JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Partridge, J. F.
Right arrow Articles by Breeden, L. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Partridge, J. F.
Right arrow Articles by Breeden, L. L.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 14, Issue of April 4, 1997 pp. 9071-9077
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Cell Cycle-dependent Transcription of CLN1 Involves Swi4 Binding to MCB-like Elements*

(Received for publication, November 7, 1996, and in revised form, January 14, 1997)

Janet F. Partridge Dagger §, Glen E. Mikesell Dagger and Linda L. Breeden Dagger

From the Dagger  Fred Hutchinson Cancer Research Center, Basic Sciences Division, Seattle, Washington 98104

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

Two promoter elements have been defined that activate G1/S-specific transcription in Saccharomyces cerevisiae. SCB elements (CACGAAA) are activated by the Swi4-Swi6 complex, and MCB elements (ACGCGTNA) are activated by the Mbp1-Swi6 complex. CLN1 encodes a cyclin which is expressed during this interval, and requires Swi4 and Swi6 for peak transcription, but it has no consensus SCB elements in its promoter. Two SCB-like sequences had been previously noted and suggested to be the functional promoter elements. Our studies indicate that these sequences are unable to activate transcription of a lacZ reporter construct, or to bind Swi4-Swi6 complexes in vitro. However, a cluster of three sequences resembling MCB sequences are active promoter elements, sufficient to confer G1/S-specific transcription to a reporter. These sites are the predominant activation elements in the CLN1 promoter, and despite their resemblance to MCB elements, they bind Swi4-Swi6 complexes in vitro and require Swi4 and Swi6 for their activity in vivo. This indicates that the sequences that promote Swi4/Swi6 binding have not been fully defined, or that there are multiple Swi4- and Swi6-containing complexes with distinct DNA binding specificities. In addition to these novel Swi4/Swi6-binding sites, these studies also show that there must be at least one novel promoter element that can confer G1/S-specific transcription to CLN1, because when all the potential SCB- and MCB-like sequences are eliminated the transcript is still cell cycle regulated.


INTRODUCTION

Passage of cells through the cell cycle of Saccharomyces cerevisiae requires the activation of the Cdc28 kinase. Cdc28 is activated by association with different regulatory subunits, called cyclins. As the name implies, cyclins are unstable proteins whose levels vary within the cell cycle, primarily by the cell cycle regulation of transcription (1, 2). During late G1, there are two predominant cyclins (Cln1 and Cln2) which can form active complexes with Cdc28. The promoters of both of these genes show strong cell cycle regulation which is reflected both at the level of the protein and associated Cdc28 kinase activity (3, 4).

The timing of expression of CLN1 and CLN2 is similar to that of the HO endonuclease and many of the DNA synthesis genes of S. cerevisiae. Transcription of the HO endonuclease is absolutely dependent on the activity of two transcription factors, Swi4 and Swi6, which form a complex and bind to repeated sequence elements within the HO promoter known as Swi4/Swi6-regulated cell cycle boxes (SCBs)1 (5-7). Swi4 is the DNA-binding component of the complex (6, 8) and brings Swi6 to the DNA via association between their COOH termini (8-10). Many of the DNA synthesis genes are also transiently expressed in late G1 and their cell cycle regulated transcription is also dependent on Swi6 (11, 12). However, transcription of these genes seems to be mediated by an alternative DNA sequence element, the MluI cell cycle box (MCB) (13, 14), which is bound by a complex of Swi6 (11, 12, 15) with a different DNA binding partner, Mbp1. MBP1 was identified through its homology to SWI4, and like Swi4, Mbp1 binds DNA through the amino-terminal region of the protein, and associates with Swi6 through its COOH terminus (16).

Deletion of SWI4 and SWI6 is lethal (17) and deletion of SWI4 alone is lethal in some strains (18). To identify the essential transcriptional targets of the Swi4-Swi6 complex, high copy suppressors of this lethality were sought. CLN1 and CLN2 were identified in these screens (18, 19) and their transcription was shown to be largely dependent upon Swi4 and Swi6. Furthermore, complexes formed in vitro on the SCB sequences within the HO and CLN2 promoters include the Swi4 and Swi6 proteins (6, 18, 19).

Although CLN1 has been considered to be coordinately regulated with CLN2, no direct analyses of the CLN1 promoter have been performed. Within the CLN1 promoter, there are two SCB-like sequences, CTCGAAA, which differ from the consensus SCB sequence at the second position, with T replacing A. Because of the similarity of the SCB-like sequence to the consensus, and because of the transcriptional induction of CLN1 by the Swi4 and Swi6 factors, it has been widely thought that the CLN1 SCB-like sequences are functional in binding Swi4/6 and mediating cell cycle-regulated expression. However, mutational analysis has indicated that all the bases within the SCB element are critical for its activity (20). To clarify this issue, we have characterized the CLN1 promoter and found that the SCB-like sequences play little or no role in transcriptional induction of CLN1. Instead there are three MCB-like sequences that are critical for activation and cell cycle regulation of this promoter. Furthermore, we find that Swi4 plays a more important role in binding and activating these MCB-like sites than does the "MCB-binding protein" Mbp1. In addition to the novel Swi4-Swi6 complexes that form on the CLN1 promoter, our studies show that there is at least one other cell cycle regulatory element which also confers G1/S-specific transcription to the CLN1 promoter.


EXPERIMENTAL PROCEDURES

Strains and Growth Conditions

Strains BY 602 (Mata, ade2-1, trp1-1, can 1-100, leu2-3, 112, his3-11,15, ura3, met, HO::lacZ46) and the related swi4 and swi6 deletion strains (BY606 and BY600) have been described previously (21), as have the mbp1 deletion strain K3294 and its isogenic wild type strain K1107 (16). All these strains were derived from W303-1a, but they are not isogenic with it. The BY1231 wild type is isogenic with W303-1a (Mata, ade2-1, trp1-1, can 1-100, leu2-3,112, his3-11,15, ura3). Yeast cultures were grown in YEP medium or YC minimal media supplemented with essential nutrients as required and containing 2% glucose (22). For cell cycle synchronization, cells were grown overnight in media lacking either uracil or tryptophan, transferred to rich media and grown to A600 of 0.2, before addition of 4-5 µg/ml alpha -factor. alpha -Factor arrests were monitored by phase microscopy. For measurement of transcript levels in logarithmically growing cells containing plasmids, the cells were grown under conditions that selected for the plasmid to an A600 of about 0.15. Then the cells were transferred to rich media and allowed to double once before RNA was isolated.

