKI and Dap(125ISA)-YIK(ABA)SAEKI was performed by radioiodination of ASA-Y(PO3H2)IK(ABA)SAEKI and Dap(ISA)-Y(PO3H2)IK(ABA)SAEKI, respectively, followed by enzymatic dephosphorylation. The HPLC-purified products were lyophilized and immediately used for photoaffinity labeling experiments.

Kd and TCR Photoaffinity Labeling

Soluble monomeric Kd-peptide derivative complexes were prepared by incubating purified Kd with 125IASA-YIK(ABA)SAEKI followed by UV irradiation at >= 350 nm and FPLC gel filtration as described by Luescher et al.(15, 17). For TCR photoaffinity labeling, 107 cpm of Kd-"125IASA"-YIK(ABA)SAEKI were incubated with 107 CTL, resuspended in 1 ml of Dulbecco's modified Eagle's medium supplemented with 2% fetal calf serum and 20 mM HEPES, on ice for 3 h followed by UV irradiation at 312 ± 40 nm. For two-dimensional gel analysis and peptide mapping, peptide derivative-Kd cross-linking was prevented by using the monofunctional PbCS derivative Dap(ISA)-YIK(ABA)SAEKI as described previously (15). 1 mCi of Dap(125ISA)-YIK(ABA)SAEKI was incubated with 50 µg of Kd for 2 h at ambient temperature prior to addition of 4 × 107 cloned CTL in 2 ml of medium (see above) containing beta -2 microglobulin (2.5 µg/ml). After 2-3 h of additional incubation at 0-4 °C, the incubations were UV irradiated at 312 ± 40 nm.

Immunoprecipitation and Gel Electrophoresis

The photoaffinity labeled cells were washed twice with cold PBS and lysed on ice in PBS (1 × 107 cells/ml) supplemented with 0.7% Nonidet P-40, HEPES, phenylmethylsulfonyl fluoride, leupeptin, and iodoacetamide as described (17). After centrifugation (3 min at 15,000 × g), the detergent-soluble fractions were membrane filtered and subjected to immunoprecipitation with the anti-TCR Cbeta mAb H57-597 or the anti-Kd alpha 3 mAb SF1-1.1.1 as described (17). For two-dimensional gel analysis and peptide mapping, TCR were immunoprecipitated with H57-597 mAb on protein A-Sepharose as described (17, 19, 20). The washed and lyophilized Sepharose was resuspended in sample buffer for IEF, and after a 1-h incubation at 37 °C, the supernatants were subjected to disc IEF followed by SDS-PAGE as described (21). All antibodies were obtained from American Type Culture Collection (ATCC, Rockville, MD).

Peptide Mapping

The photoaffinity labeled and immunoprecipitated W13 TCR was reduced and denatured in 200 µl of 100 mM Tris buffer, pH 8.0, supplemented with 8 M urea, 100 mM 2-mercaptoethanol, and 1% Nonidet P-40, at 37 °C for 1 h. To the supernatant, 400 µl of 500 mM Tris, pH 8.0, containing 100 mM iodoacetic acid were added. After incubation for 1 h at 20-24 °C, the samples were dialyzed at 4 °C in 25-kDa membrane tubings (Spectrapore) against 3 × 1 liter of distilled water. Following lyophilization, aliquots were reconstituted in 500 µl of either 100 mM Tris, pH 8.0 (for tryptic digests), or 100 mM phosphate buffer, pH 7.8 (for V-8 digests), containing M guanidine hydrochloride, both containing 10% acetonitrile, and subjected to tryptic or protease V-8 peptide mapping as described (15) except that a C-18 column was used for HPLC (4 × 250 mm, 5 µm particle size, Vydac, Hisperia, CA). In brief, 10 µg aliquots of trypsin or protease V-8 (Boehringer Mannheim) were added in 12-h intervals, and after 48 h of incubation at 37 °C, the digests were subjected to HPLC. Radioactivity was monitored by gamma  counting of 1 ml fractions and chromatography by measuring the A214 nm of standards including NE-(2,4-dinitrophenyl)Lys (elution time 29.1 min), approximately YIPSAEKI (23.6 min), MAVDPIGHLY (26.7 min), ASNENMDAM (30.1 min), and oxidized insulin beta  chain (37.7 min) (Sigma). The maximal variation tolerated was ±1 min. For secondary peptide mapping, labeled digest fragments were reconstituted in 300 µl of 100 mM phosphate buffer, pH 7.4, containing 50 µg of bovine gamma -globulin and 10% acetonitrile. Endoprotease Pro-C (gift from Dr. J. Gagnon, Biologie Structurale, C.E.A. and C.N.R.S., URA 1333, Grenoble, France) was added in 10-µg aliquots in 12-h intervals, and after 36-48 h, the samples were subjected to HPLC. SDS-PAGE analysis of labeled digest fragments was performed as described (22).

Generation of ANBA-YIK(ABA)SAEKI-specific CTL Clones

Cloned CTLs were obtained as described previously (15, 16). In brief, (BALB/c × C57BL/6) F1 mice were immunized with ConA spleen blasts expressing covalent Kd-"ANBA"-YIK(ABA)SAEKI complexes. Cultures of peritoneal exudate lymphocytes were stimulated in vitro over two 7-day intervals. Viable cells were cloned 7 days after the second in vitro stimulation by fluorescence-activated cell sorting of CD8+ cells into 96-well plates. The clones were stimulated weekly with 2 × 104 gamma -irradiated P815 pulsed before hand with 1 µM of ANBA-YIK(ABA)SAEKI and 3 × 105 gamma -irradiated BALB/c splenocytes. All rapidly expanding cultures were tested as described below. The U, V, and W clones were derived from three different mice.

Cytolytic Assays

The cytolytic activity of the CTL clones under study was assessed in a standard 51Cr release assay as described previously (16, 23). In brief, 51Cr-labeled P815 cells or Kd transfected L cells (L-Kd) (2 × 103 cells/well) were incubated with a constant number of CTLs (6 × 103 cells/well) and serial dilutions of peptide derivative or peptide derivative variants in V-bottom microplates. The L-Kd and L-Kd mutants have been described previously (24). After 4 h of incubation at 37 °C, the released 51Cr was measured, and the specific lysis was calculated in percent as 100 × (experimental-spontaneous release)/(total-spontaneous release). The relative antigenic activities were calculated by dividing the concentration of ANBA-YIK(ABA)SAEKI required for half-maximal lysis by that required for the peptide derivative variants. The Kd competitor activity, expressing the ability of a peptide derivative to bind to Kd, was assessed in a recognition-based competition assay as described (23). In brief, 51Cr-labeled P815 cells were incubated with three-fold dilutions of the test peptide derivatives prior to addition of the antigenic HLA-Cw3 peptide 170-179 (RYLKNGKETL) and Cw3-specific cloned CW3/1.1 CTL. After 4 h of incubation, the 51Cr release was measured. The Kd competitor activity of each compound was calculated relative to the one of ANBA-YIK(ABA)SAEKI, which was defined as 1. For the sake of comparison, the relative antigenic activities of the different peptide variants were normalized by dividing the relative antigenic activity by the corresponding relative Kd competitor activities.

