JBC Origene Your Gene Company

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhu, X.-G.
Right arrow Articles by Cheng, S.-Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhu, X.-G.
Right arrow Articles by Cheng, S.-Y.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 14, Issue of April 4, 1997 pp. 9048-9054
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

The Differential Hormone-dependent Transcriptional Activation of Thyroid Hormone Receptor Isoforms Is Mediated by Interplay of Their Domains*

(Received for publication, July 30, 1996, and in revised form, December 9, 1996)

Xu-Guang Zhu , Peter McPhie Dagger , Kwang-Huei Lin § and Sheue-Yann Cheng

From the Laboratory of Molecular Biology, Division of Basic Sciences, Dagger  Laboratory of Biochemical Pharmacology, NIDDKD, National Institutes of Health, Bethesda, Maryland 20892 and § Department of Biochemistry, Chang-Guang Medical College, Kwei-San, Tao-yuan, Taiwan

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES


ABSTRACT

Human thyroid hormone nuclear receptor isoforms (TRalpha 1 and TRbeta 1) express differentially in a tissue-specific and development-dependent manner. It is unclear whether these two isoforms have differential functions. We analyzed their interaction with a thyroid hormone response element with half-site binding motifs arranged in an everted repeat separated by six nucleotides (F2). Despite extensive sequence homologies, the two isoforms bound to F2 with different affinities and ratios of homodimer/monomer. Using F2-containing reporter gene, we found that the transcriptional activity of TRbeta 1 was ~6-fold higher than that of TRalpha 1. The lower activity of TRalpha 1 was not due to differences in expression of the two isoforms because similar nuclear localization patterns were observed. To understand the structural determinants responsible for these differences, we constructed chimeric receptors in which hinge regions (domain D), hormone binding domains (domain E), and domains (D + E) were sequentially interchanged and their activities were compared. Chimeric TRs containing the domains D, E or (D + E) of TRbeta 1 showed increased propensities to form homodimers and mediated higher transactivation activities than TRalpha 1. Thus, differential transactivation activities of TR isoforms are mediated by interplay of their domains and could serve as an important regulatory mechanism to achieve diversity and specificity of pleiotropic T3 effect.


INTRODUCTION

Thyroid hormone receptors (TRs)1 are the products of two genes, TRalpha and TRbeta , located on chromosomes 17 and 3, respectively. Alternate splicings of their primary transcripts produce isoforms of the protein (alpha 1, alpha 2, beta 1, and beta 2), which regulate the transcription of their target genes by binding to specific DNA sequences, known as thyroid hormone response elements (TREs). These contain repeats of a half-site binding motif with the sequence AGGTCA. Naturally occurring TREs can include these sequences as adjacent palindromic repeats, as direct repeats separated by 4 nucleotides, and as everted repeats separated by 6 nucleotides (F2) (1, 2). The sequences of TRs have been divided into four separate domains, A/B, C, D, and E. Domain C contains two zinc fingers and is involved in binding of the receptors to TREs. Domains D and E are structurally linked, in so far as part of domain D is required for the biological function of domain E, which is to bind thyroid hormones (3). Domains D and E are also involved in binding to co-repressors and dimerization, respectively (4). The crystal structures of TRE-bound domains C of TRbeta 1 and the retinoid X receptor (5) and of domains D/E complexed with a thyroid hormone agonist (6) have recently been solved. These structures give important information on interaction within domains but reveal nothing about the modes and roles of the interaction between domains in intact receptors, which may have important biological significance.

Comparison of the sequences between the human TRalpha 1 (w-TRalpha 1) and human TRbeta 1 (w-TRbeta 1) indicates that except domain A/B, there is extensive sequence homology between the two isoforms, specifically 88% in domain C, 71% in domain D, and 86% in domain E. Despite this high sequence homology, biochemical evidence suggests that they could have isoform-specific roles in mediating the action of thyroid hormones. TRalpha and beta  genes are expressed at different stages during embryonic development (7, 8) and during amphibian metamorphosis (9). Moreover, these two isoforms are expressed differentially in different tissues (8, 10). More direct evidence to support the isoform-specific functional role of the TRalpha 1 and TRbeta 1 was provided by using gene transfer experiments. Strait et al. (11) showed that the gene encoding PCP-2 is regulated by TRbeta 1 but not by TRalpha 1. The 3,3',5-triiodo-L-thyronine (T3)-dependent negative regulation of thyroid tropin releasing hormone promoter was shown to be mediated by TRbeta 1 but not by TRalpha 1 (12). Recently, using stably transfected neuronal cell line, Lebel et al. (13) showed that only cells that overexpress TRbeta 1, but not TRalpha 1, can respond to T3 to exhibit morphological and functional characteristics indicative of neural differentiation.

At present, the molecular basis of isoform-specific gene regulation is not understood. It was suggested that the different homodimerization potentials of the two isoforms may underlie the functional differences. TRbeta 1 is known to bind to F2 and the TRE site on cardiac beta -myosin heavy chain mainly as a homodimer, whereas TRalpha 1 forms homodimer poorly (14, 15). These differences, however, are not eliminated by removal of A/B domains from the molecules (16) and consequently must arise from the remainder of the receptors. However, it is not clear that they are a consequence only of differences in sequence. They may also be caused by changes in interactions between domains in the intact receptors. Because of their marked effects on the properties of the receptors as transcription factors, we have investigated their origins by construction of a series of six chimeric receptors, in which domains A/B/C, D, and E from the two isoforms are joined in all possible combinations. We have measured their affinities for T3 under identical conditions and their binding to an F2 TRE. We also determined the T3-dependent transcriptional activity of the wild type and chimeric receptors. We found that the domains C, D, and E are functionally linked, and the differential transcriptional activity of the two isoforms is mediated by interplay of their domains.


EXPERIMENTAL PROCEDURES

Chemicals and Materials

Dulbecco's modified essential medium was purchased from BioWhittaker (Walkersville, MD). Fetal bovine serum and lipofectamine transfection reagents were from Life Technologies, Inc. [alpha -32P]dCTP was obtained from Amersham Life Sciences, Inc. [14C]Chloramphenicol and [3'-125I]T3 ([125I]T3) were purchased from DuPont NEN. TNT-coupled reticulocyte lysate in vitro translation kits were from Promega (Madison, WI).