Clones and Constructs

Region of the CLN1 promoter encompassing nucleotides -618 to -479 was amplified by PCR1 from CLN1 in YEp13 (23) with oligonucleotide primers BD1497 (GCCAGCTCGAGGCCTGCAAGAGACGCGTTCAAGG) and BD1507 (GCCAGCTAGCGGCCGCGGCACCATTCAGCTCAATTCC). The -480 to -367 region of the CLN1 promoter was amplified from the same plasmid with BD1495 (GCCAGCCTCGAGCCAGGTCGAGGCTGGGAGGG) and BD1496 (GCCAGCTAGCGGCCGCGGGGACCCACGCTG). Both sets of primers incorporate XhoI and NotI restriction sites so that they could be subcloned into pBD1442, which is a derivative of pSH144 (24) with a NotI restriction site inserted downstream of the XhoI restriction site by introduction of the annealed linker oligonucleotides BD1392 (TCGAGAAAGTATGCGGCCGCTAA) and BD1393 (TCGATTAGCGGCCGCATACTTTC), generating plasmids pBD1512 (CLN1 MCB:lacZ) and pBD1513 (pCLN1 SCB:lacZ), respectively.

The promoter fusion construct pCLN1:HIS3 was generated by subcloning the BamHI/ClaI fragment (-674 to +177) of CLN1 from pJHB1a (23) into pRS314 to generate pBD1582. The HIS3 gene (-22 to +813) was amplified by PCR from pRS303 with oligonucleotides BL29 (TTCCATCGATGCAAGATAAACGAAGGC) and BL30 (GCCCAGCTCGAGGCGCGCCTCGTTC) and subcloned into ClaI/XhoI digested pBD1582 to generate pBD1584 (pCLN1:HIS3). The mcb mutated version of this plasmid (pBD1586) was generated by site-directed mutagenesis (25) of pBD1584 using the mutagenic oligonucleotides BL20 (CTGCAAGAGACCTTCAAGGAAGAATTCCATTTTAC) and BL22 (ATCTCGCACCCTTAGTTAGTTTCC). The mcb, scb mutated version of this construct, pBD1632, was generated by mutagenesis of pBD1586 with the mutagenic oligonucleotide BL47 (GACTAATCAAGTGACGAAGATCAAATTAA). Changes from the wild type sequence are underlined.

S1 Nuclease Protection

The MATa1, LacZ, and CLN1 probes have been described previously (26-28). The probe used to detect the CLN1:HIS3 transcripts was generated by subcloning the KpnI/HindIII fragment of pBD1584 (-334 of CLN1 to +305 of HIS3) into pBS KSII+ (Stratagene) to generate pBD1587, or by subcloning the same fragment into M13mp18 to produce pBD2022. The analysis of transcript levels by S1 nuclease protection was performed essentially as described (29). S1 protection data was quantified by PhosphorImaging (PhosphorImager 400A, Molecular Dynamics Corp., Sunnyvale, CA).

Gel Retardation Assays

The HO promoter probe used in these assays has been described previously (9). The TMP1 promoter probe was amplified by PCR from pEM88 (13) and spans -216 to -112 of the promoter. The CLN1 SCB-like and MCB core regions were amplified by PCR from pBD1513 and pBD1512, using oligonucleotides BD1495/BD1496 and BD1497/BD1507, respectively. Probes were prepared by PCR, using 0.125 mM dNTP mixture, but with dCTP at 0.06 mM and 30 µCi of [alpha -32P]dCTP (3000 Ci/mmol, DuPont NEN). Probes were isolated by electrophoresis through 7% polyacrylamide gels and electroelution. Protein extracts were prepared from exponentially growing cells as described (9), except that the breaking buffer was supplemented with 5 mM MgCl2.

Binding reactions were performed for 10 min at 30 °C, with 10 µg of protein extract, 1 µg of poly(dI-dC) as nonspecific competitor, and other competitor DNAs in assay buffer (9). Up to 1 ng of probe was added and after a further 10-min incubation, binding mixtures were chilled prior to loading on a 4% polyacrylamide gel. Gels were pre-run for 1 h at 200 V at 4 °C before reactions were loaded and electrophoresed for 1.5-2.5 h. Gels were dried, and autoradiographed at -70° C with X-AR film (Kodak). In the antibody addition experiments, sera was added in the amounts indicated for a second 10-min incubation prior to addition of probe.

Competitor oligonucleotides used in the gel retardation experiments were derived from the CLN1 promoter (-616 to -578) using annealed oligonucleotides of plus strand sequence CTGCAAGAGACGCGTTCAAGGAAGAATTCGCGATTTTAC (BL16 and BL17). This DNA is referred to as CLN1 MCB(2). The mutant version of this DNA, called CLN1 mcb(2), was made with oligonucleotides BL20 and BL21, which covered the same sequence, but with the CGCG sequences at -604 and -586 mutated to CC. The REB1 duplex DNA is the -610 to -596 region of the SIN3 promoter (CGAGAGTCCGGGTAATGAT). The HO SCB sequence was the annealed oligonucleotides BD260/BD261 encompassing -666 to -636 of the HO promoter and contained a single perfect SCB (CACGAAAA) (9) or the HO scb mutant (ACTAAAA).