TCR Sequence Analysis

Total RNA extraction was performed using the isothiocyanate acid-phenol method. cDNA synthesis was carried out on total RNA with AMV reverse transcripts following the supplier instructions (Boehringer Mannheim, Rotkreuz, Switzerland). Screening of junctional regions of alpha  and beta  chains was performed by PCR using primers as described in Ref. 25. Purified PCR products were sequenced with Sequenase Version 2.0 kit (U. S. Biochemicals, Cleaveland, OH) and alpha  [35S]dATP following the supplier instructions. For sequencing of the Valpha of W13 and U4, the primers W135' (GACCGAATTCAGATGACACTAAAGATGGAC) and W133' (CAACGTGGATCCACAGGGAACGTCTGAACTGG) were used.

Molecular Modeling

Models of the W13 TCR and Kd-ANBA-YIK(ABA)SAEKI complex were built using the ICM software (26). For the beta  chain, we used as template the crystal coordinates of a BV8S2A1 encoded beta  chain (4). A crude model of the W13 Vbeta chain was obtained using the ProMod package (27) and was subjected to a standard energy minimization with X-PLOR and followed by a regularization of the geometry with ICM (the RMSD between the initial and the regularized structures was 0.49 Å for non-hydrogen atoms). Similarly, the model of the W13 TCR Valpha chain was obtained by homology modeling using the x-ray structure of AV4S2 (5) as a template. The resulting Valpha model (RMSD between the template and the modeled structure was 1.0 Å for 106 Calpha atoms) was associated with the Vbeta model to form a Valpha -Vbeta complex, starting with the geometry of an Ig VH/VL domain. After minimization of the complex, possible conformations of the CDR3 loops were searched using a local deformation Monte-Carlo procedure. The Kd-ANBA-YIK(ABA)SAEKI complex was modeled on the basis of the x-ray structure of H-2Kb as described before (15). As the PbCS peptide derivative contains non-canonical amino acids, namely K(ABA) and ANBA, models for these residues were generated using the molecular editor of the HyperChem package. Atom charges were calculated using the CNDO/2 method. The files containing the resulting coordinates and charges were imported and processed by ICM to produce ICM library entries used in subsequent modeling. The structure of the trimolecular complex, consisting of W13 Valpha -Vbeta docked to the Kd-peptide complex, was obtained by several cycles of the following procedures and guided by the experimental data derived from the mapping of the photoaffinity labeled site and the effects of mutations in Kd: 1) local deformation Monte-Carlo search of an optimal conformation for Valpha -Vbeta CDR loops within the field of the Kd-peptide surface; 2) Monte-Carlo search of the optimal position of the side chains of all residues of the interface between TCR and ligand; 3) a constrained Brownian-like "walk" of the ligand around the TCR; and 4) exhaustive minimization of the whole structure. The resulting structure was checked visually as well as by calculation of the local electrostatic interactions in the K(ABA) binding pocket.


RESULTS

To produce a new family of "photoprobe"-specific CTL clones, we prepared a photoreactive derivative of the PbCS peptide 252-260 by replacing Pro-255 with K(ABA). To cross-link the peptide derivative to Kd, Ser-252 was replaced with IASA to make IASA-YIK(ABA)SAEKI. As assessed in a recognition-based competition assay, this derivative bound to Kd nearly 100-fold less efficiently than the parental PbCS peptide, but replacement of IASA with ANBA, Nbeta -IASA-2,3-L-diaminopropionic acid (Dap(IASA)), or Nbeta -(iodo-salicyloyl)-2,3-L-diaminopropionic acid (Dap(ISA)) restored efficient Kd binding (2-3-fold less than the PbCS peptide). However, since ANBA-YIK(ABA)SAEKI was not available in radioactive form and Dap(IASA)-YIK(ABA)SAEKI very inefficiently photoaffinity labeled Kd, 125IASA-YIK(ABA)SAEKI was used for radioactive photoaffinity labeling experiments.

Antigen Recognition by ANBA-YIK(ABA)SAEKI-specific CTL Clones

From 14 independent CTL clones derived from mice immunized with ANBA-YIK(ABA)SAEKI, seven that exhibited efficient TCR photoaffinity labeling were selected for further studies. As shown for a representative experiment in Table I, the concentration of ANBA-YIK(ABA)SAEKI required for half-maximal lysis of P815 target cells was in the range of 0.5 (V8 clone) to 150 pM (U3 clone), which is comparable with other Kd-restricted CTL clones (15, 16). The recognition by all clones was inhibited by the anti-Kd alpha 1 mAb 20-8-4S, indicating that they were Kd-restricted (data not shown).

Table I.

Recognition of PbCS peptide derivatives by seven independent CTL clones


Normalized relative antigenic activitya

      ABA  ABA  ABA    ABA  ABA   Ac
       |   |   |     |   |   |
CTL clone ANBA-YIKSAEKI YIKSAEKI YIKSAEKI YIKSAEAI YI Orn SAEKI YIKSAE Orn I YIKSAEKI

50% [1]b
[2]
[0.1]
[2.7]
[0.6]
[1]
[1.5]
pM
U3 150c 4 <10-4 <10-4 0.03 0.3 0.03
U4 20 2 <10-5 <10-5 <10-5 <10-5 0.6
V8 0.5 0.3 <10-6 10-6 <10-5 <10-5 0.004
V13 3 0.2 <10-5 <10-6 <10-6 0.01 0.1
V17 10 0.4 0.002 <10-5 <10-5 <10-6 0.1
V19 1 0.1 <10-6 <10-6 0.05 <10-5 0.003
W13 27 5 <10-5 <10-5 <10-4 <10-4 0.08

a The normalized relative antigenic activities of the peptide derivatives were calculated by dividing the relative antigenic activities by the relative Kd competitor activities (see "Experimental Procedures").
b The relative Kd competitor activities were calculated relative to the one of ANBA-YIK(ABA)SAEKI.
c The numeric values indicate the concentration (pM) of ANBA-YIK(ABA)SAEKI required for 50% maximal lysis (51Cr release) by the corresponding CTL clones. Dilutions (3-fold) of the peptide derivative were made in the range of 10-5-10-15 M. These values were used to calculate the relative antigenic activity of the other conjugates.

