JBC Avanti Polar Lipids

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Legan, P. K.
Right arrow Articles by Richardson, G. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Legan, P. K.
Right arrow Articles by Richardson, G. P.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 13, Issue of March 28, 1997 pp. 8791-8801
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

The Mouse Tectorins
MODULAR MATRIX PROTEINS OF THE INNER EAR HOMOLOGOUS TO COMPONENTS OF THE SPERM-EGG ADHESION SYSTEM*

(Received for publication, December 4, 1996, and in revised form, January 13, 1997)

P. Kevin Legan Dagger , Angela Rau Dagger , Jeff N. Keen § and Guy P. Richardson Dagger

From the Dagger  School of Biological Sciences, University of Sussex, Falmer, Brighton, BN1 9QG, United Kingdom and the § Department of Molecular Biology and Biochemistry, University of Leeds, Leeds LS2 9JT, United Kingdom

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

The cDNA and derived amino acid sequences for the two major non-collagenous proteins of the mouse tectorial membrane, alpha - and beta -tectorin, are presented. The cDNA for alpha -tectorin predicts a protein of 239,034 Da with 33 potential N-glycosylation sites, and that of beta -tectorin a smaller protein of 36,074 Da with 4 consensus N-glycosylation sites. Southern and Northern blot analysis indicate alpha - and beta -tectorin are single copy genes only expressed in the inner ear, and in situ hybridization shows they are expressed by cells both in and surrounding the mechanosensory epithelia. Both sequences terminate with a hydrophobic COOH terminus preceded by a potential endoproteinase cleavage site suggesting the tectorins are synthesized as glycosylphosphatidylinositol-linked, membrane bound precursors, targeted to the apical surface of the inner ear epithelia by the lipid and proteolytically released into the extracellular compartment. The mouse beta -tectorin sequence contains a single zona pellucida domain, whereas alpha -tectorin is composed of three distinct modules: an NH2-terminal region similar to part of the entactin G1 domain, a large central segment with three full and two partial von Willebrand factor type D repeats, and a carboxyl-terminal region which, like beta -tectorin, contains a single zona pellucida domain. The central, high molecular mass region of alpha -tectorin containing the von Willebrand factor type D repeats has homology with zonadhesin, a sperm membrane protein that binds to the zona pellucida. These results indicate the two major non-collagenous proteins of the tectorial membrane are similar to components of the sperm-egg adhesion system, and, as such may interact in the same manner.


INTRODUCTION

The sensory epithelia of the inner ear contain hair and supporting cells, and the apical surfaces of these epithelia are covered by extracellular matrices which transmit forces to the mechanosensitive stereociliary bundles of the hair cells. In the ampullae of the semi-circular canals, a cupula sits on top of each crista; in the saccule and utricule, the maculae are covered by an otolithic membrane; in the cochlea, a tectorial membrane lies over the surface of the organ of Corti. The structures of these three types of matrices, the cupula, the otolithic membrane, and the tectorial membrane, are complex and not identical, and each may be tailored to provide the optimal stimulus for the type of hair cell present in each organ.

The tectorial membrane is the best characterized of these matrices. In the chick it is a dense fibrillogranular matrix (1) composed of two major glycoproteins, alpha - and beta -tectorin (2, 3). Chick alpha -tectorin is a large (Mr = 196,000) disulfide cross-linked complex composed of six polypeptides, the alpha 1- to alpha 6-tectorins, whereas chick beta -tectorin is considerably smaller (Mr = 43,000) and not covalently associated with alpha -tectorin. The cDNA for chick beta -tectorin has been recently cloned (3) and analysis of the sequence indicates beta -tectorin is related to the pancreatic zymogen granule protein GP2, the urinary glycoprotein uromodulin (Tamm-Horsfall protein), and two components of the extracellular matrix that surrounds the unfertilized egg, the zona pellucida proteins ZP2 and ZP3.

The mammalian tectorial membrane is considerably more complex than that of the bird, containing polypeptides that react with antibodies to types II, V, and IX collagen (4, 5) and a number of collagenase-insensitive glycoproteins that account for up to 50% of the tectorial membrane protein (4). Under reducing conditions these non-collagenous proteins of the mouse tectorial membrane form three broad, diffuse bands on SDS gels with peak masses of 173, 60, and 45 kDa which have been referred to as the high, medium, and low molecular mass tectorins (HMM,1 MMM, and LMM tectorin, Ref 6). The polydisperse behavior of the mouse tectorins observed on SDS gels may result partially from glycosylation heterogeneity. For example, mouse HMM tectorin is sulfated and following treatment with endo-beta -galactosidase it is converted from a diffuse smear to a sharp band with an Mr of 160,000 (4, 6). Under nonreducing conditions most of the non-collagenous mouse tectorial membrane protein forms a large (Mr > 240,000), disulfide cross-linked complex which may be homologous to chick alpha -tectorin. A proportion of the protein in the LMM tectorin fraction is not covalently associated with the other tectorins (4) and may represent the murine homologue of chick beta -tectorin.

The studies of Kronester-Frei (7) originally described the presence of two major fibril systems in the mammalian tectorial membrane; the Type A protofibrils, straight unbranched filaments organized in bundles that run predominantly radially across the tectorial membrane, and the Type B protofibrils, described as branched, coiled, irregular diameter fibrils that could apparently exist in two states of hydration, with the highly hydrated form comprising the matrix within which the Type A protofibrils were found, and the weakly hydrated form forming the covernet fibrils, the marginal net, Hensen's stripe, and the limbal undersurface of the tectorial membrane. The Type A protofibrils are entirely degraded by bacterial collagenase (8), and can be labeled by antibodies directed against Types II and IX collagen (9). The matrix within which the Type A protofibrils are embedded is resistant to degradation by bacterial collagenase and fixation in the presence of tannic acid reveals it is composed of two types of fine, 7-9-nm diameter filament; a light and a dark staining type that are linked to one another by staggered cross-bridges and arranged in sheets with the filaments lying within the plane of each sheet (8). The alternating arrangement of the two fibril types in these sheets gives the matrix a striated appearance, and these sheets roll up to form the thicker, hydrated Type B protofibrils described by Kronester-Frei (7).

To further our understanding of the way in which the tectorial membrane matrix is formed and functions in the process of mechanotransduction, we have now deduced the primary structure of the mouse tectorins. The data indicate that the HMM, MMM, and LMM tectorins observed on SDS gels are mainly derived from a single large mouse alpha -tectorin sequence, with a smaller sequence, that of mouse beta -tectorin, contributing partially to the LMM tectorin fraction. The ways in which these two proteins may interact via their different domains to form the observed structure of the non-collagenous matrix of the tectorial membrane are discussed.


