![]()
|
|
||||||||
(Received for publication, October 23, 1996)
-
ugi

From the Immunology Program, Memorial Sloan-Kettering Cancer Center, New York, New York 10021
Many signals that cause apoptotic cell death
operate by inducing transcription and translation of other (presumably
death effector) mediators, and it is well established that
stimulus-induced apoptosis can often be blocked by inhibiting
transcription and translation. Transcriptional regulation of apoptosis,
however, is incompletely understood. To gain insight into nuclear
events associated with signal-induced apoptosis during T cell
development, we studied signal-induced apoptosis of ex vivo
isolated immature CD8+4+ double-positive (DP)
thymocytes. Stimuli utilizing the T cell receptor (TCR) signaling
pathway or its parts (an
CD3/TCR monoclonal antibody, a
Ca2+ ionophore, or a protein kinase C-activating phorbol
ester) or a stimulus that antagonizes TCR signaling and apoptosis in T
cell hybridoma (forskolin, a cyclic AMP-signaling activator) resulted in massive apoptosis of DP thymocytes. At the same time, these stimuli
induced qualitatively similar but quantitatively unique patterns of
inducible transcription factors (TFs) NF-
B/RelA-p50, AP-1 (Fos-Jun),
and NUR-77. We focused our attention on the role of AP-1 (Fos-Jun)
complex, which was strongly induced by all of the above stimuli and
thus was a candidate for a proapoptotic TF. However, we found that
AP-1/c-Fos induction was vital in prolonging DP thymocyte life, as
judged by increased spontaneous and induced death of DP cells in
Fos
/
mice. In direct support of this hypothesis,
experiments with antisense oligonucleotides demonstrated that c-Fos
plays an essential role in protecting normal DP thymocytes from
Ca2+- and cAMP-induced apoptosis but not from TCR-mediated
death. Together, these results demonstrate a physiological role for
c-Fos in maintaining longevity of DP thymocytes.
Apoptosis plays a key role in tissue modeling during normal development, yet many of its features remain obscure. One such feature is the transcriptional control of apoptosis. Signal-induced apoptosis is an active process that by definition requires transcription and translation (1). Such is the case in mature T cells, where a primary signaling cascade (e.g. the one initiated via the TCR1 in T cells) would activate transcription of the genes whose products function in a secondary, "death effector" signaling, many of which belong to the TNF family (TNF, FasL, CD30L, etc.) (2). There is, however, a paucity of information concerning nuclear (transcriptional) changes that occur during initial phases of signal-induced apoptosis in other systems, and it is not clear whether the rule of primary-secondary cascades applies as well.
One of the most investigated models of apoptosis is the one using
rodent thymocytes. In the steady-state adult murine thymus, apoptosis
daily eliminates up to a third of all thymocytes, or up to 95% of all
newly generated cells. The eliminated cells either failed positive
selection (nonselected, or neglected, cells), or were triggered to die
to prevent autoimmunity, because they bear potentially autoreactive
receptors (negative selection) (3-5). The former type of death
corresponds to "programmed" cell death, because the cells subjected
to it, the CD8+4+ double-positive (DP)
thymocytes, have a strictly limited life span of 2-3 days in the
absence of positive selection (6). The latter type of death is induced
by extracellular signals that chiefly operate via the TCR and is
reminiscent of the activation-induced cell death (AICD) of mature
peripheral T cells following exposure to antigen (while we shall use
the term AICD for signal-induced apoptosis of thymocytes, it is
important to bear in mind that the two phenomena are by no means
identical). Experimental apoptosis of thymocytes can be readily induced
in vitro by a variety of stimuli, which utilize different
signaling pathways. Such stimuli include glucocorticoids
(glucocorticoid nuclear receptor pathway), ionomycin (an activator of
the Ca2+ pathway), PMA (an activator of protein kinase C
and the Ras-Raf pathway), forskolin or prostaglandin E2
(cAMP-dependent signaling), FasR/CD95 signaling, and
-irradiation (7-13). Furthermore, negative selection of thymocytes
can be mimicked in vivo and in vitro by agonistic
CD3/TCR-specific mAbs (10, 14, 15), which, similarly to the natural
TCR ligands, elicit stimulation of the downstream Ca2+,
protein kinase C, and other pathways. The bulk of thymocyte apoptosis
in these experimental systems and in the course of in vivo
thymocyte selection (16) occurs among the
CD4+CD8+ DP thymocytes, precisely because they
are the population undergoing selection. However, relative roles and
the interplay of distinct signaling pathways during physiological
development and selection of thymocytes are poorly understood, as is
the role of transcriptional control of the above processes.