All clones efficiently recognized the derivative lacking the N-terminal photoreactive group (YIK(ABA)SAEKI), but none detectably recognized the derivative lacking ABA (YIKSAEKI) except for a very inefficient recognition by the V17 clone (Table I). Interestingly, all clones recognized, though some inefficiently, the variant containing acetyl in place of ABA (YIK(Ac)SAEKI), suggesting that the Nepsilon amide bond of K(ABA) may participate in TCR-ligand binding. Moreover, the derivatives containing alanine or K(Ac) in place of Lys-259 (YIK(ABA) SAEAI or YIK(ABA)SAEK(Ac)I) were not detectably recognized by all clones (Table I and data not shown). Shortening of K(ABA) by one methylene group (YIOrn(ABA)SAEKI) abolished recognition by all except the U3 and V19 clones, which inefficiently recognized this derivative. Similarly, shortening of Lys-259 (YIK(ABA)SAEOrnI) abolished the recognition by all but the U3 and V13 clones, which recognized this variant 3- and 100-fold, respectively, less efficiently (Table I). These results demonstrate that K(ABA) and Lys-259, but not the N-terminal photoreactive group, were essential parts of the epitope recognized by these clones and that generally the full spacer length of these side chains was required for efficient antigen recognition.

To obtain information on TCR-Kd contacts, we assessed the ability of the CTL clones to recognize ANBA-YIK(ABA)SAEKI on L cells expressing mutant Kd molecules. The mutations were single alanine substitutions of surface exposed residues in the middle parts of the alpha 1 and alpha 2 helices (e.g. Glu-62, Gln-65, Ser-69, Gln-72, Gln-149, Glu-154, Tyr-155, and Glu-163). As shown for a representative experiment in Fig. 1, the recognition of ANBA-YIK(ABA)SAEKI by all clones, except the V17 clone, was impaired or abolished by at least one of the Kd alpha 1 mutations E62A, S69A, or Q72A. In contrast, of the Kd alpha 2 mutations, only Y155A dramatically affected the recognition by all clones. This effect, however, is explained in part by reduced peptide derivative binding by this Kd mutant (24).


Fig. 1. Effect of Kd mutations on ANBA-YIK(ABA)SAEKI recognition by specific CTL clones. L cells expressing Kd molecules containing single alanine substitutions in the indicated positions of the alpha 1 and alpha 2 helices were tested in 51Cr release assay as described under "Experimental Procedures." White boxes indicate normalized antigenic activities of 1-0.1, hatched boxes indicate activities of 0.1-0.001, and black boxes indicate activities of <0.001. For normalization, the specific lysis measured on L cells expressing wild-type Kd (Kd wt) was used as reference. No lysis was detectable on untransfected L cells (LM1).
[View Larger Version of this Image (31K GIF file)]


TCR Photoaffinity Labeling

For TCR photoaffinity labeling, covalent Kd-peptide derivative complexes were used, which were obtained by photoaffinity labeling of soluble Kd with 125IASA-YIK(ABA)SAEKI. This derivative, upon correction for its reduced Kd binding, was recognized by all clones as efficiently as ANBA-YIK(ABA)SAEKI (data not shown). Following incubation of the cloned CTL with Kd-peptide derivative complexes and photoactivation of the ABA group, the cells were detergent solubilized and the lysates subjected to immunoprecipitation. The immunoprecipitates with an anti-TCR mAb migrated on SDS-PAGE under reducing conditions with an apparent molecular mass of 87-92 kDa (Fig. 2A). Since TCR are composed of disulfide-linked alpha  and beta  chains, 38-45 kDa each (21), the molecular mass of these materials corresponded to trimolecular complexes consisting of Kd heavy chain (45 kDa), the peptide derivative (~1,400 Da), and one TCR chain.


Fig. 2. TCR photoaffinity labeling on ANBA-YIK(ABA)SAEKI-specific CTL clones. A, cloned CTL U3 (lane 1), U4 (lane 2), V8 (lane 3), V13 (lane 4), V17 (lane 5), V19 (lane 6),and W13 (lane 7) were incubated with soluble, covalent Kd-"125IASA"-YIK(ABA)SAEKI. After UV irradiation, the immunoprecipitated TCRs were analyzed by SDS-PAGE (10%, reducing conditions) and autoradiography. B, specificity of W13 TCR photoaffinity labeling. W13 cells were incubated with "125IASA"-YIK(ABA)SAEKI in the absence (lane 1) or presence of 300-fold molar excess of peptide PbCS 253-260 (lane 2) or peptide Ad5 E1a 234-243 (lane 3). Alternatively, W13 cells were incubated with covalent soluble Kd-"125IASA"-YIK(ABA)SAEKI in the absence (lanes 4, 5, 6, and 9) or presence of anti-Kd alpha 1 mAb 20-8-4S (lane 7) or anti-Db mAb 34-4-20S (lane 8). After UV irradiation, total cell lysate (lane 4) or immunoprecipitates with anti-TCR Cbeta mAb (lanes 1, 2, 3, 6, 7, 8, and 9) or with anti-Kd alpha 3 mAb (lane 5) were analyzed by SDS-PAGE under reducing (lanes 1-8) or non-reducing conditions (lane 9).
[View Larger Version of this Image (37K GIF file)]


To assess the specificity of TCR photoaffinity labeling, cloned W13 CTL were incubated with 125IASA-YIK(ABA)SAEKI in the absence or presence of a 300-fold molar excess of peptide PbCS 252-260 or the Db-restricted peptide Ad5 E1a 234-243 (Fig. 2B, lanes 1-3). Following UV irradiation at 312 ± 40 nm, which activates the IASA and ABA groups, the cells were analyzed as in the previous experiment. The TCR photoaffinity labeling observed in the absence (lane 1) or presence of the Db binding peptide (lane 3), was abolished in the presence of the Kd binding PbCS peptide (lane 2), indicating that TCR photoaffinity labeling required peptide derivative binding to Kd (of CTL) and that free conjugate was unable to detectably label the TCR. The same findings were obtained for the other clones (data not shown).