RESULTS

The MCB-like Region, Not the SCB-like Region, from the CLN1 Promoter Is a Cell Cycle-regulated Upstream Activation Sequence

The CLN1 promoter has a cluster of three CGCG sequences and two closely spaced CTCGAAA sequences located within 400 base pairs of the transcription start site (Fig. 1). None of these sequences match the full consensus MCB (ACGCGTNA) or SCB (CACGAAA) sequences, but clusters of MCB core sequences (CGCG) have been shown to activate transcription in other contexts (13, 24). In contrast, the mutagenic analysis of SCB elements that has been carried out (20) predicts that the two SCB-like sequences would be poor activation sequences. To see if either of these regions are upstream activation sequences (UAS) for CLN1 transcription, we cloned these regions into a UAS-deficient promoter, which was fused to lacZ (pBD1442), and measured lacZ transcript levels. The level of MATa1 transcript was also measured and served as an internal control for the amount of total RNA present in each sample. These measurements (see Table I) show that the SCB-like region of the promoter does not activate lacZ expression above background. This suggests that there are no upstream activation sequences in this region. Since SCB elements are known to activate transcription in this reporter context (5), it is likely that the T in the second position prevents recognition of these sites by the Swi4/Swi6 trans-activation complex. In contrast, the CLN1 MCB-like region is an efficient activator of transcription, in that it induces a 70-fold increase in lacZ transcription above background transcription from the UAS-less vector.


Fig. 1. The CLN1 MCB region can activate cell cycle regulated transcription. The upper panel depicts known features of the CLN1 promoter and the promoter fragments used in this study. The transcriptional start site is at -240 (18). Two SCB-like sequences (open boxes) with the sequence CTCGAAA are located at -433 and -450, and three MCB core sequences are situated at -554, -586, and -604 (black boxes) from the ATG. Regions -618 to -479, and -480 to -367 are denoted as CLN1 MCB and CLN1 SCB, respectively. CLN1 MCB(2) includes DNA from -616 to -578. These DNA fragments were used as probes and competitors in gel retardation assays and for transcriptional activation analysis. The CLN1:HIS3 constructs used in Fig. 3 contain CLN1 sequences from -674 to +171 fused to the HIS3 gene. The lower panel shows the result of a quantitative S1 protection experiment in which the level of lacZ transcript driven by the CLN1 MCB promoter fragment (pBD1512) in BY1231 was measured over successive synchronous cell cycles after release from an alpha -factor arrest. The quantitation of the lacZ transcript relative to the MATal internal control is shown and compared with the level of endogenous CLN1 transcript, which is also normalized to MATa1.
[View Larger Version of this Image (22K GIF file)]


Table I.

UAS activity of the SCB and MCB regions of the CLN1 promoter

The CLN1 MCB and SCB regions, as depicted in Fig. 1, were cloned into the UAS-less:lacZ reporter plasmid, pBD1442, and transformed into two different wild type strains (BY602 or K1107). RNA was harvested from logarithmically growing cells and the lacZ and MATa1 mRNA levels were measured by S1 protection. These data were quantitated by PhosphorImaging from duplicate samples. LacZ transcripts were normalised to the invariant MATa1 transcript, and then averaged.


Plasmid BY602 K1107

pBD1442 UAS-less:lacZ .19 .30
pBD1513 CLN1 SCB:lacZ .49 .23
pBD1512 CLN1 MCB:lacZ 14.38 21.5

To see if the transcription activated by the MCB core region of the CLN1 promoter is cell cycle regulated in a manner similar to the full-length promoter, we synchronized cells carrying the CLN1 MCB reporter plasmid in G1 with alpha -factor, and then took samples of cells at 10-min intervals following release from the arrest. lacZ transcript levels for CLN1 MCB directed transcription were measured by S1 nuclease protection, and normalized to MATa1 levels as before. The quantitation of this experiment (Fig. 1, lower panel) shows that the CLN1 MCB region is sufficient to promote cell cycle regulated expression of the lacZ reporter. Furthermore, comparison of the lacZ transcription profile with the endogenous CLN1 transcript in the same samples shows that the timing of expression driven by the CLN1 MCB-like region is very similar to that of the endogenous CLN1.

To define the activity of the MCB core sequences in the context of the normal promoter, plasmids were generated containing CLN1 sequence (-674 to +177) fused to HIS3 on centromeric vectors. Then, the analogous plasmid was made with the three MCB core sequences CGCG mutated to CTCT (cln1:HIS3 mcb). This mutated sequence cannot compete for SCB and MCB bound factors in vitro (data not shown). The presence of these mutations reduced transcript levels about 4-fold (Fig. 2), indicating that the MCB core sequences are the elements responsible for most of the transcriptional activation of CLN1 in logarithmically growing cells. To see if the SCB-like sequences contribute any activation function in the absence of the MCB cores, additional mutations were introduced in the SCB-like sequences (CTCGAAA to GTCTACA) to produce a cln1:HIS3 mcb scb plasmid. A further 2-fold reduction in transcript levels was observed from the mcb scb mutant promoter. This modest effect, together with the inability of the CLN1 SCB-like region to significantly activate lacZ expression in the reporter construct, suggests that these SCB-like sequences are minor contributors to the transcriptional activation of CLN1.


Fig. 2. MCB core sequences are the predominant activation elements in the CLN1 promoter. Plasmids containing either the wild type CLN1:HIS3 fusion (pBD1584), the mcb scb (pBD1632), or the mcb mutant derivative (pBD1586) of it were transformed into wild type BY1231 cells. Three independent transformants of each type were subjected to quantitative S1 protection to measure transcript levels. A single probe covering the CLN1:HIS3 transcript protects the fusion transcript as well as the endogenous CLN1 and HIS3 transcripts, which resolve as indicated after electrophoresis. The radioactivity in each band was quantitated by PhosphorImaging. Background values were obtained from the gel section immediately above each band and subtracted. The CLN1:HIS3 transcript levels were then normalized to endogenous HIS3 mRNA and the three samples were averaged. This image, and all others in this article, were scanned from autoradiographs with a Sharp scanner JX-325 v2.0, into Adobe Photoshop where they were cropped and minimally adjusted for background uniformity. Pict files were then transferred to Canvas 3.0, labeled and printed on a Tektronix Phasar IISDX printer.
[View Larger Version of this Image (53K GIF file)]


The CLN1 Promoter Contains Novel Cell Cycle Regulatory Element(s)

We have shown that the MCB-like region of CLN1 is sufficient to activate cell cycle-regulated expression, but specific mutation of the MCB core sequences did not completely eliminate transcription, nor did elimination of both MCB- and SCB-like sequences. This suggests that there are other active transcription elements in the CLN1 promoter. To see if these unidentified elements contribute to the cell cycle regulated transcription of the CLN1 promoter, we compared the profiles of transcription from the wild type and the mcb scb mutant versions of the CLN1:HIS3 plasmid through the cell cycle. Fig. 3 shows that the CLN1:HIS3 transcript driven by the mcb scb mutant promoter (lower panel) is still clearly cell cycle regulated, and peaks with similar timing to the endogenous CLN1 transcript and to the wild type construct (upper panel). Since cell cycle regulated transcription persists in the absence of all the recognizable MCB- and SCB-like sequences, there must be a novel sequence element residing in the promoter that confers G1/S-specific transcription.