Construction of Plasmids Encoding Chimeric TRalpha 1 and TRbeta 1

The T7-expression plasmids of the six chimeric receptors (see Fig. 2) were derived from the T7 expression plasmids of w-TRalpha 1 (pLC13) (17) and w-TRbeta 1 (pCJ3) (18). For cloning purpose, two restriction enzyme sites, NsiI and BamHI, were introduced into the boundaries between domains C and D and domains D and E of w-TRalpha 1 (nucleotide positions 412-414 (AAG/Lys to AAA/Lys) and 616-621 (GGCAGC/Gly-Ser to GGATCC/Gly-Ser)) to yield a new T7 expression plasmid of w-TRalpha 1, pCHalpha . Only one restriction site, BamHI, was required to introduce into the boundary between domains D and E of w-TRbeta 1 (nucleotide positions 991-996 (GGCAGC/Gly-Ser to GGATCC/Gly-Ser)) because in pCJ3 (w-TRbeta 1) the NsiI already existed which yielded a new T7 expression plasmid of w-TRbeta 1, pCHbeta . The introduction of these restriction sites was carried out by in vitro mutagenesis kit according to the manufacturer's instructions (Bio-Rad). The introduction of these two new restriction sites into TRalpha 1 and the BamHI site into TRbeta 1 did not change the amino acid sequences of TR isoform proteins. The six chimeric receptors were constructed by exchanging the domains between w-TRalpha 1 and w-TRbeta 1 using NsiI, BamHI, and the 3' EcoRI site immediately downstream of the termination codons of w-TRalpha 1 (nucleotide position 1306 for TRalpha 1 and 1672 for TRbeta 1 (pCJ3)) to yield T7 expression plasmids pCH1, pCH2, pCH3, pCH4, pCH5, and pCH6 for beta alpha beta , beta beta alpha , beta alpha alpha , alpha alpha beta , alpha beta alpha , and alpha beta beta , respectively (see Fig. 2). The coding sequences for the six chimeric receptors were verified by restriction map analyses and direct DNA sequencing.


Fig. 2. Schematic representation of w-TRbeta 1, w-TRalpha 1, and their chimeric receptors. I, the domain structure of the two isoforms and the extent of sequence homology. II, the chimeric receptors are designated by three-letter symbols, the first letter represents A/B and C domains; the second letter represents D domain, and the third letter represents E domain. The amino acid positions at the boundaries of domains C, D, and E are shown.
[View Larger Version of this Image (47K GIF file)]


The mammalian expression plasmids of the TRalpha 1 and TRbeta 1 chimeric receptors were derived from the corresponding w-TRalpha 1 and w-TRbeta 1 expression plasmids, pCLC61 and pCLC51 (19), respectively. The expression of w-TRalpha 1 and w-TRbeta 1 is driven by cytomegalovirus promoter. To prepare the mammalian expression plasmids of chimeric receptor of TRbeta 1, pCLC51 was restricted by NotI followed by filling in with Klenow in the presence of deoxynucleotides. The coding sequence of the w-TRbeta 1 in pCLC51 was then released by treating the linearized and blunt-ended pCLC51 with HindIII, thereby providing the vector for ligation to the proper chimeric TR coding fragments. The wild type and chimeric TRbeta 1 coding fragments were derived from the above T7 expression plasmids (pCHbeta , pCH1, pCH2, and pCH3) by treating the plasmids with EcoRI. After filling in, the fragments were released by treating with NdeI. An adaptor (HindIII/NdeI) was used in the final ligation of TR coding fragments to the vectors to yield plasmids pCDMCHbeta , pCDMCH1, pCDMCH2, and pCDMCH3 for W-TRbeta 1, beta alpha beta , beta beta alpha and beta alpha alpha , respectively. The mammalian expression plasmids of w-TRalpha 1 and its chimeric receptors were prepared similarly except that the vector was derived from pCLC61. The resulting mammalian plasmids were pCDMCHalpha , pCDMCH4, pCDMCH5, and pCDMCH6 for w-TRalpha 1, alpha alpha beta , alpha beta alpha , and alpha beta beta , respectively.

Electrophoresis Gel Mobility Assay (EMSA)

The probe, F2, was 32P-labeled similarly as described (20). Briefly, two complementary oligonucleotides containing the F2 sequences as shown in Sequence 1 below,
<UP> 5′ AAGGGGATCCTTATTGACCCCAGCTGAGGTCAAGTTACG 3′</UP>
<UP>           3′ AATAACTGGGGTCGACTCCAGTTCAATGCCTAGAAGGA 5′</UP>
<UP><SC>Sequence</SC></UP><UP> 1</UP>
were annealed and the recess 3'-end filled with DNA polymerase (Klenow fragment) in the presence of [alpha -32P]dCTP. The labeled oligonucleotides were separated on a 12% polyacrylamide gel and purified by electroelution.

For EMSA, unlabeled TRs synthesized by in vitro transcription/translation were used. The synthesized receptor proteins were quantified by measuring the intensity of the 35S-labeled protein bands after SDS-polyacrylamide gel electrophoresis using PhosphorImager (Molecular Dynamics, CA). The 35S-labeled protein was synthesized concurrently by using amino acid mixture minus methionine but with [35S]methionine (4 µl; 1190 Ci/mmol). Based on the quantitation of the labeled receptors, the amounts of the unlabeled receptors were calculated. For the determination of the binding constants of TRs to F2, equal amounts of the in vitro translated unlabeled receptors were incubated with increasing concentrations of the labeled probes (0.2-120 fmol) in the binding buffer (25 mM Hepes, pH 7.5, 5 mM MgCl2, 4 mM EDTA, 10 mM dithiothreitol, 0.11 M NaCl, and 0.4 µg of single-stranded DNA). In some experiments, RXRbeta prepared as described by Meier et al. (20) was added. After incubation for 30 min at 25 °C, the reaction mixture was loaded onto a 5% polyacrylamide gel and electrophoresed at 4 °C for 2-3 h at a constant voltage of 250 V. The gel was dried and autoradiographed. The intensities of retarded bands and free probes were quantified by PhosphorImager. The binding data were analyzed based on the equations and considerations as described below.