Analysis of total lysate of W13 cells labeled with Kd-"125IASA"-YIK(ABA)SAEKI on SDS-PAGE under reducing conditions showed two labeled species of apparent molecular masses of 45 and 90 kDa, respectively (lane 4). These materials correspond to the Kd-peptide derivative complex and the TCR-ligand complex, respectively. The absence of other labeled species shows that the TCR photoaffinity labeling was remarkably selective. The same labeled species were observed following immunoprecipitation with anti-Kd alpha 3 mAb SF1-1.1.1 (lane 5), which precipitates free as well as ligand cross-linked with TCR (17). Upon immunoprecipitation with anti-TCR mAb, only the trimolecular complex was observed (lane 6). This TCR photoaffinity labeling was inhibited by the anti-Kd alpha 1 mAb 20-8-4S (lane 7), which prevents Kd-TCR interactions (17), but not by the anti-Dd mAb 34-4-20S (lane 8). Finally, when analyzed by SDS-PAGE under nonreducing conditions, labeled material of approximately 130 kDa was observed (lane 9). This increase in molecular mass corresponds to the second TCR chain, which is part of the trimolecular complex under these conditions. These results demonstrate that the TCR photoaffinity labeling was specific and required peptide derivative presentation by Kd.

Assessment of the Photoaffinity Labeled TCR Chain

To identify which TCR chain was photoaffinity labeled, W13 TCR was labeled with Kd-associated Dap(125ISA)-YIK(ABA)SAEKI. This conjugate was recognized by all CTL clones as efficiently as ANBA-YIK(ABA)SAEKI (data not shown) but, due to lacking an N-terminal photoreactive group, was unable to cross-link to Kd. The immunoprecipitated TCRs were analyzed by two-dimensional gel electrophoresis in which the first dimension was IEF and the second SDS-PAGE. As shown in Fig. 3A, labeled material with an IP of about 4.9 and an apparent molecular mass of approximately 43 kDa was observed. Alternatively, W13 cells were surface radioiodinated and analyzed likewise. The same analysis showed two labeled materials, one of which migrated very similarly to the one in the previous experiment while the other had an IP of about 6.5 and an apparent molecular mass of approximately 44 kDa (Fig. 3B). Since both TCR chains have similar molecular mass but the IP of alpha  chains are acidic (IP 4-5) and those of beta  chains nearly neutral (21), these results indicate that the W13 TCR was photoaffinity labeled selectively at the alpha  chain. The same analysis was performed with the other clones. As shown in Fig. 3C, all clones were labeled selectively at the alpha  chain except for the V17 TCR, which was labeled 70% at the alpha  chain and 30% at the beta  chain.


Fig. 3. Two-dimensional gel electrophoresis of labeled TCR. W13 cells were photoaffinity labeled with Dap(125ISA)-YIK(ABA)SAEKI (A) or were surface radioiodinated (B). The immunoprecipitated TCR were analyzed by two-dimensional gel electrophoresis in which the first dimension (horizontal) was IEF and the second (vertical) SDS-PAGE (10%), both under reducing conditions. The same analysis was performed on the other clones. The densitometric evaluation of the autoradiograms are summarized in panel C. 100% is the total TCR photoaffinity labeling.
[View Larger Version of this Image (36K GIF file)]


TCR Sequencing by PCR

PCR using V region-specific primers showed that four of the seven clones (U4, V8, V19, and W13) expressed BV1S1A1 encoded beta  chains (Table II, left). Sequencing indicated that their junctional, CDR3beta equivalent regions, were 11-12 residues long and contained Ser in position 1, Gln in position 2, Asp or Glu in position 3, Gly in positions 5 and 6, usually Glu in position 10, and Leu in PC (Table II, left). The corresponding Jbeta were different, but all, except one (U4), belonged to the Jbeta 2 family. Of the remaining clones, two expressed BV8S1 (U3 and V17) and one expressed BV13S1 (V13). The corresponding CDR3beta s were more diverse but always acidic. The same analysis performed on the alpha  chains indicated that the Valpha , Jalpha , and CDR3alpha sequences were diverse. For the V8 clone, none of the Valpha -specific primers (22) used for screening (25) detected an in-frame transcript. Performing the same analysis on six additional ANBA-YIK(ABA)SAEKI-specific CTL clones showed a very similar pattern (data not shown). The finding that specific TCR-beta , but not -alpha , sequences were selected was puzzling because these TCR were selectively photoaffinity labeled at the alpha  chain (Fig. 3C).

Table II.

TCR gene elements usage and TCR junctional amino acid sequences

Seven ANBA-YIK(ABA)SAEKI-specific CTL clones are listed on the vertical axis. The TCR-beta (left) and alpha  (right) segments consistent with an open reading frame, encoding for junctional, putatively CDR3-like, regions are known. For Valpha and Vbeta , the nomenclature described in Ref. 36 was used.


CTL clone TCR-beta
TCR-alpha
Vbeta FW CDR3 FW Jbeta Valpha FW CDR3 FW Jalpha

U4 1S1A1 CAS SQDVGGSNERL FFG 1.4 4S3 CAL GDRTGSGGKL TLG TA46
V8 1S1A1 CAS SQETGGVAETL YFG 2.3 4 CAL Out of frame TFG J101
No Valpha in frame found
V19 1S1A1 CAS SQDWGGAGQNTL YFG 2.4 2S1 CAA KGI FFG JMD13
10 CAM Out of frame TFG J11.3
W13 1S1A1 CAS SQDLGGSAETL YFG 2.3 4S10 CAL STDYSNNRL TLG W13
1 CAA Out of frame
U3 8S1 CAS SDNQDTQ YFG 2.5 11S2 CAA EANTDKV VFG JF1.12
V17 8S1 CAS SDSGTDNQRP LFG 1.5 5S1 CAP SRGKL IFG J1.14
4 Out of frame HFG J34S.281
V13 13S1 CAS SYYQANTEV FFG 1.1 10S1 CAM PDTNAYKV IFG JF3.2
4 Out of frame FFG JMD13

Mapping of the TCR Photoaffinity Labeled Site on the W13 TCR

To elucidate this paradox, we mapped the photoaffinity labeled site on a representative TCR, the W13 TCR, which was BV1S1A1 and AV4S10 encoded (Table II). To this end, W13 TCR was photoaffinity labeled with Kd-associated Dap(125ISA)-YIK(ABA)SAEKI and following reduction and alkylation, was extensively digested with protease V-8. The resulting digest fragments were separated by HPLC on a C-18 column. As shown in Fig. 4A, the major labeled fragments reproducibly eluted from the column after approximately 33 min. On SDS-PAGE, this material was homogeneous and migrated with an apparent molecular mass of about 4,300 Da (Fig. 4F, lane 1). The later eluting labeled materials migrated slower on SDS-PAGE (apparent molecular masses of about 8,300 Da, 38 min, and 13,000 Da, 44 min, respectively) and were more abundant after shorter digest periods, suggesting that they were incomplete digest products.