EXPERIMENTAL PROCEDURES

NH2-terminal Protein Sequencing

Mouse and chick tectorial membranes were collected by dissection in phosphate-buffered saline containing a mixture of protease inhibitors (1 mM phenylmethylsulfonyl fluoride, 2 mM benzamidine, 10 µM pepstatin, and 1 µg/ml leupeptin), washed with the same buffer containing 0.1% Triton X-100 and stored frozen at -70 °C until sufficient numbers had been collected. To prepare the mouse tectorins for sequencing, approximately 550 tectorial membranes were washed with 50 mM sodium acetate, pH 5.8, containing the protease inhibitor mixture, and digested overnight at 37 °C with 5 milliunits of endo-beta -galactosidase (ICN Biomedicals, Thame, United Kingdom) in a 60-µl volume of the same buffer. Membranes were then washed 3 times with 100 mM Tris-HCl, pH 7.4, 0.05% Triton X-100 containing protease inhibitors and incubated with 0.2 mg/ml bacterial collagenase (Sigma, Poole, United Kingdom) in a 100-µl volume of 50 mM Tris-HCl, pH 7.2, 5 mM CaCl2 for 4 h at 37 °C. Following collagenase digestion, membranes were washed 5 times with 100 mM Tris-HCl, pH 7.4, containing 0.05% Triton X-100 and protease inhibitors, and then solubilized by boiling in a 200-µl volume of 0.4% SDS, 2% beta -mercaptoethanol, 10 mM sodium phosphate, pH 7.2, for 2 min. The sample was cooled to room temperature, and 80 µl of 5 times concentrated digestion buffer (2.5% CHAPS, 50 mM EDTA, 100 mM sodium phosphate, pH 7.2, 50 mM NaN3), 120 µl of H2O and 0.4 unit of N-glycosidase F (Boehringer Mannheim, Lewes, United Kingdom) added. After digestion with N-glycosidase F for 3 h at 37 °C, the sample was dialyzed against cold H2O overnight, lyophilized, and resuspended in 40 µl of reducing SDS-PAGE sample buffer. For the chick tectorins, approximately 800 tectorial membranes were washed once with high salt buffer (1 M NaCl, 10 mM Tris-HCl, pH 7.4, 0.1% Triton X-100), twice with low salt buffer (10 mM Tris-HCl, pH 7.4, 0.1% Triton X-100), and finally with H2O. All solutions contained the protease inhibitor mixture. Membranes were then boiled in nonreducing SDS-PAGE sample buffer and run on 7.5% preparative mini-gels (10). The chick alpha - and beta -tectorin bands were cut out from the gels and the protein recovered by electroelution. Electroeluted samples were dialyzed against cold H2O and lyophilized. Lyophilized alpha -tectorin samples were redissolved in reducing SDS-PAGE sample buffer. Total mouse tectorin and chick alpha -tectorin samples were run on 8.25% mini-gels (using material from 100 to 200 tectorial membranes per lane) and transferred to polyvinylidene difluoride membranes using semidry electroblotting. The membranes were washed with H2O, stained briefly with 0.005% sulforhodamine B in 30% methanol, 0.2% acetic acid, rinsed in H2O, and dried in a dessicator. The stained tectorin bands were identified, cut out from the blots, and sequenced using standard procedures on a 477A liquid-pulse instrument (PE Applied Biosystems) and a Beckman LF 3000 automated NH2-terminal sequencer.

Reverse Transcription PCR

Differential analysis of reverse transcriptase (RT)-mediated PCR products obtained from a region of the cochlea that is known to produce the tectorial membrane and from one that is not involved in tectorial membrane production was used to identify products potentially derived from tectorin cDNAs. The combined greater and lesser epithelial ridges (GLER) which are known to produce the tectorial membrane, and the stria vascularii which are not involved in tectorial membrane synthesis were dissected from the cochleae of 100 2-3-day-old postnatal Swiss CD1 mice (Charles River, United Kingdom) in Hepes-buffered Hanks' balanced salt solution, pH 7.0, collected separately, and snap frozen in liquid nitrogen. Poly(A)+ RNA was isolated by a one-step oligo(dT)-cellulose selection method (Quick Prep Micro kit, Pharmacia, St. Albans, United Kingdom) and double stranded cDNA was synthesized from 2 µg of poly(A)+ RNA in a final volume of 20 µl using a commercial kit (Boehringer Mannheim). Degenerate forward and reverse oligonucleotide primers based on the NH2-terminal amino acid sequences of the chick alpha 4- and alpha 5-tectorins (alpha 4S1, ATGGCNTCN(CT)TNTA(TC)CCNTT; alpha 4R1, AANGG(GA)TANA(GA)NGANGCCAT; alpha 5S1, GTNACNGCNAA(AG)AA(TC)GA(AG)GA; alpha 5R1, TC(TC)TC(AG)TT(TC)TTNGCNGTNAC) were used to isolate candidate alpha -tectorin RT-PCR products. A degenerate sense primer based on NH2-terminal sequence from one of the mouse tectorin bands (mtm4S1, GA(AG)CA(TC)ACNCCNAA(TC)AA(AG)GC), and a degenerate antisense primer (beta TDEGR, GGNGTNGCCCA(AG)CA(AG)TT) based on an amino acid sequence (CWATPS) conserved in chick beta -tectorin and mouse alpha -tectorin were used to isolate a beta -tectorin specific RT-PCR product. Separate PCR reactions using 1-µl aliquots of the two cDNA populations and 50 pmol of each primer in a 50-µl reaction volume (as described in Ref. 3) were hot started and followed by 25 cycles of 50 °C for 15 s, 72 °C for 1 min, and 94 °C for 15 s. The reactions ended with a 10-min incubation at 72 °C. PCR products were analyzed by agarose gel electrophoresis in 1 × Tris borate-EDTA buffer and products specific to the GLER were isolated using GeneClean (Stratech Scientific, Luton, United Kingdom).

Preparation and Screening of Mouse Cochlear cDNA Libraries

GLER samples were collected from the cochleae of approximately 500 2-3-day-old postnatal Swiss CD1 mice as described above. Total RNA was isolated using guanidinium thiocyanate extraction (11) followed by cesium trifluoroacetate gradient centrifugation (12) and poly(A)+ mRNA selected by oligo(dT)-cellulose chromatography (Quick Prep Micro kit, Pharmacia). A directionally cloned, oligo(dT)-primed cDNA library was constructed using commercial kits (Stratagene, Cambridge, United Kingdom). First strand cDNA synthesis was primed with an oligo(dT) primer containing a 5' XhoI site, the cDNA was then double stranded, EcoRI adaptors were added and the cDNA digested with XhoI. The cDNA was directionally ligated into lambda  UniZap XR arms and packaged in vitro. A randomly primed cDNA library was constructed in a similar manner, with the following modifications; poly(A)+ RNA was isolated directly from the GLER of 300 2-3-day-old postnatal mouse cochleae with a Quick Prep Micro kit, first strand cDNA synthesis was primed with a mixture of random hexamers and an antisense primer designed to the 5' end of clone A2 (GAAATGGAGGCGTAGTGCTG) and, after addition of EcoRI adaptors, the double stranded cDNA was ligated into the EcoRI site of lambda  Zap II. Libraries were screened at high density with 32P-labeled DNA probes. Positive plaques were rescreened to purity and converted to plasmids by phage rescue.