Analysis of Binding Data from EMSA

Binding of glucocorticoid nuclear receptors to response elements with adjacent identical half-sites has been successfully analyzed using a simple two-site cooperative model, which ignored dimerization of free receptors in solution (21). Since dimerization of unbound TR's has never been detected, we interpret our results in a similar way (Equation 1). Receptor (R) can bind to either TRE half-site (D) to give monomeric complexes (DR and RD) or to both yielding a dimeric complex (RDR).
<AR><R><C></C><C></C><C></C><C></C><C><UP>DR</UP></C></R><R><C></C><C></C><C></C><C>↗</C><C></C><C>↖</C></R><R><C></C><C></C><C>K<SUB>1</SUB></C><C></C><C></C><C></C><C>K<SUB>2</SUB></C></R><R><C></C><C>&dlarr;</C><C></C><C></C><C></C><C></C><C></C><C>&drarr;</C></R><R><C>2<UP>R</UP>+<UP>D</UP></C><C></C><C></C><C></C><C></C><C></C><C></C><C></C><C><UP>RDR</UP></C></R><R><C></C><C>↖</C><C></C><C></C><C></C><C></C><C></C><C>↗</C></R><R><C></C><C></C><C>K<SUB>1</SUB></C><C></C><C></C><C></C><C>K<SUB>2</SUB></C></R><R><C></C><C></C><C></C><C>&drarr;</C><C></C><C>&dlarr;</C></R><R><C></C><C></C><C></C><C></C><C><UP>RD</UP></C></R></AR> (Eq. 1)

We assume that a receptor molecule can bind to either half-site on an empty TRE (D) with a binding constant K1 and on a monomeric complex (DR or RD) with a binding constant K2. If K2 = s·K2, then s is the cooperativity parameter. Positive cooperativity implies s > 1, i.e. stronger binding of the second TR than the first to the TRE. The concentration of monomeric complexes
[<UP>monomer</UP>]=[<UP>DR</UP>]+[<UP>RD</UP>]=2 · K<SUB>1</SUB> · [<UP>R</UP>] · [<UP>D</UP>] (Eq. 2)
and of dimeric complexes
[<UP>dimer</UP>]=K<SUB>2</SUB> · [<UP>D</UP>] · [<UP>RD</UP>]=K<SUB>1</SUB> · K<SUB>2</SUB> · [<UP>D</UP>] · [<UP>R</UP>]<SUP>2</SUP> (Eq. 3)
The total concentration of TRE,
[<UP>D</UP>]<SUB>0</SUB>=[<UP>D</UP>]+[<UP>DR</UP>]+[<UP>RD</UP>]+[<UP>RDR</UP>] (Eq. 4)
=[<UP>D</UP>] · (1+2 · K<SUB>1</SUB> · [<UP>R</UP>]+K<SUB>1</SUB> · K<SUB>2</SUB> · [<UP>R</UP>]<SUP>2</SUP>)
Consequently
[<UP>monomer</UP>]=<FR><NU>2 · K<SUB>1</SUB>[<UP>R</UP>] · [<UP>D</UP>]<SUB>0</SUB></NU><DE>(1+2 · K<SUB>1</SUB> · [<UP>R</UP>]+K<SUB>1</SUB> · K<SUB>2</SUB> · [<UP>R</UP>]<SUP>2</SUP>)</DE></FR> (Eq. 5)
[<UP>dimer</UP>]=<FR><NU>K<SUB>1</SUB> · K<SUB>2</SUB> · [<UP>D</UP>]<SUB>0</SUB> · [<UP>R</UP>]<SUP>2</SUP></NU><DE>(1+2 · K<SUB>1</SUB> · [<UP>R</UP>]+K<SUB>1</SUB> · K<SUB>2</SUB> · [<UP>R</UP>]<SUP>2</SUP>)</DE></FR> (Eq. 6)
The concentrations of monomer, dimer, and TRE are measured on the gel from the known specific activities of the DNA probes. However, the recombinant TRs are produced in cell lysates. It was not possible to determine how much of the protein in each lysate was intact, competent TR, i.e. [R] is unknown. In each experiment, in each lane, we can measure a ratio,
<UP>r</UP>=<FR><NU>[<UP>dimer</UP>]</NU><DE>[<UP>monomer</UP>]</DE></FR>=<FR><NU>K<SUB>1</SUB> · K<SUB>2</SUB> · [<UP>D</UP>]<SUB>0</SUB> · [<UP>R</UP>]<SUP>2</SUP></NU><DE>2 · K<SUB>1</SUB> · [<UP>R</UP>] · [<UP>D</UP>]<SUB>0</SUB></DE></FR>=<FR><NU>K<SUB>2</SUB> · [<UP>R</UP>]</NU><DE>2</DE></FR> (Eq. 7)
so
[<UP>R</UP>]=<FR><NU>2 · <UP>r</UP></NU><DE>K<SUB>2</SUB></DE></FR> (Eq. 8)
Substituting Equation 8 into 5 and 6 gives
[<UP>monomer</UP>]=<FR><NU>4 · K<SUB>1</SUB> · [<UP>D</UP>]<SUB>0</SUB> · <UP>r</UP></NU><DE>(K<SUB>2</SUB>+4 · K<SUB>1</SUB> · <UP>r</UP>+4 · K<SUB>1</SUB> · <UP>r</UP><SUP>2</SUP>)</DE></FR> (Eq. 9)
[<UP>dimer</UP>]=<FR><NU>4 · K<SUB>1</SUB> · [<UP>D</UP>]<SUB>0</SUB> · <UP>r</UP><SUP>2</SUP></NU><DE>(K<SUB>2</SUB>+4 · K<SUB>1</SUB> · <UP>r</UP>+4 · K<SUB>1</SUB> · <UP>r</UP><SUP>2</SUP>)</DE></FR> (Eq. 10)

For each combination of recombinant TR and TRE, values of K1 and K2 were estimated by fitting the measured concentrations [monomer] and [dimer] simultaneously to Equations 9 and 10 as functions of [D]0 and r, with the constraints K1 > 0, K2 > 0. Analyses were performed using the PC-MLAB program (Civilized Software, Bethesda, MD). It must be pointed out that this procedure violates one basic assumption of least squares curve fitting, i.e. that experimental uncertainties in plotted data parallel the y axis (22). Here we have uncertainties along both axes. Together with the problems of the gel retardation method, which requires separation of reactants and products, perturbing the system from equilibrium, as discussed previously (16), could result in some uncertainty in K1 and K2. Consequently, the values given in Table I may be only approximate.