Fig. 4. Peptide mapping of photoaffinity labeled W13 alpha  chain. Immunoprecipitated W13 TCR photoaffinity labeled Dap(125ISA)-YIK(ABA)SAEKI was reduced and alkylated and digested with protease V8 (A) or trypsin (B), and the digest fragments were subjected to C-18 HPLC. The principal labeled primary V-8 digest fragment was digested with trypsin and subjected to HPLC (C). Alternatively, the primary V-8 (D) or tryptic (E) digest fragments were digested with endoprotease Pro-C, and the resulting fragments were separated by C-18 HPLC. The labeled fragments were analyzed by SDS-PAGE (F): lane 1, fraction 33 of panel A; lane 2, fraction 33 of panel B; lane 3, fraction 32 of panel C; lane 4, fraction 31 of panel D; and lane 5, fraction 30 of panel E.
[View Larger Version of this Image (34K GIF file)]


When trypsin was used for digestion, the major labeled fragments also eluted after about 33 min (Fig. 4B). On SDS-PAGE, this material was homogeneous but migrated slightly faster (apparent molecular mass of about 3,800 Da) than the major labeled V-8 digest fragment (Fig. 4F, lane 2). A second labeled tryptic digest fragment eluted from the HPLC column after 38-39 min and migrated on SDS-PAGE with an apparent molecular mass of about 7,600 Da. This component again was more abundant after shorter digest periods, suggesting that it was an incompletely digested fragment (data not shown).

Digestion of the labeled primary V-8 digest fragment with trypsin resulted in a new fragment that by HPLC and SDS-PAGE was indistinguishable from the labeled primary tryptic fragment (Fig. 4, C and F, lane 3). Treatment of the primary tryptic fragment with V-8 yielded no new product according to HPLC and SDS-PAGE (data not shown). As shown in Fig. 5, the W13 TCR Valpha /Jalpha sequence contains only two prolines, Pro-32 and Pro-41. To assess whether the labeled primary V-8 and tryptic digest fragments contained prolines, they were treated with endoprotease Pro-C. As shown in Fig. 4, D and F (lane 5), this enzyme converted the labeled primary V-8 digest fragment into a new fragment, which eluted from the HPLC column 2 min earlier and, by SDS-PAGE, had an apparent molecular mass of about 2,000 Da. Similar results were obtained when the labeled primary tryptic digest fragment was treated with Pro-C (Fig. 4, E and F, lane 4).


Fig. 5. Amino acid sequence of W13 TCR alpha  chain (A) and beta  chain (B) variable domains. The protease V-8 cleavage sites (E and D) are indicated by triangles, and those of trypsin (R and K) are indicated by squares and circles, respectively. The endoprotease Pro-C cleavage sites (P) are indicated by a diamond. Open boxes indicate CDR1, CDR2, and CDR3 loops, and the hatched box indicates the segment containing the photoaffinity labeled sites.
[View Larger Version of this Image (24K GIF file)]


Since the W13 sequence contains only two prolines (Fig. 5A) and Pro-C is highly specific for proline peptide bonds (28), these results indicate that both labeled primary digest fragments contain prolines. Moreover, the high similarity between both labeled secondary Pro-C digest fragments very strongly suggests that the labeled site was contained in the sequence between Pro-32 and Pro-41 (e.g. segment 33-41). This is consistent with the observed molecular mass and the finding that the same secondary Pro-C digest fragments were observed upon treatment of the minor, later eluting labeled primary V-8 or tryptic fragments (data not shown). If this were correct, the labeled primary V-8 digest fragment would correspond to residues 15-43, and the primary tryptic fragment would correspond to residues 17-39. This is in accordance with the observed apparent molecular mass (Fig. 4F, lanes 1 and 2) but also with the finding that the labeled primary and secondary tryptic digest fragments were very similar, and slightly smaller than the labeled primary V-8 digest fragment. Logically, the photoaffinity labeled site needs to be contained in the sequence common to these fragments, which is the segment 33-39 (Fig. 5A).

Computer Modeling of the W13 TCR and Its Ligand

To better understand in structural terms the data obtained, we built models of the ligand and the W13 TCR. The TCR model suggests the presence of a deep hydrophobic pocket between CDR1alpha , CDR2alpha , CDR3alpha , and CDR3beta (Fig. 6A), which is confined in essence by the side chains of CDR3beta Ser-99 and Ala-100 and CDR3alpha Ser-94 and Leu-102 and the Valpha residues Asn-33 and Phe-35 (C-strand) and Ala-92 (F-strand) (Fig. 6, B and C). As suggested by docking experiments, this pocket, upon small structural changes, can avidly bind the K(ABA) side chain of the ligand (Fig. 6, A and C, and data not shown). The main forces driving this interaction include: i) hydrophobic interactions (e.g. the pocket and K(ABA) side chain evading contact with water), ii) significant Van der Waals interactions due to high complementarity of pocket and side chain, iii) 8pi -8pi interaction of the ABA azido substituent with the phenyl moiety of Valpha Phe-35, and iiii) hydrogen bond formation of the ABA carbonyl oxygen, the most polar atom of this side chain, with CDR3alpha Ser-94 (Fig. 6B). This prediction is consistent with the finding that the photoaffinity labeled sites were contained in the Valpha segment 33-39 (Figs. 4 and 5).


Fig. 6. Computer models of the W13 TCR and Kd-ANBA-YIK(ABA)SAEKI complex. A, the surface contour of the W13 TCR ligand binding site is shown. The alpha  chain is in light blue and the beta  chain is in dark blue. Yellow domains indicate hydrophobic regions. The carbon backbone of ANBA-YIK(ABA)SAEKI is shown in white, and the side chains of K(ABA) and Lys-259 are in red. B and D show details of the K(ABA) side chain (in red) bound in the hydrophobic pocket formed by the Valpha C-strand (carbon backbone in light blue and side chains of F-35 and Tyr-37 in orange), F-strand-CDR3-Jalpha (carbon backbone same color and side chains of Tyr-90, Ala-92, Leu-93, Ser-94, Leu-102, and Leu-104 in green). CDR3alpha spans from Ser-94 to Leu-102. CDR3beta (carbon backbone in dark blue and side chains of Ser-99 and Ala-100 in purple) confine, in part, the opening of the pocket. D, shown is the Kd-ANBA-YIK(ABA)SAEKI complex as seen from the TCR. The carbon backbone of Kd is in gray with the side chains of Glu-62, Ser-69 (on alpha 1 helix), and Tyr-155 (on alpha 2 helix) in yellow. The carbon backbone of ANBA-YIK(ABA)SAEKI and the side chains of K(ABA) and Lys-259 are shown in red.
[View Larger Version of this Image (76K GIF file)]


According to our ligand model, the K(ABA) side chain of Kd-bound ANBA-YIK(ABA)AEKI is very extended and "leans over" to the Kd alpha 2 helix (Fig. 6D). A very similar orientation was obtained when the ligand was modeled alone or together with the W13 TCR (data not shown). The Kd residues Glu-62, Ser-69, and Tyr-155, which upon alanine substitution dramatically affected the antigen recognition by the W13 clone (Fig. 1), are located on the surface of the alpha 1 and the alpha 2 helices, respectively.