Fig. 3. Novel elements within the CLN1 promoter contribute to the cell cycle regulation of CLN1. Wild type cells (BY1231) transformed with pBD1584 CLN1:HIS3 (upper panel) or pBD1632 cln1:HIS3 mcb scb (lower panel) were synchronized with alpha -factor, released, and samples were taken through three consecutive cell cycles to monitor transcription of the CLN1:HIS3 fusion transcript. S1 protection data is shown using CLN1:HIS3 probe made from pBD1587 (upper panel) or pBD2022 (lower panel). The probes generated from these two different vectors are the same, but they were not made at the same time, so they cannot be directly compared. However, this probe protects three transcripts of discrete sizes: the plasmid-derived CLN1:HIS3 and the endogenous HIS3 and CLN1 transcripts, so the relative levels of the three transcripts in each experiment gives some basis for comparison. The first sample is from alpha -factor arrested cells, and the following samples were taken at the indicated intervals up to 150 min. Note that the 40-min sample is missing from the upper panel.
[View Larger Version of this Image (74K GIF file)]


Swi4 and Swi6 Are the Principle Activators of Transcription from the MCB Region of the CLN1 Promoter

Our in vivo results show that the MCB core sequences serve as a major source of transcriptional activation of CLN1. This result was unexpected because peak levels of CLN1 transcription are dependent upon both Swi4 and Swi6 (18, 19), and these proteins have been characterized as activators of expression through SCB sequences (5). To see if Swi4 and Swi6 activate CLN1 transcription through the MCB core sequences, we transformed swi4 and swi6 deletion strains with the CLN1 MCB:lacZ reporter plasmid, and assayed lacZ transcription in asynchronous cell populations by S1 nuclease protection as before (Table II). Transcription from the CLN1 MCB:lacZ reporter dropped about 5-fold in the absence of either Swi4 or Swi6 activity, suggesting that these factors could be responsible for trans-activation via the MCB core sequences. In contrast, deletion of MBP1, the transcription factor thought to have MCB-binding specificity (16), caused less than a 2-fold reduction in lacZ transcription. These results indicate that Swi4 and Swi6 are the principle activators of transcription from the MCB region of CLN1 in vivo. Mbp1 participates to a lesser extent in this activation.

Table II.

CLN1 MCB-driven transcription is dependent upon Swi4 and Swi6 activity

pCLN1 MCB:lacZ (pBD1512) was transformed into each of these strains and lacZ and MATa1 mRNA levels were measured, normalized, and averaged as described in Table I. The data is presented both as a lacZ/MATa1 ratio, and as the percent relative to the levels obtained from the isogenic wild type strain.


Strains transformed with pCLN1 MCB:lacZ lacZ/MATa1 mRNA

BY 602 SWI+ 31.8 100%
BY 600 swi6 7.1 22%
BY 606 swi4 7.3 21%
K1107 MBP1+ 19.59 100%
K3294 mbp1 11.2 57%

We then asked if Swi4 and Swi6 could bind to the CLN1 MCB elements directly by performing gel-retardation assays on whole cell extracts prepared from wild type and mutant yeast. To ensure that the extracts had the potential to form Swi4-Swi6 and Mbp1-Swi6 complexes, we first assayed complex formation on fragments from the HO and TMP1 promoters. HO was the first promoter in which SCB sequences were identified (30), and binding of Swi4/Swi6 to these sequences is well established (6, 7, 9). Consistent with previous studies, a low abundance high molecular weight complex (denoted by the arrow in Fig. 4A) was formed with wild type cell extracts on the HO promoter. This complex was absent from the swi4 or swi6 extracts, but was unaffected by mutation of MBP1. This confirms that our wild type extracts are competent to form SCB binding complexes. The lower complexes observed were comparable to those previously observed and were not specific for the SCB elements.


Fig. 4. Gel retardation analysis of CLN1 promoter binding factors. Binding assays were performed with radiolabeled probes containing SCB sequences from HO (A), MCB sequences from the TMP1 promoter (B), the SCB-like sequences from CLN1 (C), or the MCB core sequences from CLN1 (D). Whole cell extracts from wild type (BY602 and K1107) and deletion strains (BY600 swi6, BY606 swi4, K3294 mbp1) were assayed for binding to these probes and the complexes were separated by electrophoresis on 4% native polyacrylamide gels. In each case, the upper bands, denoted with arrows, are the only specific complexes. The gel shift complexes that are formed on the HO and TMP1 promoters are equivalent to those previously published (6, 7, 9, 12, 16, 36) based on their mobility, the effect of competitors and dependence upon specific transcription factors (data not shown). The lower complexes are nonspecific. These vary depending upon the DNA fragment used and the strain background.
[View Larger Version of this Image (53K GIF file)]


The TMP1 promoter contains MCB sequences which are critical for cell cycle-dependent transcription (12, 13), and activation of these MCB elements is Swi6- (11, 12) and Mbp1-dependent (16). Again, consistent with previous findings (16), a low abundance high apparent molecular weight complex was formed on the TMP1 MCB elements upon incubation with wild type extract that was not formed with the swi6 and mbp1 mutant cell extracts (Fig. 4B). This confirmed that the wild type extracts were competent to form standard MCB binding complexes. The MCB specificity of these binding complexes was verified by competition studies with wild type and mutant MCB sequences (data not shown). It is worth noting that complex formation is reduced in the swi4 strain. This could indicate that Swi4 also binds to the TMP1 MCB elements, however, Swi4 antibodies have no apparent effect on these binding complexes (see Fig. 5C).