Table I.

Apparent affinity constants of the binding of w-TRbeta 1, w-TRalpha 1, and chimeric receptors to F2

Increasing concentrations of the 32P-labeled F2 TRE were incubated with equal amounts of in vitro translated w-TRalpha 1, w-TRbeta 1, or the chimeric receptor proteins. After EMSA, the intensities of the monomeric and homodimeric bands were quantified by PhosphoImager. K1 and K2 are binding constants for the association of a receptor molecule to a half-site on an empty TRE and on a monomeric complex, respectively. Cooperativity between the sites is measured by s (=k2/k1). Their values were calculated according to the equations described under "Experimental Procedures."


TRs F2, Ka (× 106 M-1)
K1 k2 s

w-TRbeta 1 (beta beta beta ) 0.1 400 4000
 beta alpha beta 0.3 500 1667
 beta beta alpha 0.4 500 1250
 beta alpha alpha 2 400 200
w-TRalpha 1 (alpha alpha alpha ) 3 300 100
 alpha alpha beta 3 300 100
 alpha beta alpha 3 300 100
 alpha beta beta 4 200 50

Binding of T3 to the Wild Type and Chimeric Receptors

The binding was carried out by incubating the in vitro translated TR proteins with 0.4 nM [125I]T3 in the presence or absence of increasing concentrations of unlabeled T3 (0.1 to 10 nM) in 0.25 ml of buffer B (50 mM Tris·HCl, pH 8.0, 0.2 M NaCl, 0.01% Lubrol, and 20% glycerol) for 90 min at 25 °C. TR-bound [125I]T3 was separated from the unbound radioligand in a Sephadex G-25 (fine) column (5.5 × 1 cm), as described (3).

The binding data were analyzed by using Equation 11 based on direct competition between [125I]T3 and the unlabeled T3 for a single site on the receptor. The concentration of radioactive complex is given by Equation 11:
[<UP>Rh</UP>]=<FR><NU>[<UP>R</UP>]<SUB>0</SUB>+[h]</NU><DE>K<SUB>d</SUB>+[h]+[c]</DE></FR> (Eq. 11)
where [R]0 is the total concentration of receptor, [h] and [c] are the concentrations of [125I]T3 and the unlabeled T3, respectively, and Kd is the dissociation constant of the hormone-receptor complex. The data were fitted directly to Equation 11 using the PC-MLAB program (Civilized Software, Bethesda, MD), to evaluate Kd and [R]0.

Transient Transfection Assay

CV1 cells (4 × 105 cells/60-mm dish) were plated 24 h before transfection in Dulbecco's modified essential medium containing 10% fetal bovine serum. Cells were transfected with appropriate expression plasmids (0.2 µg) for w-TRbeta 1 (pCDMCHbeta ), w-TRalpha 1 (pCDMCHalpha ), or the chimeric receptors (pCDMCH1, pCDMCH2, pCDMCH3, pCDMCH4, pCDMCH5, and pCDMCH6), TRE-containing TK-CAT reporter plasmid (0.2 µg), and pCH110 (0.2 µg; an expression plasmid for beta -galactosidase) by using the lipofectamine transfection method according to the manufacturer's procedure (Life Technologies, Inc.). pBluescript SK II (+) Strategene, La Jolla, CA) was used to bring the total DNA transfected to 3 µg. After 6 h, the medium was replaced by fresh Dulbecco's modified essential medium containing 10% thyroid hormone-depleted serum. Fifteen hours before cells were harvested, T3 (100 nM) was added to the appropriate dishes. After an additional 18 h, cells were lysed and chloramphenicol acetyltransferase (CAT) activity was determined as described previously (23, 24). CAT activity was normalized by using equal amounts of lysate proteins.

Immunocytolocalization of TR Proteins by Immunofluorescence

Cultured CV-1 cells were transfected as described above. Two days later, cells were processed for immunofluorescence studies as described previously (25). Briefly, cells were fixed in 3.7% formaldehyde in phosphate-buffered saline for 5 min at 25 °C. After washing, cells were incubated with monoclonal antibody C4 (10 µg/ml; 26) in phosphate-buffered saline containing 0.1% saponin and 4 mg/ml normal goat globulin for 30 min at 25 °C. After being washed with phosphate-buffered saline, cells were incubated with affinity-purified goat anti-mouse immunoglobulin conjugated with rhodamine (25 µg/ml) for 30 min at 25 °C. Cells were viewed and photographed using microscope equipped with rhodamine epifluorescence optics.

Western Blotting

Cell lysates (25 µg) from transient transfection experiments as described above were loaded onto a 10% SDS gel. After electrophoresis, proteins were transferred onto a nitrocellulose membrane (PH79 membrane; Schleicher & Schuell). The membrane was gently shaken in 5% non-fat milk in TBS (25 mM Tris, pH 7.4, 150 mM NaCl) for 20 h and was subsequently washed three times with TBS. The membrane was incubated with monoclonal antibody C4 (1 µg/ml) for 1 h. After washing, the membrane was incubated with affinity-purified rabbit anti-mouse immunoglobulin conjugated with horseradish peroxidase (1:1,000 dilution). TR protein bands were visualized by chemiluminescence using ECL kit (Amersham Life Sciences, Inc.).


RESULTS

Differential Interaction of TRalpha 1 and TRbeta 1 with F2

Previously it has been shown that TRbeta 1 binds to F2 mainly as a homodimer, whereas TRalpha 1 binds to F2 both as a homodimer and as a monomer (14, 15). However, there was no quantitative comparison in the differential binding of F2 to the two isoforms. We therefore compared the binding affinities of F2 to the two isoforms. Fig. 1 shows the binding of TRalpha 1 and TRbeta 1 to F2 in a concentration-dependent manner. Consistent with previous observations (14, 16), TRbeta 1 bound to F2 predominantly as a homodimer. Interestingly, when F2 concentration was higher than 15 fmol, weak binding of TRbeta 1 to F2 as a monomer was clearly detected (lanes 13-16). However, TRalpha 1 bound to F2 differently from TRbeta 1. As shown in Fig. 1, at all corresponding F2 concentrations, TRalpha 1 bound both as a homodimer and as a monomer. It clearly had a higher propensity to form monomer than TRbeta 1 (lanes 1 versus 9; lane 2 versus 10; lane 3 versus 11; lane 4 versus 12; lane 5 versus 13; lane 6 versus 14; lane 7 versus 15; and lane 8 versus 16).


Fig. 1. Differential binding of w-TRalpha 1 and w-TRbeta 1 to F2. Equal amounts of in vitro translated TRalpha 1 or TRbeta 1 proteins were incubated with increasing concentrations of 32P-labeled F2 as described under "Experimental Procedures." The concentration of TRE in lanes 1-8 or lanes 9-16 were 0.9, 1.9, 3.8, 7.5, 15, 30, 60, and 120 fmol, respectively. Lane 17 was the control in which the unprogrammed lysates were used. The TRE-bound TRs were visualized by autoradiography. Free, unbound 32P-labeled TREs; M, monomer; H, homodimer.
[View Larger Version of this Image (56K GIF file)]


The binding data shown in Fig. 1 were analyzed, and the Ka values of homodimeric (K2) and monomeric (K1) binding for TRbeta 1 were found to be 400 and 0.1 × 106 M-1, respectively, indicating an increase of 4000-fold in the binding affinity when TRbeta 1 was bound to F2 as a homodimer (s = 4000; Table I). Thus, binding of the first monomer of TRbeta 1 to F2 facilitated the binding of the second monomer. We designated "s" as the ratio of K2/K1 to measure the extent of positive cooperativity in the binding of TR to TREs. The Ka values of homodimeric and monomeric binding of TRalpha 1 to F2 were 300 and 3 × 106 M-1, respectively, which gave a substantially lower cooperativity (s = 100; see Table I) than that for TRbeta 1.

Role of Domains in the DNA and T3 Binding Activity of TR Isoforms

To identify the molecular basis of the differential interaction of TRalpha 1 and TRbeta 1 with F2, we interchanged the domains between the two isoforms and evaluated the effects of domain swapping on the F2 and T3 binding activity. An examination of the sequences between the two isoforms indicates that there is no sequence homology in the A/B domain, whereas there is an 88, 71, and 86% homology in sequence in domains C, D and E, respectively (Fig. 2I). We have previously shown that the removal of domain A/B has no effect on the interaction of TRbeta 1 with TREs (16). Therefore, we grouped domain A/B together with domain C as a unit and constructed the chimeric receptors by swapping domains A/B/C, D, and E (Fig. 2II). The sequences encoding the chimeric receptors in the constructs were confirmed by restriction map analyses and DNA sequencing.

To assess the T3 binding activity, we prepared the receptors by in vitro transcription/translation and carried out competitive T3 binding assays. The displacement curves for w-TRbeta 1 and its chimeric receptors are shown in Fig. 3A and for w-TRalpha 1 and its chimeric receptors are shown in Fig. 3B. Binding data were analyzed, and the Kd values are shown in Table II. The Kd values for the binding of w-TRbeta 1 and w-TRalpha 1 to T3 were 0.36 ± 0.06 and 0.10 ± 0.037 nM, respectively, indicating that w-TRalpha 1 bound to T3 with an approximately 3-fold higher affinity than that of w-TRbeta 1. The 3-fold difference is very significant as indicated by the t test (p < 0.01). The difference in the binding affinity was not due to the different protein expression level by the in vitro transcription/translation. As shown in Fig. 3C, lane 2 shows the two translation products of w-TRbeta 1 initiated from the ATGs (Met-5 and -32) with the molecular weights of ~55,000 and ~52,000 (26, 27) that have the combined intensity similar to that of w-TRalpha 1 shown in lane 6 (Fig. 3C). Similar binding experiments were carried out for the chimeric receptors, and as shown in Fig. 3, A and B, no significant differences were observed in the binding curves within the same subtype. The Kd values for the chimeric receptors are virtually identical to those of the wild type receptors (Table II), indicating that the domain swapping between the two isoforms had no effect on the T3 binding activity.


Fig. 3. Binding of the wild type and chimeric TRs to [125I]T3. Equal amounts of in vitro translated w-TRbeta 1 or its chimeric receptors (A), w-TRalpha 1 or its chimeric receptor proteins (B) were incubated with 0.4 nM of [125I]T3 in the absence or presence of increasing concentration of unlabeled T3 (0.2, 0.5, 1, and 10 nM). The free and receptor bound [125I]T3 were separated by Sephadex G-25 (fine) column and quantified. Data are expressed as % of [125I]T3 bound in the absence of unlabeled T3. The apparent affinity constants were calculated according to the binding Equation 11 shown under "Experimental Procedures." C, comparison of the size and expression level of the in vitro translated wild type and chimeric receptors by SDS-polyacrylamide gel electrophoresis. Three µl of the lysates containing the in vitro 35S-labeled translated receptor proteins were loaded onto a 10% SDS-polyacrylamide gel. The gel was dried and autoradiographed.
[View Larger Version of this Image (26K GIF file)]


Table II.

Apparent affinity constants of the binding of w-TRbeta 1, w-TRbeta 1, and chimeric receptors to F2

Increasing concentrations of the 32P-labeled F2 TRE were incubated with equal amounts of in vitro translated w-TRalpha , w-TRbeta 1, or the chimeric receptor proteins. After EMSA, the intensities of the monomeric and hoomodimeric bands were quantified by PhosphoImager, k1 and k2 are binding constants for the association of a receptor molecule to a half/site on an empty TRE and on a monomeric complex. respectively. Cooperativity between the sites is measured by s(=k2/k1). Their values were calculated according to the equations descdribed under "Experimental Procedures."


TRs Kd

nM
w-TRbeta 1 (beta beta beta ) 0.36  ± 0.06
 beta alpha beta 0.33  ± 0.02
 beta beta alpha 0.34  ± 0.08
 beta alpha alpha 0.34  ± 0.07
w-TRalpha 1 (alpha alpha alpha ) 0.10  ± 0.03
 alpha alpha beta 0.14  ± 0.05
 alpha beta alpha 0.18  ± 0.04
 alpha beta beta 0.14  ± 0.04

In contrast to the T3 binding activity, domain swapping had a dramatic effect on the interaction of chimeric receptors with F2. Lanes 2-5 of Fig. 4 compare the binding of w-TRbeta 1 (beta beta beta ; see Fig. 2) and its chimeric receptors to F2 by EMSA. Replacement of domains D or E of TRbeta 1 by that of TRalpha 1 had no significant effect on the binding of beta alpha beta or beta beta alpha receptor to F2 as a homodimer, but an increase in the formation of monomer was seen (lanes 3 versus 2; lanes 4 versus 2). However, when both domains D and E were swapped, a dramatic increase in the monomer formation was detected. The extent of monomer formation was similar to that seen for w-TRalpha 1 (alpha alpha alpha , lane 6 of Fig. 4A versus lane 5). We further measured an F2 concentration-dependent binding to each chimeric receptor (beta alpha beta , beta beta alpha , and beta alpha alpha ), similar to the experiments shown in Fig. 1, and determined their affinity constants. The binding data were analyzed, and the Ka values are shown in Table I. Swapping of domain D or E of TRbeta 1 by that of TRalpha 1 led to a 3- and 4-fold increase in the binding affinity of beta alpha beta or beta beta alpha to F2 as a monomer, respectively (K1 = 0.3 and 0.4 × 106 M-1, respectively, versus 0.1 × 106 M-1 for w-TRbeta 1), but with little change in the binding affinity of these two chimeric receptors as a dimer (K2 = 500 × 106 M-1). On the other hand, when both domains D and E were swapped, a dramatic 20-fold increase in monomer binding affinity (K1 = 2 × 106 M-1) was detected. Thus, inclusion of domain D or E of TRalpha 1 facilitates the binding of TR as a monomer.


Fig. 4. Comparison of the binding of the wild type and chimeric receptors to TRE. Equal amounts of in vitro translated w-TRalpha 1, w-TRbeta 1, or chimeric receptor proteins were incubated with 32P-labeled F2 according to the methods described under "Experimental Procedures." The concentration of the 32P-labeled TRE was 12 × 10-9 M; M, monomer; H, homodimer.
[View Larger Version of this Image (70K GIF file)]


Lanes 7-9 of Fig. 4 show that replacement of either domain D or E alone or both domains D and E of TRalpha 1 by the corresponding regions of TRbeta 1 resulted in a similar reduction in the monomer formation (lane 6 versus lanes 7-9). The ratios of monomer to homodimer were clearly reduced in alpha alpha beta , alpha beta alpha , and alpha beta beta . A more detailed analysis was carried out by determining the affinities in the binding of F2 to the chimeric TRalpha s. Their K1, K2, and s values are shown in Table I which indicate that there were only small changes in the values of positive cooperativity in alpha alpha beta , alpha beta alpha , and alpha beta beta as compared with alpha alpha alpha (s = 50-100).

RXRs have been shown to heterodimerize with TRs and modulate the activity of TRs (1, 2). We therefore also examined the effect of domain swapping on the heterodimerization activity of the chimeric receptors. Similar to w-TRbeta 1 and w-TRalpha 1, all chimeric TRs were capable of forming dimers with RXRbeta on F2. No significant differences in the extent of formation of heterodimers were detected among the chimeric TRs (data not shown).

Role of Domains in the Differential Transactivation Activity of the Wild Type and Chimeric TRs

To assess the role of the domains in the transactivation activity of TRs, we constructed the mammalian expression vectors in which the expression of the wild type and chimeric TRs was driven by the cytomegalovirus promoter. We co-transfected the TR expression plasmids with F2-containing reporter into CV1 cells. Fig. 5 shows that w-TRbeta 1 (beta beta beta ) had a ~6-fold higher T3-dependent transactivation activity than w-TRalpha 1 (alpha alpha alpha ; bars 2 versus 6 of Fig. 5). The lower transactivation of w-TRalpha 1 was not due to the lower expression of w-TRalpha 1 proteins in CV1 cells. Using high titer monoclonal antibody C4 (26), we had concurrently carried out immunocytochemical localization of TRs in CV1 cells and Western blotting for quantitation of the expressed TRs. w-TRs and their chimeric TRs were similarly expressed in the nuclei (data not shown). Thus, the lower transactivation activity was not due to the inability of w-TRalpha 1 to be translocated into the nuclei. Furthermore, the Western blots show that w-TRalpha 1 (alpha alpha alpha ), surprisingly, was expressed ~2-fold higher than w-TRbeta 1 (lanes 6 versus lane 2 of Fig. 5), indicating that the lower transactivation activity was not due to the lower protein expression level of w-TRalpha 1.


Fig. 5. Comparison of the transcriptional activity of w-TRbeta 1, w-TRalpha 1, and chimeric receptors mediated by F2 in CV1 cells. w-TRbeta 1 (pCDMCHbeta ), w-TRalpha 1(pCDMCHalpha ), or chimeric receptor expression plasmids (0.2 µg; pCDMCH1, pCDMCH2, pCDMCH3, pCDMCH4, pCDMCH5, or pCDMCH6) were co-transfected with the TRE-CAT reporter (0.2 µg) and the beta -galactosidase expression plasmid pCH110 (0.2 µg) into CV-1 cells according to the methods described under "Experimental Procedures." Cell lysates were prepared, and the CAT activity was determined. The CAT activity was normalized to the protein concentration in the lysates. Data are expressed as mean ± S.E. (n = 6), each with duplicates.
[View Larger Version of this Image (43K GIF file)]


To identify which domain in the TRs mediated the differential transactivation activity between these two isoforms, we further examined the transactivation activity of the chimeric TRs. On F2, swapping of domain D of w-TRbeta 1 by that of w-TRalpha 1 (bars 3 versus 2 of Fig. 5) reduced the transactivation activity of beta alpha beta by 35%. As shown bars 4 and 5, the T3-dependent transactivation was reduced by ~60% when domain E alone or domains D + E of w-TRbeta 1 was replaced by that of w-TRalpha 1. Swapping of domains E and D + E in w-TRalpha 1 by the corresponding regions of TRbeta 1 led to a 1.8- (bar 8) and 2.5-fold (bar 9 of Fig. 5) increase in the transactivation in alpha alpha beta and alpha beta beta , respectively. The differences in the transactivation activity of the chimeric TRs were neither due to the differences in the ability of the chimeric TRs to be translocated into the nuclei because similar nuclear localization patterns were seen (data not shown) nor due to the TR expression levels because the transactivation activities shown in Fig. 5 were normalized against the amounts of proteins detected in Fig. 6. Taken together, these results indicate that domains D and E of TRbeta 1 had a propensity to mediate a higher transactivation activity, and those of TRalpha 1 mediated a lower transactivation activity.