While the available crystallographical coordinates permitted modeling of the TCR framework, including the hydrophobic pocket, with good accuracy, conclusive modeling of CDR3 loops was elusive because of the high number of possible, energetically equivalent conformers. We therefore modeled these loops by using the ligand surface as "template" to define loop conformations that provide the lowest energy of the TCR-ligand complex. These docking experiments were based on the assumptions that 1) the ligand K(ABA) side chain inserts in the hydrophobic pocket of the W13 TCR, 2) the Kd residues Glu-62, Ser-69, and Tyr-155, but not Gln-65, Gln-72, Gln-149, Glu-154, or Glu-163, interact with the TCR, and 3) Asp-95 or Glu-101 of CDR3beta interact with PbCS Lys-259. The latter assumption was made based on the finding that the W13 TCR (and most other TCR of that specificity) has two acidic residues in CDR3beta , but none in CDR1 and CDR2 of both chains (Fig. 5). These experiments suggest that the W13 TCR interacts with its ligand in the orientation shown in Fig. 6A, in which the C-terminal portion of the Kd-bound peptide is located underneath CDR3beta , and the N-terminal portion is underneath CDR3alpha . It is noteworthy that the helices of Kd, especially the alpha 2 helix, are slanted, and the W13 TCR has a complementary surface contour, which provides a maximal surface contact in this orientation (data not shown).


DISCUSSION

To study TCR-ligand interactions by TCR photoaffinity labeling, we derived CTL clones from mice immunized with the PbCS peptide derivative ANBA-YIK(ABA)SAEKI. As in previous studies with other photoreactive PbCS peptide derivatives (15, 16), ANBA-YIK(ABA)SAEKI-specific CTL were readily obtained. The "photoprobe"-specific CTL described here, as well as those described previously, displayed all the hallmarks of antigen recognition by "conventional" CTL, including MHC restriction and dependence on auxiliary molecules (i.e. CD8 and LFA-1) (Fig. 2 and data not shown) (17, 29). Similarly, numerous reports described CD8+ as well as CD4+ T cells that recognize antigens modified with haptens such as trinitrophenyl, benzoarsonate, or fluorescein but also with carbohydrates (13, 30-32). The epitopes recognized by these T cells, as far as is known, are MHC bound peptides that contain nonpeptidic entities. Thus, while antigen recognition by T cells is MHC restricted, it is not limited to conventional peptides but clearly can include a vast array of structures. In several cases, such T cell reactivities have been shown to play a role in disorders such as drug allergies or delayed type hypersensitivities (33).

The epitope recognized by ANBA-YIK(ABA)SAEKI-specific CTL clones included two peptide derivative residues, K(ABA) and PbCS Lys-259 (Table I). The latter residue was also essential for the recognition of the PbCS 252-260 peptide by most PbCS-specific CTL clones (16). Similarly, the antigen recognition by IASA-YIPSAEK(ABA)I-specific CTL clones required K(ABA) in position 8 (15). These findings demonstrate that for the PbCS system, the residue in position 8 is a primary TCR contact residue. This is consistent with computer modeling suggesting that this ligand residue is fully solvent exposed (Fig. 6D and Ref. 15). However, the three systems differed regarding the residue in position 4. For PbCS and IASA-YIPSAEK(ABA)I-specific CTL PbCS, Pro-255 was a secondary TCR contact residue (15, 16), but for ANBA-YIK(ABA)SAEKI-specific ones, K(ABA), in this position, was essential (Table I). Since the N-terminal photoreactive group was not required for antigen recognition by ANBA-YIK(ABA)SAEKI and IASA-YIPSAEK(ABA)I-specific clones (Table I and Ref. 15), the epitopes recognized by these families of clones essentially differed by the absence or presence of K(ABA) in positions 4 and 8, respectively.

The TCR expressed by the three families of clones were also different. Those expressed by PbCS-specific CTL clones were highly diverse both in terms of CDR3 sequences and TCR gene element usage, except that 57% of the clones expressed BV3S1A1 (25). In contrast, about 80% of IASA-YIPSAEK(ABA)I-specific clones expressed BV1S1 encoded beta  chains that were paired with Jalpha TA28 encoded alpha  chains (15). On the other hand, the ANBA-YIK(ABA)SAEKI-specific CTL also preferentially expressed BV1S1, though less frequently, but the alpha  chains lacked any apparent sequence consensus (Table II).2 Remarkably, however, the ANBA-YIK(ABA)SAEKI-specific TCR, unlike the IASA-YIPSAEK(ABA)I-specific ones, were selectively labeled at the alpha  chain (Fig. 3). Peptide mapping showed that the W13 TCR photoaffinity labeling took place in a site-specific manner (Fig. 4), which implies that the ABA group specifically bound to this TCR.

As suggested by computer modeling, the W13 TCR ligand binding site contains a deep hydrophobic pocket, which is located and structured such that it can avidly bind the ligand K(ABA) side chain (Fig. 6). This is consistent with the localization of the photoaffinity labeled site in the Valpha C-strand segment 33-39, which contains Phe-35, that according to our docking experiments intimately interacts with the ABA azide substituent (Figs. 4 and 6, B and C). In accordance with that is the finding that the derivative lacking this substituent (YIK(BA)SAEKI) was recognized by W13 CTL less efficiently.2 In addition, the most polar atom of this side chain, the carbonyl oxygen of the ABA group, according to our modeling forms a stabilizing hydrogen bond with CDR3alpha Ser-94, which is in agreement with the observation that W13 CTL recognized, though inefficiently, the variant YIK(Ac)SAEKI (Table I).