Fig. 5. Direct binding of Swi4 and Swi6 to the CLN1 MCB. Polyclonal sera raised against recombinant Swi4 and Swi6 proteins (9) was titrated into gel retardation reactions with whole cell extracts prepared from wild type yeast (BY1231) with the CLN1 MCB (A), HO (B), and TMP1 (C) probes, as indicated at the top. Lanes 1, 7, 13, and 18 have no antibody added (-), lanes 2, 8, and 14 received 3 µl of phosphate-buffered saline (p), lanes 3-5, 9-11, 15-17, 19, and 20 had up to 5 µl of sera added as indicated above the lanes, and lanes 6 and 12 received 3 µl of sera and no yeast extract. For lanes 1-17 the arrow denotes the only Swi4- and Swi6-dependent bandshift complex. For lanes 18-20 the arrow points to the Mbp1- and Swi6-dependent bandshift complex on TMP1 as previously published (16).
[View Larger Version of this Image (73K GIF file)]


Knowing that our extracts and conditions permitted formation of both SCB- and MCB binding complexes, we repeated the assay with the SCB-like region of CLN1. With the CLN1 SCB probe, no complexes were formed that were Swi4-, Swi6-, or Mbp1-dependent (Fig. 4C). In contrast, the CLN1 MCB probe formed high molecular weight complexes with proteins from wild type extracts (Fig. 4D) that resembled the HO and TMP1 specific complexes in mobility. These complexes did not form with swi6 and swi4 mutant extracts, but they were as abundant with the mbp1 mutant extract as they were with wild type extracts. This indicates that the CLN1 MCB binding complex is Swi4- and Swi6-dependent, but that Mbp1 is not required.

To address whether Swi4 and Swi6 are present in the CLN1 MCB binding complex, we used affinity purified antibodies raised against recombinant Swi4 and Swi6 proteins (9) in the gel retardation assays. Addition of the Swi4 antibody to the CLN1 MCB binding reaction (Fig. 5A) caused retardation of all of the upper complexes. In fact, the pattern of supershifting on CLN1 MCB was very similar to that produced on incubation of Swi4 antisera with the HO DNA binding reaction using the same wild type extracts (Fig. 5B) (9). This suggests a direct involvement of Swi4 protein in the CLN1 MCB binding complex. The Swi6 antibody also affected the CLN1 MCB complex in that it either shifted the complexes to a higher position in the gel or prevented binding altogether. These results also support a direct involvement of Swi6 in the CLN1 MCB binding complex. In fact, all of the specific CLN1 MCB binding complex is affected by both the Swi4 and Swi6 antibodies. This would not be expected if a significant fraction of the complexes included Mbp1 instead of Swi4 or if they lacked Swi6. Thus, both the in vivo and in vitro data indicate that Swi4-Swi6 complexes are the predominant trans-activators of the CLN1 MCB region.

The Swi4 and Mbp1 proteins are related (16), therefore it was possible that the Swi4 antisera could cross-react with Mbp1. To address this possibility, we incubated Swi4 antibody in a TMP1 binding reaction in which Mbp1-Swi6 is the predominant complex. In this case the Swi4 antibodies had no impact on the mobility or the abundance of the TMP1 binding complex (Fig. 5C). The Swi4 antibody does not cross-react with Mbp1 under the conditions of the gel retardation assay, so it must be detecting only Swi4 in the CLN1 MCB binding complex.

Finally, we wanted to confirm that the MCB core sequences were responsible for the Swi4-Swi6 complex formation observed with the CLN1 MCB probe. To do this, we performed competition experiments using either the CLN1 MCB(2) probe (see Fig. 1) which includes the first two CGCG core sequences, or the analogous but mutated competitor (CLN1 mcb(2)), in which both CGCG cores of the elements are mutated to CTCT. Titration of the wild type competitor into the binding reaction caused a loss of complex formation, whereas even high levels of the mutant competitor failed to compete for binding to CLN1 MCB (Fig. 6). Interestingly, a single SCB element from the HO promoter could also compete for complex formation, whereas the homologous sequence with a mutated scb element failed to compete even at high concentrations. These experiments show that the CGCG core sequences are important for complex formation with the CLN1 MCB probe, but that binding of Swi4-Swi6 to the CLN1 MCB probe can also be competed by an SCB consensus binding sequence (CACGAAA).


Fig. 6. Complex formation on CLN1 MCB can be competed by both MCB and SCB sequences. Gel retardation assays were set up including up to 15-fold molar excess of competitor oligonucleotides in binding reactions with wild type yeast extracts (BY1231), prior to addition of CLN1 MCB probe. MCB competitors tested were the wild type CLN1 MCB(2) from -616 to -578 as diagrammed in Fig. 1, and the equivalent fragment (CLN1 mcb(2)), in which the two MCB cores were mutated from CGCG to CTCT. SCB competitors were derived from the HO endonuclease promoter (nucleotides -666 to -636) with a single SCB sequence (HO SCB), or a mutated version (HO scb) used in previous studies (9). The REB1 oligonucleotide is an unrelated transcription factor binding sequence which serves as a negative control.
[View Larger Version of this Image (74K GIF file)]



DISCUSSION

We have shown that the MCB core sequences are the predominant transcription activation elements in the CLN1 promoter during logarithmic growth. The SCB-like sequences in this promoter contribute much less to CLN1 activation. They are unable to activate reporter gene constructs, and they do not serve as Swi4-Swi6-binding sites in vitro. These SCB-like sequences differ from the known SCB sites at the second position, with CTCGAAA instead of the consensus CACGAAA. An A to C transversion at this position causes a 5-fold drop in UAS activity (20), so it is not surprising that a T is also deleterious at the second position.

One of the surprising results of these studies is that transcriptional activation of CLN1 is, in large part, derived from MCB-like sequences which are activated by Swi4-Swi6 complexes. Antibodies to Swi4 react with and supershift all the specific protein complexes formed on the CLN1 MCB core sequences, indicating that Swi4 is present in all of these complexes. This is not due to cross-reactivity of the Swi4 antibodies with Mbp1 (Fig. 6), nor is it due to the absence of Mbp1 from the whole cell extracts because the Mbp1-dependent band shift on TMP1 readily forms under these conditions (Fig. 5B). Mbp1 simply is not a detectable component of the CLN1 MCB complexes that form in vitro. Why, then, is the UAS activity of the CLN1 MCB region reduced at all in an mbp1 mutant strain? Two explanations seem plausible. Mbp1 may participate directly in a subset of the DNA binding complexes instead of Swi4, but our in vitro conditions may not favor its detection. Alternatively, the 2-fold drop in CLN1 MCB transcription that we observe in mbp1 strains may be an indirect effect. Swi4 has three MCB-like elements in its promoter that are critical for full SWI4 transcription (24). Thus, the loss of Mbp1 activity could reduce SWI4 transcription or affect its timing and that could indirectly cause the drop in CLN1 MCB transcription. Whether Mbp1 participates directly or indirectly, it is clear that it plays a minor role compared with Swi4 in these complexes. Swi4-Swi6 complexes form on the MCB core sequences and are the predominant trans-activators of the CLN1 gene.

This is the first clear demonstration that Swi4-Swi6 complexes can activate transcription through MCB-like elements in vivo, but there is other evidence that supports this idea. Cross-competition between SCB and MCB binding complexes has been demonstrated in vitro, but this requires 50-fold molar excess of competitor (12). In addition, in vitro translated fragments of Swi4 can bind to MCB sequences, and fragments of Mbp1 can bind to SCB sequences (16). Interpretation of these experiments is complicated by the fact that only fragments of the Swi4 and Mbp1 proteins were used, and they were present at far higher concentrations than the wild type proteins. Thus, their binding could be an artifact of protein concentration or conformational differences. These fragments are not competent to bind Swi6, so they certainly do not reflect the binding properties of the native complex. Swi4 overproduction in vivo promotes Swi6-independent transcription at SCB (17) and MCB sites (31), but this activity depends upon overproduction of Swi4, and the vast majority of the Swi4 present in such cells is also fragmented (9). With wild type levels of Swi4, both binding and activation of SCB elements absolutely depends upon Swi6 activity (5, 32). So, while these studies are useful for defining what the DNA binding fragment of Swi4 is capable of interacting with, the physiological significance of this interaction could not be assessed until such an activity was demonstrated in vivo with wild type cells. This study shows that the Swi4/Swi6-binding sites in the CLN1 promoter are different and more MCB-like than the ones that have been identified in the CLN2 and HO promoters. This raises the possibility that the complexes themselves may be fundamentally different, and that the Cln1 and Cln2 cyclins may be differentially regulated.

The only other known promoter at which functional overlap between Swi4 and Mbp1 may exist is the CLB5 promoter. CLB5 is also a cyclin, whose transcription peaks at the same time as SCB- and MCB-regulated genes. Interestingly, the CLB5 promoter contains five MCB core sequences (CGCG), but it has no perfect matches to either the MCB or SCB consensus (33). It has been suggested that these sites may be activated by both Swi4- and Mbp1-containing complexes because CLB5 transcription is cell cycle-regulated in both swi4 and mbp1 mutants (16, 33). However, the critical cell cycle regulatory elements in the CLB5 promoter have not been identified, so it is also possible that these CGCG sequences play no role in CLB5 transcription at all. If they do, they may be conventional Mbp1-Swi6-binding sites and the residual cell cycle regulation of CLB5 that is observed in mbp1 mutants may be due to a novel cell cycle regulatory element that has not yet been identified. The existence of novel cell cycle-specific regulatory elements has been demonstrated in all three of the G1-specific promoters that have been carefully analyzed (SWI4 (24), CLN2 (34, 35), and CLN1 (Fig. 3)). However, since activation at CGCG sequences occurs principally via Swi4-Swi6 complexes at the CLN1 promoter, it will be interesting to determine if CLB5 is regulated in a similar fashion, or if the CGCG sites in its promoter represent a fourth type of site at which binding by both Swi4-Swi6 and Mbp1-Swi6 complexes is equally likely.

The SCB binding complex, which includes Swi4 and Swi6, has been referred to as SBF, and the MCB binding complex, including Mbp1 and Swi6, is commonly called MBF (12, 36). Our data indicates the existence of a third type of complex, where Swi4 and Swi6 bind to CGCG sequences. This finding makes it clear that the binding site specificity of Swi4-Swi6 complexes is not restricted to SCB sequences as they are currently perceived, so it may be premature to apply one name to all of them. The lack of a clear consensus sequence for Swi4- and Mbp1-mediated transcription also makes it impossible to deduce by inspection the elements or factors required for the expression of any given promoter.

There are several possible hypotheses that could account for the altered binding specificity of Swi4 in the CLN1 MCB complexes. One possibility is that sequences adjacent to the CGCG sequences directly specify the binding of Swi4- rather than Mbp1-containing complexes. Alternatively, an accessory factor may bind to an adjacent site on the DNA that promotes this binding. A third possibility is that another protein binds directly to or modifies a subset of the Swi4-Swi6 complexes and changes their DNA binding specificity. It has been shown that the binding of the S. cerevisiae Mcm1 protein to weak consensus sequences can be strengthened by the presence of an adjacent binding site for the alpha 1 protein (37). Also, the DNA binding specificity of the Oct1 transcription factor is altered by the presence of the Herpes viral tegument protein, VP16, from ATGCAAAT to TAATGARAAT (38). We cannot rule out any of these possibilities at the moment. Determining the binding site specificity of Swi4-containing complexes by site selection (39) or by mutational analysis (20) is difficult because a single SCB element does not form a stable band shift complex2 or activate sufficient transcription to be reliably measured (5). The involvement of other proteins also cannot be addressed easily because full-length Swi4 cannot be efficiently produced in the expression systems that have been tested or by in vitro translation (8, 10). However, resolving these issues will be important for understanding the large number of G1/S-specific events that are regulated by the Swi4-Swi6 or Mbp1-Swi6 transcription complexes.

The other surprising result of this study is that the CGCG sequences are not the sole source of cell cycle regulated transcription within the CLN1 promoter. Elimination of these sequences as well as the SCB-like sequences did not eliminate the cell cycle regulation of the CLN1 promoter. In fact, the timing of the residual cell cycle regulated transcription from the mutant promoter is similar to the timing of the expression from the wild type promoter. There are no other obvious cell cycle regulatory elements within this promoter, so there must be another unrecognized cell cycle regulatory element within the CLN1 promoter which activates G1/S-specific transcription.

Redundancy is a commonly employed strategy for regulating cell cycle-specific events. Cyclin-CDK complexes are typically regulated at the level of transcription, post-translational phosphorylation, and ubiquination, and by the binding of inhibitors which are in turn highly regulated (40). Here is another example, where even the transcriptional control exerted on a cyclin promoter is redundant. It will be interesting to determine how many different promoter elements are employed to ensure the G1/S specificity of transcription and if their mechanisms of activation are equivalent, or whether they respond to different regulatory signals. The latter would afford more protection from deregulation, and more capacity to respond to different environmental cues.


FOOTNOTES

*   This work was supported in part by Grant GM41073 from the National Institutes of Health (to L. B.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§   Supported by a Robert E. Bayley Construction Inc. Fellowship and Human Frontiers of Science Postdoctoral Fellowship LT95/93. Present address: MRC Human Genetics Unit, Western General Hospital, Crewe Rd., Edinburgh, EH4 2XU, Scotland.
   To whom correspondence should be addressed: Fred Hutchinson Cancer Research Center, A2-168, 1124 Columbia St., Seattle, WA 98104. Tel.: 206-667-4484; Fax: 206-667-6526; E-mail: lbreeden{at}fred.fhcrc.org.
1    The abbreviations used are: SCB, Swi4/Swi6-regulated cell cycle box; MCB, MluI cell cycle box; PCR, polymerase chain reaction; UAS, upstream activation sequence.
2   L. Breeden, unpublished observations.

ACKNOWLEDGEMENTS

We thank J. Sidorova for reagents and valuable technical advice. We also thank J. Sidorova, C. McInerny, B. Mai, S. Ewaskow, and C. Gordon for critical reading of the manuscript. We are grateful to C. Wittenberg and B. Miller for DNAs and strains. We also thank T. Knight and P. Goodwin for PhosphorImage analysis and P. Huff for help with the manuscript.


REFERENCES

  1. Koch, C., and Nasmyth, K. (1994) Curr. Opin. Cell Biol. 6, 451-459 [CrossRef][Medline] [Order article via Infotrieve]
  2. Breeden, L. (1996) Curr. Top. Microbiol. Immunol 28, 95-127
  3. Wittenberg, C., Sugimoto, K., and Reed, S. I. (1990) Cell 62, 225-237 [CrossRef][Medline] [Order article via Infotrieve]
  4. Tyers, M., Tokiwa, G., and Futcher, B. (1993) EMBO J. 12, 1955-1968 [Medline] [Order article via Infotrieve]
  5. Breeden, L., and Nasmyth, K. (1987) Cell 48, 389-397 [CrossRef][Medline] [Order article via Infotrieve]
  6. Andrews, B. J., and Herskowitz, I. (1989) Nature 342, 830-833 [CrossRef][Medline] [Order article via Infotrieve]
  7. Taba, M. R. M., Muroff, I., Lydall, D., Tebb, G., and Nasmyth, K. (1991) Genes Dev. 5, 2000-2013 [Abstract/Free Full Text]
  8. Primig, M., Sockanathan, S., Auer, H., and Nasmyth, K. (1992) Nature 358, 593-597 [CrossRef][Medline] [Order article via Infotrieve]
  9. Sidorova, J., and Breeden, L. (1993) Mol. Cell. Biol. 13, 1069-1077 [Abstract/Free Full Text]
  10. Andrews, B. J., and Moore, L. A. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 11852-11856 [Abstract/Free Full Text]
  11. Lowndes, N. F., Johnson, A. L., Breeden, L., and Johnston, L. H. (1992) Nature 357, 505-508 [CrossRef][Medline] [Order article via Infotrieve]
  12. Dirick, L., Moll, T., Auer, H., and Nasmyth, K. (1992) Nature 357, 508-513 [CrossRef][Medline] [Order article via Infotrieve]
  13. McIntosh, E. M., Atkinson, T., Storms, R. K., and Smith, M. (1991) Mol. Cell. Biol. 11, 329-337 [Abstract/Free Full Text]
  14. Gordon, C. B., and Campbell, J. L. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 6058-6062 [Abstract/Free Full Text]
  15. Verma, R., Smiley, J., Andrews, B., and Campbell, J. L. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 9479-9483 [Abstract/Free Full Text]
  16. Koch, C., Moll, T., Neuberg, M., Ahorn, H., and Nasmyth, K. (1993) Science 261, 1551-1557 [Abstract/Free Full Text]
  17. Breeden, L., and Nasmyth, K. (1987) Nature 329, 651-654 [CrossRef][Medline] [Order article via Infotrieve]
  18. Ogas, J., Andrews, B. J., and Herskowitz, I. (1991) Cell 66, 1015-1026 [CrossRef][Medline] [Order article via Infotrieve]
  19. Nasmyth, K., and Dirick, L. (1991) Cell 66, 995-1013 [CrossRef][Medline] [Order article via Infotrieve]
  20. Andrews, B. J., and Moore, L. (1992) Biochem. Cell Biol. 70, 1073-1080 [Medline] [Order article via Infotrieve]
  21. Breeden, L., and Mikesell, G. (1991) Genes Dev. 5, 1183-1190 [Abstract/Free Full Text]
  22. Sherman, F., Fink, G. R., and Hicks, J. B. (1982) Methods in Yeast Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  23. Hadwiger, J. A., Wittenberg, C., Richardson, H. E., De Barros Lopes, M., and Reed, S. I. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 6255-6259 [Abstract/Free Full Text]
  24. Foster, R., Mikesell, G. E., and Breeden, L. (1993) Mol. Cell. Biol. 13, 3792-3801 [Abstract/Free Full Text]
  25. Kunkel, T. A. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 488-492 [Abstract/Free Full Text]
  26. Miller, A. M. (1984) EMBO J. 3, 1061-1065 [Medline] [Order article via Infotrieve]
  27. Breeden, L., and Mikesell, G. (1994) Genetics 138, 1015-1024 [Abstract]
  28. Breeden, L., and Nasmyth, K. (1985) Cold Spring Harbor Symp. Quant. Biol. 50, 643-650 [Abstract/Free Full Text]
  29. Nasmyth, K. (1983) Nature 302, 670-676 [CrossRef][Medline] [Order article via Infotrieve]
  30. Nasmyth, K. (1985) Cell 42, 225-235 [CrossRef][Medline] [Order article via Infotrieve]
  31. Morgan, B. A., Bouquin, N., Merrill, G. F., and Johnston, L. H. (1995) EMBO J. 14, 5679-5689 [Medline] [Order article via Infotrieve]
  32. Andrews, B. J., and Herskowitz, I. (1989) Cell 57, 21-29 [CrossRef][Medline] [Order article via Infotrieve]
  33. Epstein, C. B., and Cross, F. R. (1992) Genes & Dev. 6, 1695-1706 [Abstract/Free Full Text]
  34. Stuart, D., and Wittenberg, C. (1994) Mol. Cell. Biol. 14, 4788-4801 [Abstract/Free Full Text]
  35. Cross, F. R., Hoek, M., McKinney, J. D., and Tinkelenberg, A. H. (1994) Mol. Cell. Biol. 14, 4779-4787 [Abstract/Free Full Text]
  36. Moll, T., Dirick, L., Auer, H., Bonkovsky, J., and Nasmyth, K. (1992) J. Cell Sci. 16, 87-96
  37. Hagen, D. C., Bruhn, L., Westby, C. A., and Sprague, G. F. J. (1993) Mol. Cell. Biol. 13, 6866-6875 [Abstract/Free Full Text]
  38. O'Hare, P., Goding, C., and Haigh, A. (1988) EMBO J. 7, 4231-4238 [Medline] [Order article via Infotrieve]
  39. Blackwell, T. K., Huang, J., Ma, A., Kretzner, L., Alt, F. W., Eisenman, R. N., and Weintraub, H. (1993) Mol. Cell. Biol. 13, 5216-5224 [Abstract/Free Full Text]
  40. Wuarin, J., and Nurse, P. (1996) Cell 85, 785-787 [CrossRef][Medline] [Order article via Infotrieve]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Eukaryot CellHome page
M. G. Slattery, D. Liko, and W. Heideman
Protein Kinase A, TOR, and Glucose Transport Control the Response to Nutrient Repletion in Saccharomyces cerevisiae
Eukaryot. Cell, February 1, 2008; 7(2): 358 - 367.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
L. Li, T. Quinton, S. Miles, and L. L. Breeden
Genetic Interactions Between Mediator and the Late G1-Specific Transcription Factor Swi6 in Saccharomyces cerevisiae
Genetics, October 1, 2005; 171(2): 477 - 488.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. M. Bean, E. D. Siggia, and F. R. Cross
High Functional Overlap Between MluI Cell-Cycle Box Binding Factor and Swi4/6 Cell-Cycle Box Binding Factor in the G1/S Transcriptional Program in Saccharomyces cerevisiae
Genetics, September 1, 2005; 171(1): 49 - 61.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. T. Harreman, T. M. Kline, H. G. Milford, M. B. Harben, A. E. Hodel, and A. H. Corbett
Regulation of Nuclear Import by Phosphorylation Adjacent to Nuclear Localization Signals
J. Biol. Chem., May 14, 2004; 279(20): 20613 - 20621.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Costanzo, O. Schub, and B. Andrews
G1 Transcription Factors Are Differentially Regulated in Saccharomyces cerevisiae by the Swi6-Binding Protein Stb1
Mol. Cell. Biol., July 15, 2003; 23(14): 5064 - 5077.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
E. Queralt and J. C. Igual
Cell Cycle Activation of the Swi6p Transcription Factor Is Linked to Nucleocytoplasmic Shuttling
Mol. Cell. Biol., May 1, 2003; 23(9): 3126 - 3140.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Koc, L. J. Wheeler, C. K. Mathews, and G. F. Merrill
Replication-independent MCB Gene Induction and Deoxyribonucleotide Accumulation at G1/S in Saccharomyces cerevisiae
J. Biol. Chem., March 7, 2003; 278(11): 9345 - 9352.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
S. E. Porter, T. M. Washburn, M. Chang, and J. A. Jaehning
The Yeast Paf1-RNA Polymerase II Complex Is Required for Full Expression of a Subset of Cell Cycle-Regulated Genes
Eukaryot. Cell, October 1, 2002; 1(5): 830 - 842.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
H. Wijnen, A. Landman, and B. Futcher
The G1 Cyclin Cln3 Promotes Cell Cycle Entry via the Transcription Factor Swi6
Mol. Cell. Biol., June 15, 2002; 22(12): 4402 - 4418.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
V. L. MacKay, B. Mai, L. Waters, and L. L. Breeden
Early Cell Cycle Box-Mediated Transcription of CLN3 and SWI4 Contributes to the Proper Timing of the G1-to-S Transition in Budding Yeast
Mol. Cell. Biol., July 1, 2001; 21(13): 4140 - 4148.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
Z. A. Zimmerman and D. R. Kellogg
The Sda1 Protein Is Required for Passage through Start
Mol. Biol. Cell, January 1, 2001; 12(1): 201 - 219.
[Abstract] [Full Text]


Home page
GeneticsHome page
N. Macpherson, V. Measday, L. Moore, and B. Andrews
A Yeast taf17 Mutant Requires the Swi6 Transcriptional Activator for Viability and Shows Defects in Cell Cycle-Regulated Transcription
Genetics, April 1, 2000; 154(4): 1561 - 1576.
[Abstract] [Full Text]