Southern and Northern Blotting

Genomic DNA was isolated from neonatal mouse brain by a modification of the method of Blin and Stafford (13, 14). Aliquots of DNA (10 µg) were digested to completion with EcoRI, PstI, SacI, or KpnI in the supplied buffers (Promega Ltd., Southampton, United Kingdom), electrophoresed on a 0.7% agarose gel in 1 × Tris borate-EDTA buffer, transferred to nylon membrane (Hybond N, Amersham International, Little Chalfont, United Kingdom) (15), and covalently bound to the dried membrane by UV cross-linking. Hybridization to 32P-labeled DNA probes and washing to high stringency were carried out according to the manufacturer's instructions.

Poly(A)+ RNA was isolated from cochlear, brain, heart, liver, kidney, intestine, lung, and skin tissues of 2-3-day-old postnatal mice as described for RT-PCR. Aliquots (3 µg) were electrophoresed on a 1% agarose-formaldehyde gel (14) and transferred to nylon membrane as described above. Hybridization to 32P-labeled DNA probes and washing to high stringency were carried out as described by Angst et al. (16).

Probe Preparation and Labeling

Probes for Southern and Northern blotting were generated by PCR or restriction enzyme digestion of cDNA clones. Probe fragments were separated by gel electrophoresis, recovered with GeneClean or Gelex resin (Stratech Scientific), and random primer labeled (17) with [alpha -32P]dCTP using a MegaPrime labeling kit (Amersham). Unincorporated label was removed on Sephadex G-50 columns (Pharmacia) and the probes were denatured with alkali before use.

DNA Sequencing and Analysis

Double stranded plasmid DNA minipreps (Promega) of cDNA clones were sequenced by the method of Sanger et al. (18) using T7 DNA polymerase (Pharmacia) and a combination of sequencing templates from nested deletions (19) and templates primed with synthetic oligonucleotides. Analysis of DNA and derived amino acid sequences was performed using the DNA Star package (DNA Star, London, United Kingdom). DNA and protein sequence data bases (GenBank, EMBL, DDBJ, and PDB) were searched using the BLAST network service at the National Center for Biotechnology Information (20).

Preparation of Antipeptide Sera

Three synthetic peptides for alpha -tectorin (malpha 25-38, RELMYPFWQNDTRT; malpha 742-755, TCPERPEYLEIDIN; malpha 2000-2014, KDNTIGIEENGVSLT) and one for beta -tectorin (mbeta 226-240, PTDETVLVHENGKDH) based on the derived amino acid sequences of alpha - and beta -tectorin were synthesized and purified by high performance liquid chromatography. Peptides were coupled to bovine serum albumin using glutaraldehyde (21) and dialyzed against phosphate-buffered saline. Conjugates (500 µg) were suspended in Freund's complete adjuvant and injected subcutaneously into rabbits. The immunization was repeated a further three times with Freund's incomplete adjuvant at 4-week intervals. Antipeptide antibodies were affinity isolated using the respective peptide coupled to either cyanogen bromide-activated Sepharose 4B or Affi-Gel 15.

Western Blotting

Mouse tectorial membranes were solubilized in reducing SDS-PAGE sample buffer, separated on 7.5% polyacrylamide gels, and transferred to nitrocellulose membranes using semi-dry blotting. Nitrocellulose blots were preblocked for 1 h with 3% dried milk powder, 10% horse serum in Tris-HCl buffered salt solution containing 0.05% Tween 20 and incubated overnight in the same solution containing the affinity isolated antipeptide antibodies at concentrations of 5 or 50 µg/ml. After washing, bound antibodies were labeled with biotinylated anti-rabbit Ig (1:1000 dilution) (Dako, High Wycombe, United Kingdom), followed by alkaline phosphatase-conjugated streptavidin (1:1000) (Vector Laboratories, Peterborough, United Kingdom). Alkaline phosphatase activity was visualized with 0.05 mg/ml bromochloroindolyl phosphate, 0.1 mg/ml nitro blue tetrazolium in alkaline phosphatase buffer (100 mM NaCl, 5 mM MgCl2, 100 mM Tris-HCl, pH 9.5).

In Situ Hybridization

Inner ears from 2-day-old postnatal mice were immersion fixed in ice-cold 4% paraformaldehyde in phosphate-buffered saline for 1 h prior to overnight fixation in 4% paraformaldehyde in phosphate-buffered saline containing 30% sucrose. Tissues were embedded in agarose and cryosectioned at a thickness of 20 µm. Aliquots (10 µg) of plasmid minipreps (Promega) of the alpha - and beta -tectorin cDNA clones A1 and B3 were linearized with either EcoRI or XhoI (Promega, United Kingdom)). Antisense RNA was transcribed from EcoRI cut clones using T7 RNA polymerase and sense RNA was transcribed from XhoI cut clones using T3 RNA polymerase. In situ hybridization, washing and autoradiography were carried out as described by Goodyear et al. (22).


RESULTS

NH2-terminal Amino Acid Sequence of Chick and Mouse Tectorins

NH2-terminal amino acid sequence data for the six chick alpha -tectorins and four mouse tectorin bands are presented in Tables I and II. The sequences for the chick alpha 2- and alpha 3-tectorin bands are identical suggesting chick alpha 3-tectorin is either a truncated or differentially glycosylated form of chick alpha 2-tectorin. The sequences show no similarity to derived amino acid sequences or proteins in the current data bases (GenBank, EMBL, DDBJ, and PDB) except for the sequence of the mtm4 band which has 86% identity with the predicted NH2 terminus of mature chick beta -tectorin (3). The mouse tectorin bands mtm2 and mtm3, which have Mr of 40,000 and 34,000, respectively, have almost identical NH2-terminal sequences, suggesting mtm2 is an incompletely deglycosylated form of mtm3 and that both tectorin bands are derived from the same protein. Furthermore, identity between the sequence YPFW in mtm3 and chick alpha 4-tectorin suggests that the mtm3 sequence is derived from the mouse homologue of chick alpha 4-tectorin. The first nine amino acids of the mtm1 band and chick alpha 1-tectorin also share 67% identity suggesting mtm1 is the mouse homologue of chick alpha 1-tectorin.

Table I.

NH2-terminal amino acid sequences of chick alpha -tectorins


Tectorin Mr Sequence

 alpha 1 146,000 PHYHTFDGFL
 alpha 2 60,000 MANELQYXQY
 alpha 3 56,000 MANELQYXQY
 alpha 4 43,000 MASLYPFW?P
 alpha 5 35,000 SDTFPTFTVTAKNEDRT?
 alpha 6 31,000 SDT?GHYY?VEGXQ

Table II.

NH2-terminal amino acid sequences of mouse tectorins


Polypeptide Mr Sequence

mtm1 150,000 QEYGTFDGF
mtm2 40,000 RELMYPFAQ
mtm3 34,000 RELMYPFWQN
mtm4 31,000 KXC?TPNK

Isolation and Identification of Mouse alpha - and beta -Tectorin cDNA Clones

Assuming that the different mouse alpha -tectorins were derived from a large precursor protein, RT-PCR was performed on poly(A)+ RNA from the GLER and stria vascularis with combinations of forward and reverse primers based on the NH2-terminal amino acid data. Using one primer pair based on the NH2-terminal amino acid sequences of the chick alpha 4 and alpha 5-tectorins (alpha 5S1 and alpha 4R1), a GLER-specific product of 300 bp was amplified which, while smaller than expected, was not amplified from the stria vascularis cDNA and hybridized to a cochlear-specific mRNA of about 7.5 kb on a Northern blot (data not shown). This GLER-specific PCR product was used to screen 4.5 × 105 plaque-forming units of the oligo(dT)-primed mouse cochlear cDNA library. Thirty-two positive clones were identified, of which two, A1 and A2, were selected for further study. Clone A1 is encoded by a single gene as judged by Southern blotting and, like the GLER specific PCR product, hybridizes to a cochlear-specific mRNA of approximately 7.5 kb on a Northern blot (Fig. 1, a and c). Sequence analysis of A1 and A2 suggested that they were derived from the same mRNA, but both lacked the 5' end. Clones extending further 5' were obtained by screening 1.0 × 105 plaque-forming units of the randomly primed mouse cochlear cDNA library with a PCR product from the 5' end of clone A2. Twenty-four further positives were identified of which one, A3, was found to encode the 5' end of the mRNA. Clone A1 was completely sequenced on both strands; A2 was sequenced on both strands where it extended 5' of A1, and clone A3 where it extended 5' of A2. Other regions were sequenced on one strand only (Fig. 2a). Sequences were assembled into a composite cDNA sequence of 7340 bp containing a large open reading frame (Fig. 2, a and b). A perfect match between the derived amino acid sequence and the NH2-terminal amino acid sequence of mtm3 confirms the cDNA encodes alpha -tectorin. Complete identity was also found between the NH2-terminal sequence of chick alpha 1-tectorin and the derived mouse alpha -tectorin sequence, but the NH2-terminal sequence of mtm1 only matches the derived sequence in 6 out of 9 positions.


Fig. 1. Southern and Northern analysis. a and b, Southern blots of mouse genomic DNA digested with KpnI (lane 1), SacI (lane 2), PstI (lane 3), and EcoRI (lane 4), probed with (a) a PCR product from clone A1, and (b) the cDNA insert from clone B2. Positions of size markers (1-kbp ladder) are shown between the blots. c and d, Northern blot of mouse poly(A)+ RNA from cochlea (lane 1), heart (lane 2), lung (lane 3), brain (lane 4), liver (lane 5), kidney (lane 6), intestine (lane 7), and skin (lane 8). The blot was first hybridized with the cDNA insert of clone A2 (c), then stripped and reprobed with the cDNA insert of clone B2 (d). Positions of size markers (RNA ladder) in kilobases are located to the left of both blots.
[View Larger Version of this Image (40K GIF file)]




Fig. 2. Cloning strategies (a and c) and sequences (b and d) of alpha -tectorin (a and b), and beta -tectorin (c and d). In a and c unshaded boxes indicate noncoding regions and shaded boxes indicate the open reading frames of the clones. In a the position of an alternatively spliced exon found in clone A1 is marked. In b the full derived amino acid sequence of alpha -tectorin is presented, together with the 5' and 3' regions of the cDNA sequence. In d complete cDNA and derived amino acid sequences are shown for beta -tectorin. In the derived amino acid sequences of alpha - and beta -tectorin (b and d), NH2- and COOH-terminal hydrophobic sequences are heavily underlined, matches with NH2-terminal protein sequence data are thinly underlined, tetrabasic sequences are double underlined, and consensus N-glycosylation sites are marked with dots ( ... ). In b, the position at which the additional exon in clone A1 is spliced into alpha -tectorin is marked (down-triangle) but the exon is not included. The first in-frame start codon is underlined in the cDNA sequence of alpha -tectorin (b) and in both cDNA sequences (b and d) in-frame stop codons are marked with asterisks and polyadenylation signals are underlined. These sequence data are available from the EMBL Nucleotide Sequence Data base, accession numbers X99805[GenBank] and X99806[GenBank].
[View Larger Versions of these Images (60 + 58K GIF file)]


RT-PCR on poly(A)+ RNA from the GLER using degenerate primers for beta -tectorin generated a 570-bp product (data not shown), which was of the size predicted from the chick beta -tectorin sequence data. The product was used to screen 1.0 × 105 plaque-forming units of the randomly primed mouse cochlear cDNA library and 9 positive clones were identified and rescreened to purity. Two of these, B1 and B2, were selected for further study. Clone B2 is encoded by a single gene as judged by Southern blotting and hybridizes to a cochlear-specific mRNA of approximately 2.7 kb (Fig. 1, b and d). Sequence analysis of B1 and B2 suggested these were partial cDNA clones. Screening 1.0 × 105 plaque-forming units of the oligo(dT)-primed mouse cochlear cDNA library with clone B2 identified a further 20 clones. One of these, clone B3, was found to be full-length. Clone B2 was completely sequenced on both strands, and B1 and B3 were sequenced on both strands where they did not overlap with B2 (Fig. 2c). Overlapping regions were sequenced on one strand only. The DNA sequences were assembled into a composite cDNA sequence of 2745 bp with a single open reading frame (Fig. 2d). The derived amino acid sequence matches the NH2-terminal sequence of mtm4 in 6 out of 7 positions and has 75.3% overall sequence identity with chick beta -tectorin, confirming the cDNA sequence encodes the mouse homologue of chick beta -tectorin.

Analysis of alpha - and beta -Tectorin Sequences

The alpha -tectorin cDNA sequence (Fig. 2b) has a 5'-untranslated region of 267 bp, a single open reading frame of 6453 bp, and a 3'-untranslated region of 620 bp containing two consensus polyadenylation signals, the second of which is followed by a poly(A) tail. The open reading frame is initiated at base 268 by the second ATG codon in the cDNA sequence. This codon matches the consensus initiation codon (23) by the presence of a purine at -3 and a cytosine at -4, whereas the first ATG codon, at position 121, matches only at the -3 position and is also followed by three in-frame stop codons at positions 154, 184, and 227. The beta -tectorin cDNA sequence (Fig. 2d) has a 5'-untranslated region of 130 bases followed by an open reading frame of 963 bp, which is initiated at base 131 by the first ATG codon in the sequence. This codon matches the consensus initiation codon (23) by the presence of a purine at -3 and a cytosine at -2. The 1652-bp 3'-untranslated region of beta -tectorin is unusually long and contains two potential polyadenylation signals. The second of these is used and is followed 24 bases downstream by a poly(A) tail.

The open reading frame of alpha -tectorin encodes a polypeptide of 2150 amino acids which has a calculated molecular mass of 239,034 Da and contains 33 potential N-glycosylation sites (Fig. 2b), whereas that of beta -tectorin encodes a much smaller polypeptide of only 320 amino acids with a calculated molecular mass of 36,074 Da and 4 potential N-glycosylation sites (Fig. 2d). A number of features are common to these two derived amino acid sequences. Both start with hydrophobic signal sequences, as expected for secreted molecules (24). Identity between the NH2-terminal amino acid sequence of mtm2/3 and residues 25-31 of the derived amino acid sequence of alpha -tectorin implies the signal peptide is cleaved between amino acids 24 and 25. The presence of an alanine at position 22 conforms to the -3 position of the signal peptide cleavage site (25), however, the proline at position 24 does not fit the consensus -1 position. Similarly, for beta -tectorin, identity between the NH2-terminal amino acid sequence for mtm4 and residues 18-24 of the derived amino acid sequence implies that the signal peptide is cleaved between amino acids 17 and 18 to generate the mature NH2 terminus of beta -tectorin. Alanine residues at positions 15 and 17 in the beta -tectorin sequence conform perfectly to the -3, -1 rule of von Heijne (25) for signal peptide cleavage. The derived amino acid sequences of both alpha - and beta -tectorin terminate with sequences of predominantly hydrophobic residues (Fig. 2, b and d) characteristic of proteins that are membrane bound via a glycosylphosphatidylinositol tail (26-28). The method of Kodukula et al. (29) predicts that the asparagine at position 2086 in alpha -tectorin is the most likely acceptor for the glycosylphosphatidylinositol anchor, but does not provide a clear candidate residue in the case of beta -tectorin. These hydrophobic COOH termini are both preceded a short distance upstream by tetrabasic motifs (Fig. 2, b and d) that are characteristic of endoproteinase cleavage sites (30, 31) and it seems likely that, as previously suggested for chick beta -tectorin (3), mouse alpha - and beta -tectorin are both synthesized as lipid-linked, membrane-bound precursors, targeted to the apical surface of the cochlear epithelium by the lipid (32) and then released into the extracellular compartment by the action of an endoproteinase.

Alternative Splicing of alpha -Tectorin mRNA

Comparing the cDNA sequences of the three alpha -tectorin clones identified a 15-bp sequence present in clone A1, but absent in A2, which encodes five amino acids, PLAPS (Fig. 3a). PCR of mouse genomic DNA with primers immediately adjacent to this sequence amplified a product of 1.5 kbp (Fig. 3b), suggesting this sequence may be an alternatively spliced exon flanked by approximately 1.4 kbp of intron sequences. RT-PCR of mouse GLER cDNA amplified products of 77 and 62 bp corresponding to both possible splice variants and suggests the variant lacking the 15-bp exon is the more common form (Fig. 3c). Splicing this exon into the mRNA changes Ser1659 to an Arg residue, creating a new dibasic sequence, Lys-Arg1658-1659. Additional faint bands of 101 and 104 bp are also observed (Fig. 3c) suggesting there are additional splice variants in this region.


Fig. 3. a, parts of the cDNA and derived amino acid sequences for alpha -tectorin are shown, together with a 15-bp sequence found in clone A1 (shaded) but not in clone A2. This sequence in A1 interrupts the codon for Ser1659 between the second and third bases, changing it to an Arg codon and introducing sequence encoding five further amino acids, PLAPS. These two options are shown by lines in a. b, 1% agarose gel of products of PCR on mouse genomic DNA using primers flanking this region (the 3' ends of the primers are marked by arrowheads in a). A single band of 1.5 kbp is amplified (lane 1, with genomic DNA; lane 2, control). c, 10% polyacrylamide gel of the products of RT-PCR on GLER poly(A)+ RNA. The expected products of 77 and 62 bp, and additional products of 104 and 101 bp were amplified (c: lane 1, marked by arrowheads; lane 2, no RNA control). Control PCR reactions on clone A1 generated the 77-bp product (lane 3) and on clone A2 generated the 62-bp product (lane 4; lane 5, no DNA control). Positions of size markers are shown to the right of b (1-kbp ladder) and c (10-bp ladder and 1-kbp ladder).
[View Larger Version of this Image (34K GIF file)]


Sequence Similarities

Similarity searches of the current data bases suggest alpha -tectorin is composed of three distinct modules, each with homology to different proteins. The first 219 amino acids of the NH2-terminal region of alpha -tectorin show 24.9% similarity to a part of the first globular domain (G1) of entactin/nidogen (Fig. 4a) (33, 34). A 39-amino acid stretch separates this NH2-terminal domain from the central domain which is 1528 amino acids long and is composed of three full repeats and two partial repeats homologous to the D domains of prepro-von Willebrand factor (vWF), zonadhesin, and the intestinal mucin muc2 (Fig. 4b) (35-37). The D domains are rich in cysteine, and the positions of the cysteines within the individual domains of alpha -tectorin match well, with 28 out of 37 positions being fully conserved (Fig. 4b). At the carboxyl end of the alpha -tectorin sequence there is a stretch of 255 amino acids which exhibits similarity to the zona pellucida domains (38) of uromodulin (39) and GP2 (40) (Fig. 4c, Table III). This region of alpha -tectorin is also similar to other members of the zona pellucida domain family, and, most significantly, to chick and mouse beta -tectorin (Fig. 4c, Table III). Mouse beta -tectorin contains a single zona pellucida domain (Fig. 4c) and all the major features of chick beta -tectorin are conserved in the mouse sequence, including the four consensus N-glycosylation sites, the 12 cysteine residues, and the extended basic sequence preceding the hydrophobic tail.


Fig. 4. a, alignment of the derived amino acid sequences of mouse alpha -tectorin (Mm alpha -tect) and mouse entactin (Mm entact, Ref. 33). b, alignment of the vWF type D repeats of mouse alpha -tectorin. c, alignment of the ZP domains of mouse alpha - and beta -tectorin, chick beta -tectorin (Gg beta -tect, Ref. 3), canine GP2 (Cf gp2, Ref. 40), human uromodulin (Hs uro, Ref. 39), mouse ZP2 (Mm zp2, Ref. 56), and human ZP3 (Hs zp3, Ref. 57). Conserved residues are boxed and shaded, and cysteines are heavily shaded. Vicinal cysteines in b are marked with an asterisk. In c, consensus N-glycosylation sites conserved in mouse and chick beta -tectorin are marked by dots ( ... ). Amino acid numbers on the right correspond to those in the original references.
[View Larger Version of this Image (84K GIF file)]


Table III.

Comparison of the ZP domains of alpha - and beta -tectorin, GP2, uromodulin, ZP2 and ZP3

Percentage sequence identities between the ZP domains of chick and mouse beta -tectorin (Gg and Mm beta -tec), mouse alpha -tectorin (Mm alpha -tec), dog GP2 (Cf GP2), human uromodulin (Hs uro), mouse ZP2 (Mm ZP2), and human ZP3 (Hs ZP3).


Gg beta -tec
82.4 Mm beta -tec
27.7 29.0 Mm alpha -tec
27.1 27.9 47.6 Cf GP2
26.4 26.6 46.6 65.4 Hs uro
17.1 20.0 21.9 18.2 18.5 Mm ZP2
15.2 16.2 16.4 18.5 16.8 18.2 Hs ZP3

Western Blotting with Antipeptide Antibodies

Antibodies were raised to peptide sequences in the three different modules of the alpha -tectorin sequence and used to determine whether the HMM, MMM, and LMM tectorins observed on reducing SDS gels are derived from these different regions (Fig. 5). Antibodies to a peptide sequence (malpha 742-755) in the second full vWF type D repeat of alpha -tectorin detect a broad smear extending from the top of the separating gel down to the 170-kDa region of the gel corresponding to HMM tectorin (Fig. 5, lane 1). Antibodies to a sequence (malpha 2000-2014) in the zona pellucida domain react with a band of 60 kDa corresponding to MMM tectorin, and additional polydisperse material in the 210-135-kDa region of the gel (Fig. 5, lane 2). Antibodies to a peptide sequence (malpha 25-38) at the predicted NH2 terminus of the module with similarity to the G1 domain of entactin, recognize a broad diffuse band in the 42-55-kDa region of the gel (LMM tectorin) and a faint band of 205 kDa (Fig. 5, lane 3). An antibody raised to a peptide in the derived amino acid sequence of beta -tectorin recognizes a single sharp band of 45 kDa (Fig. 5, lane 4).


Fig. 5. Western blots of mouse tectorial membrane proteins stained with antibodies to peptides malpha 742-755 (lane 1), malpha 2000-2014 (lane 2), malpha 25-38 (lane 3), and mbeta 226-240 (lane 4). Positions of molecular mass markers in kDa are indicated to the left of the blots.
[View Larger Version of this Image (29K GIF file)]


Expression Patterns of alpha - and beta -Tectorin in the Inner Ear

In situ hybridization was used to study the distribution of alpha - and beta -tectorin mRNAs in the inner ear of the 2-day postnatal mouse. This stage of development was chosen as it is known to be a period when the tectorial membrane is being produced. In the cochlea, alpha -tectorin mRNA is expressed on both sides of the organ of Corti. It is expressed in the pseudostratified cells of the greater epithelial ridge on the modiolar side of the inner hair cells, and in the immature Hensen's cells that lie alongside the outermost row of outer hair cells (Fig. 6a). Expression of beta -tectorin is also found in the immature Hensen's cells and in the greater epithelial ridge. However, in comparison to alpha -tectorin, beta -tectorin is expressed within a more restricted zone of the greater epithelial ridge that lies adjacent to the inner hair cells of the organ of Corti (Fig. 6b). In addition, beta -tectorin is expressed by the pillar cells that lie between the inner and outer hair cells within the organ of Corti, and the resultant pattern observed with beta -tectorin antisense probes is one of three stripes arrayed across the organ (Fig. 6b). In the saccule and utricule, alpha -tectorin is expressed at low levels within the sensory macula, but strongly expressed in the transitional zone around the periphery of the macula and in a region that is producing the accessory membrane, a structure that connects the otolithic membrane to the roof of the organ (Fig. 6c). In contrast, beta -tectorin is expressed in a restricted region of the macula called the striola (Fig. 6d), a region where there is known to be a high density of vestibular Type I hair cells (41).


Fig. 6. Expression of alpha - and beta -tectorin in the inner ear of the 2-day postnatal mouse. Sections of the cochlea (a and b) and the saccule (c and d) hybridized with 35S-labeled antisense probes for alpha  (a and c) and beta  (b and d) tectorin. Positions of the inner (i) and outer (o) hair cells are indicated in a and b. In c the region of the roof (r) and the transitional zone (t) expressing alpha -tectorin are indicated, and in d the striolar region (s) is labeled. Bar in d = 100 µm and applies to all panels.
[View Larger Version of this Image (71K GIF file)]



DISCUSSION

The results describe the isolation and characterization of cDNA clones for mouse alpha - and beta -tectorin. The cDNA for alpha -tectorin encodes a large protein of 239 kDa and that of beta -tectorin a smaller protein of 36 kDa, and together these two proteins can account for the HMM, MMM, and LMM tectorins observed with SDS-PAGE. The genes encoding these proteins are expressed at high levels in the developing inner ear, and not in a number of other tissues of the early postnatal mouse, indicating the tectorins may be matrix molecules unique to the inner ear. Sequence data show both proteins are probably synthesized as glycosylphosphatidylinositol-linked membrane bound precursors which may be targeted to the apical surface of the inner ear epithelia by the lipid and released by endoproteolytic activity. The two proteins share a common module, the zona pellucida domain, which may enable them to form filaments, and alpha -tectorin contains additional modules which could allow it to interact with beta -tectorin. Mouse and chick beta -tectorin share 75% overall sequence identity, both the NH2-terminal sequence data for the chick alpha -tectorins presented in this study and preliminary data from chick alpha -tectorin cDNA clones2 indicate the chick and mouse alpha -tectorins are conserved at a similar level, and the derived amino acid sequence of a human brain expressed sequence tag (accession number R84585[GenBank]) is 92% identical to mouse alpha -tectorin. The tectorins are therefore highly conserved and may be fundamentally important in the process of mechanotransduction.

Matches between the NH2-terminal sequence data for the mouse and chick tectorins and the derived amino acid sequence of mouse alpha -tectorin, together with data from Western blots with antipeptide antibodies, indicate that the HMM, MMM, and LMM tectorins are generated by proteolytic cleavage of alpha -tectorin, with beta -tectorin also contributing to the LMM tectorin band. The domain structure of alpha -tectorin and way in which the sequence may be cleaved are shown in Fig. 7a. The NH2-terminal amino acid sequences of mtm1 and chick alpha 1-tectorin match residues 328-336/7 of the derived alpha -tectorin sequence in 6/9 and 10/10 positions, respectively, that of chick alpha 2/3 tectorin partially matches residues 1659-1668 in 7/10 positions, and that of mtm4 is identical to the predicted mature NH2 terminus of the alpha -tectorin sequence. Polypeptides with these NH2 termini would have predicted masses of 147,360, 47,020, and 34,092 Da, respectively (Fig. 7a), values which are close to those observed for mouse tectorins following enzymatic deglycosylation with a combination of endo-beta -galactosidase and N-glycosidase F. Western blotting with antibodies to synthetic peptides based on different regions of the predicted alpha -tectorin sequence provides further evidence for this scheme. Antibodies to a sequence in the second full vWF type D repeat react with HMM tectorin, antibodies to a sequence in the ZP domain stain MMM tectorin, and antibodies to the predicted mature NH2 terminus of alpha -tectorin stain LMM tectorin. Good partial matches for the NH2-terminal amino acid sequence data of the chick alpha 5- and alpha 6-tectorins (75 and 67%, respectively) are also found within the region of the predicted mouse sequence that gives rise to mouse HMM tectorin according to the scheme described above. Cleavage at these sites in chicken alpha -tectorin may explain why the polypeptide core of the largest chick alpha -polypeptide, chick alpha 1-tectorin, is some 60 kDa smaller than that of the largest mouse alpha -tectorin.3


Fig. 7. a, summary diagram of the predicted domains in the mouse alpha -tectorin sequence and the proteolytic cleavage patterns that generate the HMM, MMM, and LMM tectorins. Positions of identity with the NH2-terminal sequence data are also indicated. b, a comparison of the modular structures of ZP3, ZP2, GP2, uromodulin, beta -tectorin, alpha -tectorin, and zonadhesin.
[View Larger Version of this Image (27K GIF file)]


Although the predicted sequence of mouse alpha -tectorin can account for the three major tectorins observed on SDS gels under reducing conditions, it is not clear whether the three alpha -tectorins are genuine subunits generated by active processing or simply the result of proteolysis occurring between intrachain disulfide bonds. Furthermore, the way in which this sequence appears to be processed does not clearly divide the protein into the three different modules defined by sequence analysis as the predicted NH2 termini of HMM and MMM tectorin both occur within the vWF type D repeats. The presence of a splice variant introducing a dibasic, potential endoproteinase cleavage site close to the theoretical start of the MMM tectorin polypeptide within the D4 repeat indicates this site may be of functional significance, but it should be noted that there are also many dibasic sites throughout the predicted sequence and none lie immediately upstream of the theoretical NH2 terminus of HMM tectorin. However, the splice variant without the dibasic site upstream of the potential NH2 terminus of MMM tectorin is the major species present and this may explain why the antibodies to the peptide sequence in the zona pellucida domain react with both MMM tectorin and higher molecular mass material.

While it is unclear whether alpha -tectorin is processed or slowly subject to site-specific proteolytic damage in vivo, the three distinct modules may play different roles in organizing the structure of the non-collagenous matrix of the mammalian tectorial membrane, in conjunction with beta -tectorin. The predicted sequence of mouse beta -tectorin, like that of alpha -tectorin, contains a single zona pellucida domain, a 260-amino acid module with 8 strictly conserved cysteine residues (38). This is the only common feature shared by a number of different proteins (Fig. 7b) all of which either can or do form filament based matrices or gels (42-48), and it has been suggested that it may be the element that enables them to form filaments (3). The presence of this domain in both of the two major components of the filament based non-collagenous matrix of the mouse tectorial membrane suggests that these two proteins may either self-associate via their respective zona pellucida domains to form homomeric filaments, or interact with each other via their zona pellucida domains to form heteromeric filaments. The presence of two distinct filament types, a light and a dark staining filament, in the collagenase-insensitive, striated sheet matrix of the tectorial membrane (8) immediately suggests alpha -tectorin may form one filament type and beta -tectorin the other. If the two molecules self-associate to form homomeric filaments via their zona pellucida domains, then it is conceivable that the two filament types interact with one another to form the striated sheet matrix via either the LMM or HMM alpha -tectorin modules. In this respect it is interesting to note that the central, HMM domain of alpha -tectorin containing the 2 partial and three full vWF type D repeats shares its highest homology with zonadhesin, a recently described sperm membrane protein that binds to the zona pellucida in a species specific manner (49, 36). Zonadhesin is a transmembrane protein with 3 types of extracellular domain, an NH2-terminal domain with no homology to other proteins, a threonine/serine/proline-rich mucin type domain, and a membrane proximal domain with 1 partial and 4 full vWF type D repeats (36) (Fig. 7b). During sperm maturation the first two domains of zonadhesin are lost and the membrane proximal domain with the vWF repeats is cleaved into two, disulfide cross-linked polypeptides with Mr of 105,000 and 45,000 which as a complex have the ability to bind to the zona pellucida. Not only is the homology between the vWF type D repeats of zonadhesin and alpha -tectorin high (26%), but the order of these repeats is the same in both alpha -tectorin and zonadhesin, whereas it is different in vWF and the mucins. Homomeric filaments of alpha -tectorin and beta -tectorin may therefore interact with one another via the HMM, zonadhesin-like module of alpha -tectorin, either alone or in conjunction with LMM tectorin. Although the LMM module shows similarity with nidogen, an organizer of the extracellular matrix (50, 51), the region of identity has no known function.

However, there are alternative possibilities for how the two proteins could interact. For example, alpha -tectorin molecules could form homomeric filaments via the vWF type D domains of HMM tectorin, with these filaments then interacting via their zona pellucida domains with homomeric beta -tectorin filaments. Individual pro-vWF subunits form dimers between adjacent COOH termini, and the dimers then oligomerize to form multimers via the NH2 termini of their D3 domains. These vWF multimers appear as long, thin filaments in rotary shadowed preparations (52, 53). Multimerization of vWF is dependent on vicinal cysteines present in the D1 and D2 domains of the vWF pro-sequence that are thought to have protein disulfide isomerase activity and be responsible for interchain disulfide bonding (54). Vicinal cysteines are also present in the D1 and D4 domains of alpha -tectorin (Cys458 and Cys461 in D1, Cys1619 and Cys1622 in D4, see Fig. 4) and may have similar catalytic activity and be involved in some aspect of tectorial membrane matrix assembly, although this may not be necessarily the oligomerization of alpha -tectorin to form filaments as there is no evidence for the presence of covalently linked alpha -tectorin multimers in the tectorial membrane. A third potential model for the organization of alpha - and beta -tectorin in the matrix would be one in which the two proteins interact via their ZP domains to form heteromeric filaments like the zona pellucida proteins, ZP2 and ZP3 (47). These in turn could bind to one another via the HMM module of alpha -tectorin, again either with or without the participation of the LMM module.

In situ hybridization shows that there are groups of cells in the inner ear that express either alpha - or beta -tectorin, or both molecules simultaneously. While this suggests alpha - and beta -tectorin can probably form homomeric filaments, it does not rule out the possibility they form heteromeric filaments in those areas where they are co-expressed. The patterns of alpha - and beta -tectorin expression observed in the inner ear are more complex than expected and do not obviously correlate with the regional variations in matrix structure that have been described in previous morphological studies (7, 55, 8). For example, the immature Hensen's cells are thought to produce the marginal band, a region of densely packed matrix, and the cells in the greater epithelial ridge lying adjacent to the inner hair cells form the midbody of the tectorial membrane where the matrix is loosely packed (7), yet both of these cell groups co-express alpha - and beta -tectorin. Likewise the limbal undersurface of the tectorial membrane and Hensen's stripe are regions of densely packed matrix, and yet the former is most likely to be produced by the cells of the greater epithelial ridge lying next to the limbus that are expressing only alpha -tectorin, and the latter could be produced by the pillar cells that are expressing only beta -tectorin. Regional differences in matrix structure may be important for eliciting the correct response from different types of hair cells. For example, as in the chick, beta -tectorin expression in the otolithic maculae is restricted to the striolar region, an area in the mammal where a high density of type I hair cells is found (41). While differences in the ratio of alpha - and beta -tectorin expressed in any one region may be one factor that influences matrix structure, variations in their glycosylation patterns, or the alpha -tectorin splice forms that are used could also be important determinants. Modulation of the relative expression of alpha - and beta -tectorin with respect to time during development could also play a role in shaping the structure of the tectorial membrane.

The results of this present study provide a complete molecular characterization of the two major non-collagenous glycoproteins of the mammalian tectorial membrane, an extracellular matrix essential for the perception of sound. These data should now allow the structure and properties of this matrix to be manipulated both selectively and non-invasively and reveal how the tectorial membrane influences frequency tuning in the cochlea.


FOOTNOTES

*   This work was supported by the Medical Research Council, the Hearing Research Trust, and European Union Contract CHRXCT 94-0659.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) X99805[GenBank] (alpha -tectorin) and X99806[GenBank] (beta -tectorin).


   To whom correspondence should be addressed: School of Biological Sciences, University of Sussex, Falmer, Brighton, BN1 9QG, United Kingdom. Tel.: 44-1273-678397; Fax: 44-1273-678433; E-mail: g.p.richardson{at}sussex.ac.uk.
1   The abbreviations used are: HMM, MMM, and LMM, high, medium, and low molecular mass; CHAPS, 3-[(3-cholamidopropyl)dimethylammonia]-1-propanesulfonate; GLER, greater and lesser epithelial ridges; PAGE, polyacrylamide gel electrophoresis; PCR, polymerase chain reaction; RT, reverse transcriptase; vWF, von Willebrand factor; bp, base pair(s); kbp, kilobase pair(s).
2   Coutinho, P., Legan, P. K., Goodyear, R., and Richardson, G. P., manuscript in preparation.
3   G. P. Richardson, unpublished observations.

ACKNOWLEDGEMENTS

We thank C. Malenczak for technical assistance, Chris Kowalczyk of the Sussex Center for Neuroscience for providing the mouse tectorin NH2-terminal sequence data, and both Ian Russell and Richard Goodyear for critical discussions and comments on the manuscript.


REFERENCES

  1. Tanaka, K., and Smith, C. A. (1975) Ann. Otol. Rhinol. & Laryngol. 84, 287-296 [Medline] [Order article via Infotrieve]
  2. Killick, R., Malenczak, C., and Richardson, G. P. (1992) Hearing Res. 64, 21-38 [CrossRef][Medline] [Order article via Infotrieve]
  3. Killick, R., Legan, P. K., Malenczak, C., and Richardson, G. P. (1995) J. Cell Biol. 129, 535-547 [Abstract/Free Full Text]
  4. Richardson, G. P., Russell, I. J., Duance, V. C., and Bailey, A. J. (1987) Hearing Res. 25, 45-60 [CrossRef][Medline] [Order article via Infotrieve]
  5. Thalmann, I., Thallinger, G., Crouch, E. C., Comegys, T. H., Barret, N., and Thalmann, R. (1987) Laryngoscope 97, 357-367 [Medline] [Order article via Infotrieve]
  6. Killick, R., and Richardson, G. P. (1997) Hearing Res. 103, 131-141 [CrossRef][Medline] [Order article via Infotrieve]
  7. Kronester-Frei, A. (1978) Cell Tissue Res. 193, 11-23 [Medline] [Order article via Infotrieve]
  8. Hasko, J. A., and Richardson, G. P. (1988) Hearing Res. 35, 21-38 [CrossRef][Medline] [Order article via Infotrieve]
  9. Slepecky, N. B., Cefaretti, L. K., and Yoo, T. J. (1992) Matrix 11, 80-86
  10. Laemmli, U. K. (1970) Nature 227, 680-685 [CrossRef][Medline] [Order article via Infotrieve]
  11. MacDonald, R. J., Swift, G. H., Przybyla, A. E., and Chirgwin, J. M. (1987) Methods Enzymol. 152, 219-227 [Medline] [Order article via Infotrieve]
  12. Okayama, H., Kawaichi, M., Brownstein, M., Lee, F., Yokota, T., and Arai, K. (1987) Methods Enzymol. 154, 3-28 [Medline] [Order article via Infotrieve]
  13. Blin, N., and Stafford, D. W. (1976) Nucleic Acids Res. 3, 2303-2308
  14. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  15. Southern, E. M. (1975) J. Mol. Biol. 98, 503-517 [CrossRef][Medline] [Order article via Infotrieve]
  16. Angst, B. D., Nilles, L. A., and Green, K. J. (1990) J. Cell Sci. 97, 247-257 [Abstract/Free Full Text]
  17. Feinberg, A. F., and Vogelstein, B. (1983) Anal. Biochem. 132, 6-13 [CrossRef][Medline] [Order article via Infotrieve]
  18. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 5463-5467 [Abstract/Free Full Text]
  19. Henikoff, S. (1984) Gene (Amst.) 28, 351-359 [CrossRef][Medline] [Order article via Infotrieve]
  20. Altschul, F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990) J. Mol. Biol. 215, 403-410 [CrossRef][Medline] [Order article via Infotrieve]
  21. Doolittle, R. F. (1986) Of URFs and ORFs: A Primer on How to Analyze Derived Amino Acid Sequences, University Science Books, Mill Valley, CA
  22. Goodyear, R., Killick, R., Legan, P. K., and Richardson, G. (1996) Hearing Res. 96, 167-178 [CrossRef][Medline] [Order article via Infotrieve]
  23. Kozak, M. (1984) Nucleic Acids Res. 12, 857-872 [Abstract/Free Full Text]
  24. Perlman, D., and Halvorson, H. O. (1983) J. Mol. Biol. 167, 391-409 [CrossRef][Medline] [Order article via Infotrieve]
  25. von Heijne, G. (1986) Nucleic Acids Res. 14, 4683-4690 [Abstract/Free Full Text]
  26. Cross, G. A. M. (1987) Cell 48, 179-181 [CrossRef][Medline] [Order article via Infotrieve]
  27. Ferguson, M. A. J.