The binding of the K(ABA) side chain in a hydrophobic pocket, formed mainly by CDR3alpha and Valpha framework residues, which are more conserved than CDR residues (34, 35), may explain why these TCR were preferentially labeled at the alpha  chain even though they lacked any apparent sequence consensus (Table II). The finding that a side chain of an MHC-bound peptide interacts with TCR Valpha framework residues is not in agreement with the current concept of TCR-ligand interactions, which postulates that such residues interact primarily with CDR3 loops (6). It is, however, important to note that the K(ABA) side chain is considerably longer than a conventional amino acid side chain (Fig. 6D). This long spacer is required for the ABA group to interact with the TCR, as demonstrated by the observation that shortening of this side chain by only one methylene group (1.5 Å) abolished the antigen recognition by the W13 as well as most other CTL clones (Table I). Moreover, the K(ABA) side chain is remarkably hydrophobic and hence preferentially interacts with nonpolar domains on TCR. Since these TCR were selected for avid binding of the photoreactive ligand, it can be expected that their ligand binding includes an avid binding of the K(ABA) side chain. The accommodation of the ABA group in a hydrophobic pocket, as proposed by our modeling, constitutes such a binding principle (Fig. 6, A-C).

These findings are reminiscent of a previous study, in which we showed that a BV1SA1/Jalpha TA28 encoded TCR, specific for IASA-YIPSAEK(ABA)I, utilized a similar principle to bind the K(ABA) side chain (15). However, in this case, the hydrophobic pocket was located and formed by the BV1S1A1 C- and C'-strands and the Jalpha TA28 encoded portion of CDR3alpha and adjacent G-strand residues (15). Based on these findings, we propose that TCR can express hydrophobic domains in the indicated locations; since they are formed by TCR framework and CDR3alpha residues, their shape and physicochemical nature may vary significantly according to TCR sequences. While normal amino acid side chains of MHC-bound peptides are unlikely to interact with these domains, we suggest that they enable TCR to efficiently and specifically bind epitopes containing modified side chains. Such side chains usually are long and often amphiphatic or hydrophobic, which allows them to efficiently interact with these sites.

It remains to be explained why ANBA-YIK(ABA)SAEKI-specific TCRs were selectively photoaffinity labeled at the alpha  chain, while the IASA-YIPSAEK(ABA)-specific ones were labeled at the beta  chain or both chains (Fig. 3) (15). This labeling pattern may be explained by either of two different orientations of TCR-ligand interactions. i) The Kd bound peptide runs approximately diagonal across the TCR binding site, such that K(ABA) in position 8 interacts mainly with the beta  and in position 4 with the alpha  chain (Fig. 6A). Strong evidence for this orientation has been reported by Sant'Angelo et al. (10) and Sun et al. (37). ii) Alternatively, the MHC-bound peptide could be located underneath CDR3alpha and CDR3beta , e.g. rotated by 30-40° relative to the orientation shown in Fig. 6A, in which case the orientation of the K(ABA) side chain determines with which TCR chain the ABA group preferentially interacts. This orientation corresponds to the one predicted on theoretical grounds (6) and by studies in which TCR single chain transgenic mice were immunized with peptide variants (9).

The system described here and the one described previously (15) allows assessment of TCR-ligand interactions by TCR photoaffinity labeling. This permits rapid and conclusive mutational analysis of TCR-ligand interactions but also makes possible the preparation of covalent TCR-ligand complexes for x-ray crystallographic studies. In addition, as TCR photoaffinity labeling is applicable on living cells, these systems are very suitable for structure-function studies and assessment of co-receptor participation in TCR-ligand interactions (29).


FOOTNOTES

*   This work was supported in part by grants from the Roche Research Foundation and the Association de Recherche sur le Cancer (to F. A.)The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§   Present address: Dept. of Cell Biology, Faculty of Biology, University Complutense, 28040 Madrid, Spain.
   Present address: Institute for Molecular Biology, 117 984 Moscow, Russia.
par    To whom correspondence should be addressed: Ludwig Institute for Cancer Research, Ch. des Boveresses 155, 1066 Epalinges, Switzerland. Tel.: 41 21 692 59 88; Fax: 41 21 653 44 74; E-mail: iluesche @eliot.unil.ch.
1   The abbreviations used are: CTL, cytotoxic T lymphocyte; ABA, 4-azidobenzoic acid; ANBA, 5-azido-2-nitrobenzoic acid; ASA, 4-azidosalicylic acid; Dap, 2,3-L-diaminopropionic acid; HPLC, high performance liquid chromatography; IASA, iodo-4-azidosalicylic acid; Ac, acetyl; IP, isoelectric point; Ig, immunoglobulin; mAb, monoclonal antibody; MHC, major histocompatibility complex; PAGE, polyacrylamide gel electrophoresis; PbCS, Plasmodium berghei circumsporozoite; TCR, T-cell antigen receptor; CDR, complementary determining region; PCR, polymerase chain reaction; IEF, isoelectric focusing.
2   F. Anjuère, D. Kuznetsov, P. Romero, J-C. Cerottini, C. V. Jongeneel, and I. F. Luescher, unpublished results.

ACKNOWLEDGEMENTS

We thank Drs. Graham Bentley and Roy Mariuzza for providing the coordinates of TCR structures, Christian Jaulin and Philip Kourilsky for Kd-transfected L cells, Jean Gagnon for endoprotease Pro-C, and Anna Zoppi for preparing the manuscript.