Fig. 6. Expression of w-TRbeta 1, w-TRalpha 1, and their chimeric receptors in CV1 cells analyzed by Western blot. An aliquot of the lysates from cells transfected with plasmids as described in Fig. 5 were loaded to a 10% SDS-polyacrylamide gel and transferred to nitrocellulose PH79 membrane. The w-TRbeta 1, TRalpha 1, and chimeric receptor proteins were detected using C4 antibody and visualized by enhanced chemiluminescence.
[View Larger Version of this Image (25K GIF file)]


To evaluate whether the differential transactivation activity of the two TR isoforms is mediated by TR/RXR heterodimer pathway, we co-transfected RXRbeta expression plasmid with F2-CAT reporter and w-TRbeta 1 or w-TRalpha 1 expression plasmids into CV1 cells. Consistent with the previous findings (24), the T3-dependent transactivation activity of w-TRbeta 1 mediated by F2 was repressed ~60% by RXRbeta . A similar extent of repression was also seen for the T3-dependent transactivation activity of w-TRalpha 1 by RXRbeta (data not shown). Therefore, the higher transactivation activity of w-TRbeta 1 was not due to the TR/RXR heterodimer pathway.


DISCUSSION

In an important study, Rastinejad et al. (5) recently determined the crystal structure of a heterodimeric complex of two proteins, made up from domains (C + D) derived from the RXR and TRbeta 1, respectively, bound to a direct repeat TRE. The DNA in the complex is undistorted, with regular B-DNA geometry. Many amino acid side chains are involved in the TRbeta 1-DNA interactions. The specificity of binding is determined by side chains from the 11-residue long C domain "recognition helix," which starts at the third metal coordinating cysteine of the first zinc finger. These make direct contacts with the base pairs and backbone phosphates in the major groove of the half-site binding motif. Domain D contains a long alpha -helix, which makes extensive interactions with the minor groove between the half-site and upstream spacer sequence. The dimerization interface between RXR and TRbeta 1 lies across the minor groove of the spacer, involving mainly residues from the first zinc finger in TRbeta 1 and the second zinc finger in RXR. Of the many side chains identified as making DNA contacts, only one, K193R, is changed in TRalpha 1. Mutagenesis experiments indicate that at least one other conserved region of TRs, Leu-367-Leu-374, located in domain E, is involved in dimerization of intact receptors. The structure of the separate ligand binding domains D + E of rat TRalpha 1 has recently been determined (6). The isolated protein is monomeric and gives no indication as to how this sequence, which forms "an extensive hydrophobic patch," participates in dimerization. The analogous sequence in human RXR-alpha does form a dimer interface in crystals of its isolated ligand binding domain (29). It has been suggested that this dimerization sequence from domain E has no selective pressure on response element recognition but only serves to stabilize these homodimer complexes (30), being active in all dimerization interfaces. Biochemical data, on the polarity of binding and the specificity for particular spacings in DNA response elements shown by heterodimers formed by various members of the steroid/thyroid hormone receptor family, were readily explained using the crystal structure solved by Rastinejad et al. (5). This indicates the generality of the binding mode which they detected and predicts that homodimers formed by TRs on the three different types of TREs will have distinct dimerization interfaces. Homodimers formed on F2 elements will be symmetrical, with a dimerization interface including the first zinc fingers of domain C and the D domain alpha -helices of both proteins. The situation is further complicated by the spatial arrangements of the binding sites. For DR4, the centers of the two binding motifs are on the same face of the DNA, one turn of the DNA helix apart (5). We can predict that for F2 they will fall a little further apart, on opposite faces of the DNA. Under most conditions, binding of TRbeta 1 to an F2 response element occurs as a dimer complex. Since the two half-sites involved are basically identical, the observed low levels of a 1:1 DNA/protein monomer complex indicates high positive cooperativity between the two half-sites (i.e. K2 >>  K1). There are two extreme ways in which positive cooperativity between two intrinsically identical half-sites can be achieved (31). Relative to the empty TRE we can detect (i) stabilization of the dimer complex by a large positive free energy of interaction between both sites occupied by proteins, with no interaction between occupied and unoccupied sites, or (ii) destabilization of the monomer complex by a large negative free energy of interaction between occupied and unoccupied sites, with no interaction between two occupied sites. In general, less extreme situations, where both occupied-occupied and occupied-unoccupied interactions occur, must also be considered. The binding of TRalpha 1, TRbeta 1, and their chimeric receptors to F2 shows positive cooperativity (K2 >>  K1). Table I clearly shows that the enhanced positive cooperativity of binding shown by TRbeta 1 over TRalpha 1 (i.e. its greater tendency to bind as a dimer) results mainly from the second of these causes. TRbeta 1 monomer complex is much less stable than the TRalpha 1 form, and this lower stability is relieved by formation of the dimer complex. As noted above, the sequences involved in DNA binding are essentially identical in TRalpha 1 and TRbeta 1. Consequently, the instability of the TRbeta 1 monomer complex must result from the overall structure of the receptor molecule and its effect on the binding interfaces. The data obtained with the chimeric receptors show that all proteins in which the DNA binding domain C is of the alpha  form show monomeric binding to F2, like TRalpha 1 (Table I, Fig. 4). However, exchange of only this domain to the beta  form (alpha alpha alpha left-right-arrow  beta alpha alpha ) is not sufficient to significantly enhance binding cooperativity. In the case of F2, some destabilization of the monomer complex is detected when both domains C-D or C-E are exchanged, with a full effect with all three domains derived from beta . In monomer complexes, these all fall on the occupied-unoccupied site interface, where the destabilization must occur. The physical origin of this destabilization interaction may only be revealed by determination of the structure of suitable complexes.

The hormone binding site of TRs is located in domain E. In earlier work, we showed that domain E, isolated from h-TRbeta 1 with part of domain D, can still bind T3 but with reduced affinity (3). Addition of domains C and D restored the molecule's affinity to that of the intact receptor, indicating regulatory interactions between these domains. The results shown in Fig. 3 indicate that the chimeric receptors derived from TRalpha 1's domain C all have higher T3 binding affinity than the chimeric receptors derived from domain C of TRbeta 1, at least in the absence of DNA (see Table II). Thus this aspect of the behavior of a chimeric receptor is determined exclusively by the origin of its domain C, the DNA binding domain, reinforcing the importance of interdomain interactions.

The results on the effect of domain swapping on the transcriptional activity of the TR isoforms revealed that despite a higher T3 binding affinity, TRalpha 1 and its chimeric receptors had lower transcriptional activity (Fig. 5). This was unexpected, suggesting that the mode of DNA binding to TRs overrides the advantage gained from higher T3 affinity. Inspection of the data further indicates that the extent of transcriptional activation by a receptor correlates better with the source of its domains than with its affinity for DNA. It is clear that domains D and E of TRbeta 1 tend to impart higher transcriptional activity than those of TRalpha 1. This in turn correlates well with the propensity of the chimeric receptors to form homodimers (see Fig. 4). The fact that w-TRalpha 1 and its chimeric receptors formed heterodimers with the RXR as well as w-TRbeta 1 and its chimeric receptors suggests that the higher transcriptional activity of TRs which contain the domains D and E of TRbeta 1 probably was not mediated by the heterodimer pathway. This notion is further supported by the findings that the transfected RXR repressed the T3-dependent transactivation activity of the two isoforms with similar extent. Therefore, this higher transcriptional activity of TRbeta 1 lies most likely in the interactions of domains D and E with domain C in homodimers. Genetic experiments have shown that the hormone-dependent transactivation activity depends on a short amphipathic alpha -helix at the extreme carboxyl terminus of domain E, which undergoes a large conformational change on hormone binding (6, 26, 30). The sequence is conserved in both isoforms but is probably located in different sequence contexts in relation to the DNA binding domain or in the context of the entire molecule. Thus, it may function with differing efficacies in the two different environments. Recently, several co-repressors and one co-activator for several members of the receptor superfamily including TRs have been reported (4, 32-35). Their function has been proposed to act as bridging factors between the TRs and the basal transcriptional machinery (4). It is possible that the resultant tertiary structure of domains D and E of TRbeta 1 is less favorable to bind to a co-repressor. It is also possible that the structure of domains D and E of TRbeta 1 is such that the carboxyl-terminal alpha -helix is more easily accessible to a co-activator. Thus, domains D and E of TRbeta 1 may have a higher efficacy in transmitting the effects of conformational change of the carboxyl-terminal alpha -helix upon binding the hormone to regulate the interaction of the domain C with the target genes. These possibilities can only be distinguished when the x-ray crystallographic structures of ligand-bound intact TRalpha 1 and TRbeta 1 are solved and compared. Our present studies indicate that domains C, D, and E are functionally linked and the interplay of these domains underlines the differential transcriptional activity of the two isoforms.


FOOTNOTES

*   The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
   To whom all correspondence should be addressed: Bldg. 37, Rm. 2D24, 37 Convent Dr. MSC 4255, Bethesda, MD 20892-4255. Tel.: 301-496-4280; Fax: 301-480-9676; E-mail:sycheng{at}helix.nih.gov.
1   The abbreviations used are: TR, thyroid hormone receptor; T3, 3,3',5-triiodo-L-thyronine; TRbeta 1, human TR subtype beta 1;TRalpha 1, human TR subtype alpha 1; RXRbeta , rat retinoid X receptor, subtype beta ; TRE, thyroid hormone response element; EMSA, electrophoretic mobility gel shift assay; F2, chicken lysozyme TRE; CAT, chloramphenicol acetyltransferase.

REFERENCES

  1. Cheng, S.-Y. (1995) J. Biomed. Sci. 2, 77-89 [CrossRef][Medline] [Order article via Infotrieve]
  2. Oppenheimer, J. H., Schwartz, H. J., and Strait, K. A. (1994) Eur. J. Endocrinol. 130, 15-24 [Medline] [Order article via Infotrieve]
  3. Lin, K.-H., Parkison, C., McPhie, P., and Cheng, S.-Y. (1991) Mol. Endocrinol. 5, 485-492 [Abstract]
  4. Mangelsdorf, D. J., and Evans, R. M. (1995) Cell 83, 841-850 [CrossRef][Medline] [Order article via Infotrieve]
  5. Rastinejad, F., Perlmann, T., Evans, R. M., and Sigler, P. B. (1995) Nature 375, 203-211 [CrossRef][Medline] [Order article via Infotrieve]
  6. Wagner, R. L., Apriletti, J. W., McGrath, M. E., West, B. L., Baxter, J. D., and Fletterick, R. J. (1995) Nature 378, 690-697 [CrossRef][Medline] [Order article via Infotrieve]
  7. Rodd, C., Schwartz, H. L., Strait, K. A., and Oppenheimer, J. H. (1992) Endocrinology 131, 2559-2564 [Abstract]
  8. Strait, K. A., Schwartz, H. L., Perez-Castillo, A., and Oppenheimer, J. H. (1990) J. Biol. Chem. 265, 10514-10521 [Abstract/Free Full Text]
  9. Shi, Y. B. (1994) Trends Endocrinol. Metab. 5, 14-20 [Medline] [Order article via Infotrieve]
  10. Schwartz, H. L., Strait, K. A., Ling, N. C., and Oppenheimer, J. H. (1992) J. Biol. Chem. 267, 11794-11799 [Abstract/Free Full Text]
  11. Strait, K. A., Zou, L., and Oppenheimer, J. H. (1992) Mol. Endocrinol. 6, 1874-1880 [Abstract]
  12. Lezoualc'h, F., Hassan, A. H., Giraud, P., Loeffler, J. P., Lee, S. L., and Demeneix, B. A. (1992) Mol. Endocrinol. 6, 1797-1804 [Abstract]
  13. Lebel, J. M., Dussault, J. H., and Puymirat, J. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 2644-2648 [Abstract/Free Full Text]
  14. Yen, P. M., Sugawara, A., and Chin, W. W. (1992) J. Biol. Chem. 267, 23248-23252