To understand the molecular basis of AICD in thymocytes, we
investigated transcription factor (TF) induction and apoptosis in DP
thymocytes in response to a variety of stimuli connected to TCR
signaling. We have chosen to follow the inducible transcription factors
of the NF-
B/Rel family (17), AP-1 (18), NUR-77 (19, 20), and
CREB/ATF (21), because their DNA binding activity was shown to be
regulated by signals inducing cell activation and death. NF-Y (22) was
used as a reference factor with stable DNA binding activity. We
describe a complex pattern of transcription factor induction and
provide evidence for an antiapoptotic role for c-Fos.
Female C57BL/6 (B6), B6fos
/
(Jackson Laboratory, Bar Harbor, ME), and Bcl-2 transgenic mice on B6
background (Ref. 23; generously provided by Dr. S. Cory, WEHI,
Melbourne, Australia, via Dr. H. T. Petrie, Memorial Sloan-Kettering
Cancer Center, New York) were used at 4-8 weeks of age.
CD4+CD8+ DP thymocytes were
enriched from total thymocytes by panning with anti-CD8 mAb (3.155),
immobilized on the surface of plastic dishes, as described previously
(24). Alternatively, these cells and control
CD8+CD4
were sorted to >99% purity
following staining with directly conjugated anti-CD8 and anti-CD4 mAbs
using a FACStar Plus (Becton Dickinson, Mountain View, CA).
CD4+CD8+ thymocytes were activated with 10 µg/ml immobilized anti-CD3
(145-2C11) or soluble anti-Fas mAb
(Jo2) (both from PharMingen, San Diego, CA) in 24-well flat-bottom
plates. Forskolin (10 µM), ionomycin (250-1000 ng/ml),
PMA (10 ng/ml), dexamethasone (1 µM), cycloheximide (10 µg/ml), and actinomycin D (200 ng/ml) were purchased from
Sigma. Thymocytes were directly stained with excess
FITC-anti-CD8, PE-anti-CD4 (Becton Dickinson, Mountain View, CA) and
FITC-anti-TCR
. FCM analysis was performed on a FACScan flow
cytometer using Lysis II software (Becton Dickinson).
This assay was performed as described previously (25). Cells were pelleted and resuspended in 0.5 ml of hypotonic buffer with 0.1% Triton X-100 containing propidium iodide (PI) (40 µg/ml) and DNase-free RNase A (10 mg/ml). Cells were incubated at 37 °C for 30 min and analyzed by FCM on a FACScan (Becton Dickinson, CA). The percentage of cells to the left of the diploid G0/1 peak, diagnostic of hypodiploid cells that have lost DNA, was taken as the percentage of apoptotic cells. Cell viability was also scored by trypan blue and PI exclusion and was concordant with the degree of apoptosis.
Oligonucleotides and Electrophoretic Mobility Shift Assay (EMSA)The following double-stranded oligonucleotides were used
in this study as specific probes for transcription factors (only one
strand of a double-stranded oligonucleotide is shown; binding sites of
transcription factors are underlined; lowercase nucleotides denote ends
introduced for unrelated cloning purpose):
agctTAGCCG for NF-
B;
agctTGAGCCG for AP-1; agctCCATGG
for CREB; GGAGTTTTATGCTCAATTT for NUR-77;
GTCTGAAACATTTTTCTGTTAAAAGTTGAGTGCT for NF-Y.
Oligonucleotides were end-labeled with [
-32P]ATP using
T4 polynucleotide kinase. Nuclear extracts were prepared from 20 × 106 thymocytes unless indicated otherwise. Binding
reactions were carried out by incubating the end-labeled DNA (50,000 cpm) with 2 µg of nuclear proteins and 2 µg of poly(dI-dC), as
described previously (26). For identification of transcription factors, nuclear extracts were preincubated with 1 µl of specific antiserum for 15 min at 20 °C before the addition of the labeled
oligonucleotide probes. The incubation was continued for another 30 min
and followed by EMSA. Polyclonal rabbit antisera to the p50 subunit of
NF-
B (27), to an N-terminal peptide of the RelA/p65 subunit of
NF-
B (28), to a C-terminal peptide of c-Rel (29), to mouse RelB, JunB, and JunD (30, 31), and to the full-length mouse c-Fos (32) and an
antiserum to v-Jun that cross-reacts to c-Jun (33) were kindly provided
by Drs. M. Lenardo (NIH, Bethesda, MD), W. Greene (Gladstone Institute,
San Francisco, CA), N. Rice (NCI, Frederick, MD), R. Bravo
(Bristol-Myers, Princeton, NJ), T. Curran (Roche Institute of Molecular
Biology, Nutley, NJ) and H. Rahmsdorf (University of Karlsruhe,
Germany). Quantification of the band intensity in the EMSA assay was
performed using the Bio-Rad molecular imaging system (model GS-250),
equipped with Phosphor Analyst software (Bio-Rad), and is expressed
relative to the intensity of bands without stimulation, normalized to
the levels of the reference TF, NF-Y.
Cytoplasmic cell extracts were used for isolation and purification of total RNA by the SDS-phenol method. Total RNA was separated on formaldehyde/MOPS-agarose gel and blotted on Hybond N membranes (Amersham Corp.), which were hybridized with 32P-labeled DNA probes for GAPDH, Jun-D (34) and c-Fos (32). Induction of transcription factor mRNA was quantified using the Bio-Rad molecular imaging system (model GS-250), equipped with Phosphor Analyst software (Bio-Rad) and is expressed relative to the level of the reference mRNA for the housekeeping gene, GAPDH.
For Western blot analysis, nuclear proteins were resolved by 10% SDS-PAGE, transferred to nitrocellulose and processed by a standard protocol provided in the manufacturer's manual (Amersham). Polyclonal anti-c-Fos antibody was used at 1:1000. Signals were detected using ECL (Amersham) and were quantified by densitometry.
Antisense Oligonucleotide TreatmentThe sense and antisense
phosphorothioate analogues of the oligonucleotides to the 5
-end of
c-Fos mRNA including the ATG initiation codon were synthesized
(c-Fos sense oligonucleotide, TCG ACC ATG ATG TTC TCG GGT; c-Fos
antisense oligonucleotide, ACC CGA GAA CAT CAT GCT CCA (35)). Rel-A
sense oligonucleotide (CTG ACC ATG GAC GAT CTG TTT CCC) was used as
another negative control. Purified oligonucleotides were obtained from
the Memorial Sloan-Kettering Cancer Center Microchemistry Core Facility
and were used at indicated concentrations. For all experiments, cells
were preincubated for 30 min with oligonucleotides, followed by
stimulation with activators for an additional 16 h. Apoptosis was
determined as described.
To investigate TF
involvement in thymocyte apoptosis, we first established a model of
cortical thymocyte apoptosis. We enriched CD8+4+ cells to 91 ± 2% from total
thymocyte suspensions, using panning with immobilized anti-CD8 mAb
(Fig. 1A). The purity of DP cells could be
further increased to 94-96% by the second round of panning using
immobilized anti-CD4 mAb, but such a treatment, even at 4 °C, had a
strong inhibitory effect on transcription factor induction (not shown),
reminiscent of its effect on mature T cell activation (36). Inasmuch as
our final goal was to investigate the relationship between TF induction
and AICD, we avoided extensive CD4 cross-linking and used anti-CD8
panning in most studies.
AICD in enriched
CD4+CD8+ (DP) thymocytes. A,
enrichment of DP thymocytes by panning using immobilized anti-CD8 mAbs. Positively selected thymocytes were directly stained with FITC-anti-CD8 and PE-anti-CD4 mAbs and analyzed by FCM. B, determination
of apoptosis levels by PI staining. DP-enriched thymocytes were treated for 16 h with no stimulus, immobilized anti-CD3
mAb, ionomycin (250 ng/ml), PMA (10 ng/ml), forskolin (10 µM), and
dexamethasone (Dex; 1 µM) in the absence
(lower traces) or the presence (upper traces) of
10 µg of cycloheximide (CHX) and assayed for DNA
fragmentation by PI staining as described under "Experimental
Procedures." The marker was set to delimit the percentage of apoptotic cells, containing less than
the diploid amount of DNA. C, effects of cAMP signaling on
activation-induced cell death. DP thymocytes were activated as
indicated for B, in the presence or absence of 10 µM forskolin. Results from at least five different
experiments were used to obtain mean values ± S.D.
As stimuli for AICD, we used full or partial agonists of TCR signaling
(
CD3 mAb, PMA, and ionomycin) and an antagonist of TCR signaling in
T cell hybridomas (forskolin, a cAMP signaling activator). As a
positive control, we used dexamethasone, an apoptosis-inducing stimulus
that operates via the glucocorticoid nuclear receptor and is not
connected directly to TCR signaling. All of the above stimuli
induced extensive apoptosis in DP thymocytes following overnight
treatment, as determined by quantifying cells with hypodiploid DNA
content, diagnostic for apoptosis (Fig. 1B, lower
panels). Cell counting using trypan blue (optical microscope) or
propidium iodide (FCM) exclusion, confirmed that cell loss was
substantial in each case where the numbers of hypodiploid cells were
increased, while that was not the case when few hypodiploid cells were
observed (not shown).
The aim of this work was to investigate whether this apoptosis may be linked to a specific pattern of TF induction. It was, therefore, important to confirm that all apoptosis in the above models was indeed due to new transcription and translation. To that effect, we stimulated DP thymocytes in the presence of transcription and translation inhibitors actinomycin D (200 ng/ml, not shown) and cycloheximide (10 µg/ml, Fig. 1B, upper traces). As shown in numerous other studies (1, 7-11), we found that apoptosis induced by TCR agonists, forskolin, and dexamethasone was inhibited by >90% by actinomycin D or cycloheximide and thus was dependent on new transcription and translation (Fig. 1B). By contrast, FasR-mediated apoptosis (induced by an agonistic mAb Jo2; Ref. 16) did not require transcription and translation, consistent with its rapid kinetics and its proteolytic mechanism of apoptosis induction (not shown).
By itself, forskolin induced apoptosis in DP thymocytes in a dose-dependent manner (Fig. 1B and data not shown). Since forskolin is known to antagonize TCR signaling in hybridomas (38), we sought to examine whether forskolin may also affect DP apoptosis regulated by other stimuli. 10 µM forskolin did not affect PMA- or ionomycin-induced cell death, and, surprisingly, it appeared to synergize with TCR-mediated death of DP thymocytes (Fig. 1C). These results stand in striking contrast with the inhibitory effect of forskolin on TCR-dependent apoptosis of a T cell hybridoma (38).2 Thus, the response of T cell hybridomas, which were routinely used as models of thymocyte apoptosis, was much closer to the response of mature T cells.
Signal-dependent Activation of Transcription Factors in DP ThymocytesWe next investigated whether the above stimuli
induced a discernible pattern of TF activation and whether any of the
putative changes in TF activity may be causally related to AICD of DP
thymocytes. For this study, we selected TF AP-1, NF-
B, and CREB,
which are strongly induced in the course of T cell activation, and the
orphan steroid receptor and a putative TF NUR-77, which is not only
induced following activation but also plays a role in apoptosis (19, 20). As a control, we used a conserved and constitutively expressed TF
NF-Y (22). DP thymocytes were stimulated for 3 h with the stimuli
studied in Fig. 1, and nuclear extracts from stimulated cells were used
to evaluate the induction of indicated TF by EMSA (Fig.
2A). PMA (10 ng/ml), PMA plus ionomycin (250 ng/ml), and anti-CD3
strongly up-regulated the upper NF-
B
DNA-binding complex 6-8-, 4-, and 4-5-fold, respectively (as
determined by densitometry) and increased the level of the lower
complex uniformly by about 2-fold. Ionomycin similarly increased the
lower complex (3-fold), but its effects on the upper complex were more
variable: in some experiments (Fig. 2A), this agent only
weakly up-regulated the upper NF-
B complex (1.5-fold), while in
others the up-regulation of the upper complex was more vigorous (data
not shown). This is consistent with pleiotropic effects of
Ca2+ on gene expression and suggests that other, presently
unknown, factors may modulate the effects of Ca2+ on
transcription factor induction. All of the above stimuli also induced
the AP-1 activity; the upper band was induced 2.5-fold by PMA, 3-fold
by ionomycin, 6-fold by their combination, and 3-3.5-fold by
CD3
(Fig. 2A). NUR-77 DNA binding activity was induced
preferentially by Ca2+-inducing stimuli (ionomycin,
ionomycin plus PMA, or anti-CD3, all in the range of 2-3-fold) but not
by PMA alone. Levels and the appearance of CREB/ATF did not vary very
much for ionomycin but were up-regulated by
CD3 and forskolin (data
not shown, and Figs. 2B and 3). This, taken
together with the phenotype of the mouse carrying a dominant negative
mutant of CREB/ATF, which does not exhibit discernible defects in T
cell development (39), suggested to us that CREB may not be universally
involved in thymocyte apoptosis, although further experiments are
necessary to directly examine this issue. As expected, the level of the
reference transcription factor NF-Y was stable (<5% variation),
irrespective of stimulation (Fig. 2A).
B, AP-1, NUR-77, CREB, and NF-Y
transcription factors. Quantification of band intensity relative to
basal levels was performed using imaging (see "Experimental
Procedures").
CD3-stimulation. A,
competition with homologous and heterologous oligonucleotides. EMSA was
performed with nuclear extracts of
CD3-stimulated DP thymocytes in
the presence of a 250-fold excess of unlabeled oligonucleotides
indicated above the lanes. B,
identification of NF-
B and AP-1 DNA-binding complexes. Nuclear
extracts from
CD3-treated DP cells were preincubated with antisera
to NF-
B/RelA, RelB, c-Rel, p50, v-Jun/c-Jun, JunB, JunD, or c-Fos,
as indicated above the lanes, before EMSA, using 32P-
B (left seven lanes) or
32P-AP-1 (right seven lanes) oligonucleotides.
Nonspecific bands that could be observed after the interaction of
labeled probes with antisera without nuclear extracts are designed
nss. Band intensity was quantified relative to basal levels
using imaging (see "Experimental Procedures").
cAMP-mediated signaling (forskolin) was shown to induce apoptosis of
immature thymocytes (Ref. 9; Fig. 1C). By contrast, cAMP
activation antagonized TCR-dependent signaling in T cell hybridoma and inhibited activation-induced apoptosis of these cells
(38, 40), and we therefore examined the effects of forskolin on
TCR-induced TF activation in DP thymocytes. Forskolin stimulation of DP
thymocytes up-regulated both nuclear NF-
B complexes, RelA-p50 and
p50-p50, by 1.5-2-fold, as well as AP-1 and NUR-77 (2-fold each) after
3 h (Fig. 2B). Forskolin also induced the appearance of
an additional diffuse band of CREB with increased mobility (probably a
phosphorylated form of CREB), designed as CREB-P (Fig. 2B).
By itself,
CD3 induced robust RelA-p50 activity (the upper complex
was up-regulated 5-fold) and AP-1 upper complex (Fos-Jun) activity
(3-3.5-fold induction). When administered with
CD3, forskolin
decreased anti-CD3-induced levels of RelA-p50 to the levels induced by
forskolin alone, although this effect was less pronounced than the one
observed in a T cell hybridoma.2 Likewise, forskolin
partially suppressed TF binding activities of AP-1 and NUR-77 induced
by
CD3 (Fig. 2B). Thus, although cAMP signaling partially
down-regulated TF activities induced by anti-CD3, this down-regulation
did not result in the suppression of anti-CD3-induced apoptosis of DP
thymocytes. In fact, we observed additive effects of
TCR-dependent and cAMP-dependent signaling in
the induction of apoptosis (Fig. 1C). We conclude that
transcriptional regulators different from NF-
B, NUR-77, and AP-1 are
likely to be involved in TCR-mediated AICD of DP thymocytes but may not
operate in mature T cells, as judged by the behavior of a T cell
hybridoma (38, 40).
Enriched DP cells used for the above experiments still contained
8-10% contaminating cells of other phenotypes, the most abundant (up
to 6%) being the CD8+4
single-positive. To
control for the effect of this contamination, we performed experiments
using >99% pure DP and single-positive CD8+CD4
thymocytes (FCM sorting) and showed
that NF-
B, AP-1, and NUR-77 activities could be induced in sorted DP
thymocytes but not in nuclear extracts of CD8+
single-positive cells, when the two were used in the amounts (2 µg
and 100 ng, respectively) representative of their ratios present in
preparations obtained by panning (not shown). CREB, however, was
present at relatively high levels following
CD3 induction. Since
CREB is highly inducible in mature T cells, this observation can be
explained by the maturational status of CD8+ thymocytes,
which are quite similar to their peripheral counterparts. These results
exclude the role of contaminants in the observed TF induction, and
demonstrate that thymocyte preparations obtained by panning closely
approximate the characteristics of pure DP thymocytes. Therefore, all
subsequent experiments were performed with DP thymocytes enriched by
panning.
Competition
experiments with the excess of cold homologous or heterologous
oligonucleotides demonstrated the specificity of two NF-
B
DNA-binding complexes, two AP-1 complexes, two NUR-77 complexes, CREB,
and the NF-Y complex (Fig. 3A). Cross-inhibition was
observed with the 32P-AP-1 probe, whose interaction with
nuclear extracts was inhibited not only by the specific cold
oligonucleotide but also by the CREB-binding oligonucleotide (Fig.
3A). This, however, is not surprising, since the AP-1 and
CREB binding sites share considerable homology and differ by only a
single nucleotide. Interestingly, interactions of CREB with its
specific site were less sensitive to such heterologous inhibition,
although partial inhibition by the AP-1 oligonucleotide was observed
(Fig. 3A).
Positive identification of DNA-binding complexes was achieved by
pretreatment of nuclear proteins with Abs against specific transcription factors, followed by EMSA. Such treatment results in
specific inhibition and/or supershifts of DNA-binding complexes. Results shown in Fig. 3B, using extracts from
CD3-stimulated cells, illustrate this type of analysis. As expected,
results indicated that the upper NF-
B complex was mainly composed of the RelA and p50 (60-70% inhibition with anti-RelA and 23-25% with
anti-p50), while the lower band contained the NF-
B p50-p50 homodimer
(inhibited by >60% with anti-p50). Neither ionomycin nor forskolin
induced nuclear RelB or c-Rel activity in DP thymocytes (not shown). By
contrast, PMA (not shown) and anti-CD3 (Fig. 3B) induced
high levels of RelA-p50 (>60% of the upper complex intensity in Fig.
3B was inhibited with
RelA Ab, as judged by densitometry) and low levels of RelB-p50 (20-25% inhibition by RelB Ab), which co-migrated as the upper band. No c-Rel activity was detected (<5%
inhibition).
The upper AP-1 complex is canonically a heterodimer of Fos-Jun subunits
(18), as was clearly shown by inhibiting this DNA-binding complex with
antibodies to Fos (40% inhibition), JunD (40% inhibition), and JunB
(20%). Other Fos family members (FRA1 and -2) could also have been
present. However, besides c-Fos, JunD, and JunB, the upper AP-1 complex
induced in DP thymocytes surprisingly contained NF-
B RelA (Fig.
3B). This AP-1 complex did not contain any RelB or c-Rel
activity and, at best, contained only very low amounts of c-Jun and
NF-
B p50. We were able to identify the lower band of the AP-1
complex from DP thymocytes as a Jun-Jun combination, containing JunB
and JunD (inhibited by specific antibodies by 20-30% and 40%,
respectively), but again very little c-Jun (less than 5% inhibition)
(Fig. 3B) (it should be noted that the band labeled
nss denotes a nonspecific complex, which is a result of interaction of serum proteins and labeled probes, even in the absence
of nuclear proteins). We conclude that stimulation of DP thymocytes, in
addition to Fos-JunD and Fos-JunB complexes, induced a supercomplex of
AP-1 and RelA in thymocytes, reminiscent of the one described recently
in HeLa cells (41).
All stimuli (ionomycin, PMA, a combination
of PMA and ionomycin, forskolin, and anti-CD3) induced AP-1/c-Fos TF
activity, although PMA alone was not as consistent and strong an
inducer as the other stimuli (not shown). We next tested whether this induction occurs at the level of c-Fos mRNA. Northern blot analysis followed by PhosphorImager quantification (Fig. 4)
showed that c-Fos mRNA was strongly up-regulated by cAMP and
Ca2+ signaling but was at best very weakly induced by
CD3.3 Therefore, transcriptional control
of c-Fos expression was stimulus-specific.
To determine whether cell death may be dependent on inducible c-Fos
expression and activation, we performed antisense inhibition of c-Fos
translation in DP thymocytes, followed by stimulation of pretreated
cells with forskolin, ionomycin, PMA, or dexamethasone (Fig.
5, A and B). Oligonucleotides at
concentrations used in these experiments were not toxic for DP
thymocytes, since they did not induce necrotic or apoptotic cell death
(Fig. 5 and data not shown). c-Fos suppression by antisense
oligonucleotide down-regulated the AP-1 binding activity (inhibition of
the Fos-Jun band by 2.5-3-fold by ionomycin, and by 1.5-2-fold by
forskolin; Fig. 5C), decreased the levels of Fos protein by
2-2.5-fold as judged by Western blot analysis (Fig. 5D),
and specifically increased cell death levels induced by forskolin (in
the oligonucleotide range 0.5-5 µg/ml) and ionomycin (1-10 µg/ml)
but not by PMA or dexamethasone (Fig. 5A), consistent with
the relatively weak induction of c-Fos by PMA and with the finding that
dexamethasone negatively regulates AP-1-dependent
transcription (42). The addition of sense Fos or sense RelA
oligonucleotide had no significant effects on any of the three
parameters examined (Fig. 5). The fact that c-Fos antisense treatment
did not completely block all AP-1 activity and apoptosis likely
reflects the activity of other Fos family members (FRA-1 and FRA-2),
which can substitute for Fos in the upper AP-1 complex. These family
members were shown to substitute for Fos in the Fos
mice
(49, 50). These results showed that in normal DP thymocytes c-Fos
induction correlated with the protection against Ca2+ and
cAMP-induced cell death.
The antiapoptotic protooncogene product Bcl-2 (43, 44) is developmentally regulated during T cell differentiation (45, 46) and was implicated in regulating thymocyte survival in vivo (47), but the mechanism of its action is still obscure. To investigate whether c-Fos may mediate the antiapoptotic effects of Bcl-2, we took advantage of Bcl-2 transgenic thymocytes (23). However, despite blocking c-Fos with antisense oligonucleotides, transgenic Bcl-2 still suppressed DP cell death (Fig. 5B), indicating that c-Fos was not an essential mediator of Bcl-2-dependent protection against apoptosis.
DP Thymocytes from fos
/
Mice Are Hypersensitive to
Apoptosis
fos-/- mice exhibit a
number of abnormalities, including prominent bone malformations and a
hypoplastic lymphoid system (48, 49). Their thymocytes were reported to
be severely depleted (48) or normal (50) by two different groups. To
evaluate the propensity of fos
/
DP
thymocytes to undergo apoptosis, we stimulated them with
forskolin, PMA, and dexamethasone. These experiments revealed that
the absence of c-Fos leads to a general increase in susceptibility to
both spontaneous and induced apoptosis (Fig. 6).
Increase in spontaneous apoptosis, as well as the increase in apoptosis
following stimulation with factors that do not (dexamethasone) or only
slightly (PMA) induce c-Fos, suggest that basal levels of Fos play a
role in protecting from apoptosis. Together, these results establish
c-Fos as an anti-apoptotic factor in DP thymocytes.
/
mice exhibit an
increased sensitivity to spontaneous apoptosis and AICD. DP
thymocytes from three normal and three fos
/
animals were pooled and treated as indicated and were assayed for
apoptosis by FCM at two different time points. Results were confirmed
in another experiment. Dex, dexamethasone.
The most important finding of this study is that, at physiological
levels, c-Fos can play an important role in preventing apoptosis of DP
thymocytes in response to Ca2+ and cAMP signaling. These
results are supported by the recent elegant experiments with UV
treatment of c-fos
/
mouse fibroblasts, which
also describe the role for c-Fos in inhibiting apoptosis (51). Previous
observations with the basic phenotype of Fos knockout mice were
initially controversial. One group reported no alteration of thymic
size and weight, whereas the other reported a severe reduction in
thymic size in adult (6-week) but not neonatal (2-week) animals (50,
48). Subsequent experiments revealed that thymic alterations occurred
secondary to bone abnormalities, which then affected the bone marrow,
since fos
/
bone marrow cells developed
normally into T and B cells when transferred into normal recipients
(48). Overexpression of transgenic c-Fos also resulted in reduced
thymocyte numbers, most likely secondary to a deregulated proliferation
of the thymic epithelium (52). However, spontaneous or stimulus-induced
thymocyte apoptosis was never directly investigated in the above
knockout and transgenic models. Our results demonstrate that
fos
/
DP thymocytes do not survive as well as
normal DP cells, providing further evidence for the role of c-Fos in
positively regulating thymocyte survival. In two other nonlymphoid
transformed cell systems, transfection of chimeric c-Fos was recently
shown to induce cell death by apoptosis (53, 54). Two explanations can
be put forward to reconcile these observations with our results and
those of Schreiber et al. (51). First, it is possible that c-Fos acts in a tissue-specific and stimulus-specific context to
selectively promote or suppress apoptosis. Our observation that c-Fos
did not prevent all types of DP thymocyte apoptosis is consistent with
this explanation. Second, optimal, but not overexpressed levels of
c-Fos, in concert with other factors, could be necessary for cell
survival. It will be of interest to investigate apoptosis in ex
vivo isolated Fos transgenic thymocytes, since this hypothesis
would predict that an antisense-mediated down-regulation of c-Fos
should protect these thymocytes from apoptosis. Bcl-2 did not appear to
require c-Fos for its protective function. However, another family
member, Bcl-x, is physiologically highly expressed in DP thymocytes
(55), and it will be of interest to determine the dependence of the
antiapoptotic function of this protooncogene on c-Fos.
Another observation from our study is that AP-1 (Fos-Jun) presented in
the complex with the RelA subunit in activated DP thymocytes (Fig.
3B). Consistent with this observation, anti-c-Fos partially suppressed the upper NF-
B complex induced by ionomycin (not shown). The former observation suggested a possible interaction of this complex
with AP-1, which was subsequently confirmed using RelA-specific antibodies. As was previously shown for HeLa cells (41), this combinatorial factor is transcriptionally active for the
NF-
B-dependent reporter constructs. However, the
promoter specificity of the AP-1-RelA complex in vivo, and
its connection with the regulation of cell survival are unknown at
present and are currently under investigation.
Data concerning the AP-1 activity in DP thymocytes are controversial. Very low levels of both AP-1 DNA binding activity and AP-1-dependent transcription were observed after activation of sorted DP thymocytes (56). Chen and Rothenberg (57) also concluded that DP thymocytes are characterized by a strong reduction of AP-1 DNA binding activity. By contrast, Sen et al. (58) showed that freshly isolated thymocytes contained high levels of AP-1 activity, which dramatically declined with time following the disruption of the thymocyte-microenvironment contact. Comparison of the two procedures of thymocyte purification used in our study were consistent with the latter finding. DP thymocytes enriched by the rapid panning procedure contained highly inducible AP-1 (Fig. 2), while the ones isolated by a lengthier FCM sorting (not shown) had significantly inferior AP-1 inducibility.
Promoter specificity and regulatory activity of the orphan nuclear receptor NUR-77 are still obscure, but several lines of evidence have implicated this putative transcription factor (or a possible negative regulator of transcription factors) in activation-induced apoptosis of T cell hybridoma (19, 20) and negative intrathymic selection (59). Results presented here are consistent with these findings. All stimuli that resulted in AICD of DP thymocytes induced an early activation of NUR-77 DNA binding activity. It is possible that c-Fos and NUR-77 play opposite roles in death programs of DP thymocytes, the first promoting cell survival and the second being important for cell death control.
Several stimuli investigated in our study strongly activated NF-
B
RelA-p50 complex in DP thymocytes. The NF-
B/Rel family of TFs
controls transcription of many different genes, including those that
play an important role in cell death programs, such as c-myc
and the genes for p53 and TNF
(60-63). Promoters of the fas-L
and fasR genes also contain putative NF-
B-binding
sites (64, 65) although their functional significance is unknown. The
mechanism of NF-
B activation is based on the release of RelA-p50 from the cytoplasmic inhibitor I
B
. This release requires at least
two modification steps, I
B
phosphorylation and proteolysis, the
latter probably being mediated by cysteine proteases or the proteasome
(66, 67). Cysteine proteases, especially those from the interleukin-1
converting enzyme (ICE) family, have been implicated as mediators of
many types of apoptotic death (reviewed in Ref. 68). Protease
inhibitors are known to antagonize apoptosis (69). Thus, our data
concerning NF-
B activation, which may be linked to apoptosis,
indirectly suggest the possibility that I
B
processing could be an
additional target for the antiapoptotic function of protease
inhibitors. Experiments are currently in progress to address this
possibility.
.) and CA-08253 (Memorial
Sloan-Kettering Cancer Center Core Grant).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Memorial
Sloan-Kettering Cancer Center, Box 98, 1275 York Ave., New York, NY
10021. Tel.: 212-639-2387; Fax: 212-794-4019; E-mail:
nikolicj{at}mskcc.org.
B, nuclear
factor
B; PI, propidium iodide; PMA, phorbol 12-myristate
13-acetate; MOPS, 4-morpholinepropanesulfonic acid; GAPDH,
glyceraldehyde-3-phosphate dehydrogenase; TNF FCM-flow cytometry, tumor
necrosis factor
.
CD3, most probably owing to strong activation of RNases following
ionomycin treatment, its induction relative to GAPDH is much
higher.
We thank Dragana
Nikoli
-
ugi
for flow cytometric analysis; the
Memorial Sloan-Kettering Cancer Center Flow Cytometry Core Facility for
cell sorting; Drs. M. J. Lenardo for anti-p50 NF-
B, W. Greene for
anti-p65 NF-
B, N. Rice for anti-c-Rel, R. Bravo for anti-RelB,
anti-JunB and anti-JunD, T. Curran for anti-c-Fos, and H. Rahmsdorf for
anti-v-Jun; Drs. S. Cory and H.T. Petrie for Bcl-2 transgenic mice; and
Drs. L. Freedman, E. Lacy, and S. Vukmanovi
for perusing the
manuscript.
-
ugi
, J., and Bevan, M. J.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
8633-8637
, S., Jain, N., and Nikoli
-
ugi
, J.
(1993)
J. Exp. Med.
178,
1745-1751
This article has been cited by other articles:
![]() |
V. N. Ivanov, M. Krasilnikov, and Z.'e. Ronai Regulation of Fas Expression by STAT3 and c-Jun Is Mediated by Phosphatidylinositol 3-Kinase-AKT Signaling J. Biol. Chem., February 8, 2002; 277(7): 4932 - 4944. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Wenzel, C. Grimm, A. Marti, N. Kueng-Hitz, F. Hafezi, G. Niemeyer, and C. E. Reme c-fos Controls the "Private Pathway" of Light-Induced Apoptosis of Retinal Photoreceptors J. Neurosci., January 1, 2000; 20(1): 81 - 88. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Howlett, J. S. Hutchison, J. P. Veinot, A. Chiu, P. Merchant, and H. Fliss Inhaled nitric oxide protects against hyperoxia-induced apoptosis in rat lungs Am J Physiol Lung Cell Mol Physiol, September 1, 1999; 277(3): L596 - L605. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. N. Ivanov and Z.'e. Ronai Down-regulation of Tumor Necrosis Factor alpha Expression by Activating Transcription Factor 2 Increases UVC-induced Apoptosis of Late-stage Melanoma Cells J. Biol. Chem., May 14, 1999; 274(20): 14079 - 14089. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Chen, D. Chen, and E. V. Rothenberg Specific regulation of Fos family transcription factors in thymocytes at two developmental checkpoints Int. Immunol., May 1, 1999; 11(5): 677 - 688. [Abstract] [Full Text] [PDF] |
||||