REFERENCES

  1. Matis, L. A. (1990) Annu. Rev. Immunol. 8, 65-82 [CrossRef][Medline] [Order article via Infotrieve]
  2. Fremont, D. H., Matsumura, M., Stura, E. A., Peterson, P. A., and Wilson, I. A. (1992) Science 257, 919-927 [Abstract/Free Full Text]
  3. Madden, D. R., Garboczi, D. N., and Wiley, D. C. (1993) Cell 75, 693-708 [CrossRef][Medline] [Order article via Infotrieve]
  4. Bentley, G. A., Boulot, G., Karjalainen, K., and Mariuzza, R. A. (1995) Science 267, 1984-1987 [Abstract/Free Full Text]
  5. Fields, B. A., Ober, B., Malchiodi, E. L., Lebedeva, M. I., Braden, B. C., Ysern, X., Kim, J.-K., Shao, X., Ward, E. S., and Mariuzza, R. A. (1995) Science 270, 1821-1824 [Abstract/Free Full Text]
  6. Davis, M. M., and Bjorkman, P. J. (1988) Nature 334, 395-402 [CrossRef][Medline] [Order article via Infotrieve]
  7. Danska, J. S., Livingstone, A. M., Paragas, V., Ishihara, T., and Fathman, C. G. (1990) J. Exp. Med. 172, 27-33 [Abstract/Free Full Text]
  8. Engel, I., and Hedrick, S. M. (1988) Cell 54, 473-484 [CrossRef][Medline] [Order article via Infotrieve]
  9. Jorgensen, J. L., Esser, U., de-St-Groth, B. F., Reay, P. A., and Davis, M. M. (1992) Nature 355, 224-230 [CrossRef][Medline] [Order article via Infotrieve]
  10. Sant' Angelo, D. B., Waterbury, G., Preston-Hurlburg, P., Yoon, S. T., Madzhitov, R., Hong, S.-C., and Janeway, C. A. (1996) Immunity 4, 367-376 [CrossRef][Medline] [Order article via Infotrieve]
  11. Kelly, J. M., Sterry, S. J., Cose, S., Turner, S. J., Fecondo, J., Rodda, S., Fink, P. J., and Carbone, F. R. (1993) Eur. J. Immunol. 23, 3318-3326 [Medline] [Order article via Infotrieve]
  12. Boitel, B., Ermonval, M., Panina-Bordignon, P., Mariuzza, R. A., Lanzavecchia, A., and Acuto, O. (1992) J. Exp. Med. 175, 765-777 [Abstract/Free Full Text]
  13. Nalefski, E. A., and Rao, A. (1993) J. Immunol. 150, 3806-3816 [Abstract]
  14. Nalefski, E. A., Kasibhatla, S., and Rao, A. (1992) J. Exp. Med. 175, 1553-1563 [Abstract/Free Full Text]
  15. Luescher, I. F., Anjuère, F., Peitsch, M. C., Jongeneel, C. V., Cerottini, J.-C., and Romero, P. (1995) Immunity 3, 51-63 [CrossRef][Medline] [Order article via Infotrieve]
  16. Romero, P., Eberl, G., Casanova, J.-L., Cordey, A.-S., Widmann, C., Luescher, I. F., Corradin, G., and Maryanski, J. L. (1992) J. Immunol. 148, 1871-1878 [Abstract]
  17. Luescher, I. F., Cerottini, J.-C., and Romero, P. (1994) J. Biol. Chem. 269, 5574-5582 [Abstract/Free Full Text]
  18. Anjuère, F., Layer, A., Cerottini, J.-C., Servis, C., and Luescher, I. F. (1995) Anal. Biochem. 229, 61-67 [CrossRef][Medline] [Order article via Infotrieve]
  19. Romero, P., Casanova, J.-L., Cerottini, J.-C., Maryanski, J. L., and Luescher, I. F. (1993) J. Exp. Med. 177, 1245-1256
  20. Romero, P., Maryanski, J. L., and Luescher, I. F. (1993) J. Immunol. 150, 3825-3831 [Abstract]
  21. Samelson, L. E. (1985) J. Immunol. 134, 2529-2535 [Abstract]
  22. Schagger, A., and Von Jagov, G. (1987) Anal. Biochem. 166, 368-379 [CrossRef][Medline] [Order article via Infotrieve]
  23. Romero, P., Corradin, G., Luescher, I. F., and Maryanski, J. L. (1991) J. Exp. Med. 174, 603-612 [Abstract/Free Full Text]
  24. Jaulin, C., Casanova, J.-L., Romero, P., Luescher, I., Cordey, A.-S., Maryanski, J. L., and Kourilsky, P. (1992) J. Immunol. 149, 3990-3994 [Abstract]
  25. Casanova, J.-L., Romero, P., Widmann, C., Kourilsky, P., and Maryanski, J. L. (1991) J. Exp. Med. 174, 1371-1383 [Abstract/Free Full Text]
  26. Abagyan, R., Totrov, M., and Kuznetsov, D. (1994) J. Comput. Chem. 15, 488-506 [CrossRef]
  27. Peitsch, M. C., and Jongeneel, C. V. (1993) Int. Immunol. 5, 233-238 [Abstract/Free Full Text]
  28. Chevallier, S., Goeltz, P., Thibault, P., Banville, D., and Gagnon, J. (1992) J. Biol. Chem. 267, 8192-8199 [Abstract/Free Full Text]
  29. Luescher, I. F., Vivier, E., Layer, A., Mahiou, J., Godeau, F., Malissen, B., and Romero, P. (1995) Nature 373, 353-356 [CrossRef][Medline] [Order article via Infotrieve]
  30. Martin, S., Ortmann, B., Pflugfelder, U., Birsner, U., and Weltzien, H. U. (1992) J. Immunol. 149, 2569-2575 [Abstract]
  31. Haurum, J. S., Tan, L., Arsequell, G., Frodsham, P., Lellouch, A. C., Moss, P. A. H., Dwek, R. A., McMichael, A. J., and Elliott, T. (1995) Eur. J. Immunol. 25, 3270-3276 [Medline] [Order article via Infotrieve]
  32. Ganju, R. K., Smiley, S. T., Bajorath, J., Novotny, J., and Reinherz, E. L. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 11552-11556 [Abstract/Free Full Text]
  33. Kohler, J., Martin, S., Pflugfelder, U., Ruh, H., Vollmer, J., and Weltzien, H. U. (1995) Eur. J. Immunol. 25, 92-101 [Medline] [Order article via Infotrieve]
  34. Chothia, C., Boswell, D. R., and Lesk, A. M. (1988) EMBO J. 7, 3745-3755 [Medline] [Order article via Infotrieve]
  35. Katayama, C. D., Eidelman, F. J., Duncan, A., Hooshmand, F., and Hedrick, S. M. (1995) EMBO J. 14, 927-938 [Medline] [Order article via Infotrieve]
  36. Arden, B., Clark, S. P., Kabelitz, D., and Mak, T. W. (1995) Immunogenetics 42, 501-530 [Medline] [Order article via Infotrieve]
  37. Sun, R., Shepherd, S. E., Geier, S. G., Thomas, C. T., Sheil, J. M., and Nathenson, S. G. (1995) Immunity 3, 573-582 [CrossRef][Medline] [Order article via Infotrieve]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Immunol.Home page
S. Honda, W. Zhang, A. M. Kalergis, T. P. DiLorenzo, F. Wang, and S. G. Nathenson
Hapten Addition to an MHC Class I-Binding Peptide Causes Substantial Adjustments of the TCR Structure of the Responding CD8+ T Cells
J. Immunol., October 15, 2001; 167(8): 4276 - 4285.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Kessler, O. Michielin, C. L. Blanchard, I. Apostolou, C. Delarbre, G. Gachelin, C. Gregoire, B. Malissen, J.-C. Cerottini, F. Wurm, et al.
T Cell Recognition of Hapten. ANATOMY OF T CELL RECEPTOR BINDING OF A H-2Kd-ASSOCIATED PHOTOREACTIVE PEPTIDE DERIVATIVE
J. Biol. Chem., February 5, 1999; 274(6): 3622 - 3631.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Anjuère, F.
Right arrow Articles by Luescher, I. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Anjuère, F.
Right arrow Articles by Luescher, I. F.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement