![]()
|
|
||||||||
(Received for publication, July 2, 1996, and in revised form, January 10, 1997)
From the Department of Biomolecular Sciences, University of
Manchester Institute of Science and Technology, Manchester M60 1QD,
United Kingdom
Translation and mRNA decay constitute key
players in the post-transcriptional control of gene expression. We
examine the mechanisms by which the 5 The steady-state abundance of mRNA in the eukaryotic cell is
determined by the relative rates of its transcription and degradation. mRNA decay rates are not uniform, but rather vary over at least a
100-fold range (1-6), thus influencing significantly the rates of
expression of individual genes. Moreover, modulation of mRNA decay
constitutes an important means of regulating gene expression (3,
7-10). The mechanism of mRNA degradation has accordingly been the
subject of intensive research activity and has been found to be a
complex process, following a number of pathways (2, 11-13).
Any model of mRNA decay has to take into account that the same
molecules that are turned over by the action of degradative enzymes
also serve as templates for translation (see e.g. 14). Indeed, a number of investigations have indicated that translation influences the decay process. First, the rapidly degraded mRNAs of
yeast MAT Up to now, the main model system for the study of translational
influences on mRNA degradation in yeast has been the relatively stable mRNA encoded by PGK1 (11, 23, 26). Following the original observation that premature translational termination in
URA3 destabilizes the mRNA (17), much of the work in
this area has focused on the question of how nonsense codons in the reading frame of aberrant forms of PGK1 can accelerate the
decay process (23). A current model specifies that
nonsense-dependent decay requires a termination codon
within the amino-terminal two-thirds of the PGK1 reading
frame followed by specific sequence elements that include a site for
reinitiation (24, 32). Other data suggest that similar principles apply
to the nonsense-induced decay of HIS4 mRNA
(32, 33).
Characterization of the principles governing the relationship between
translation and mRNA stability is essential to achieving an
understanding of the multiple forms of post-transcriptional control
which are active in the eukaryotic cell. In the present paper we focus
on the 5 We used the following yeast strains:
YPM156B (a ade2-1 leu2-3 leu2-112 trp1-1 ura3-52
rpb1-1), a segregation product from a cross involving RY262 (38);
SWP154 (a trp1- The plasmids were constructed according
to standard methods (42) and verified by means of DNA sequencing. The
basic expression plasmids used were YCpSUPEX1 (GPF promoter;
43) and YCp22FL (TEF1 promoter; 44). The leader sequences
inserted are schematically represented in Fig. 1 and
provided in detail in Table I. Each of these leader
sequences was synthesized in the form of an oligodeoxyribonucleotide pair using an Applied Biosystems DNA synthesizer. The paired ends were
BamHI and NdeI, whereby the NdeI site
includes the translational start codon of the main reading frame. The
sequences shown in Table I correspond to the mRNA leaders as they
are synthesized in the cell. We have shown previously that
transcription from the GPF and TEF1 promoters
initiates upstream and downstream of the 5
5 These sequences correspond to the mRNA leaders initiated at the
respective major transcriptional initiation sites of the GPF promoter (FL, B3, X3) and the TEF1 promoter (the remaining
constructs). The transcriptional initiation site of the GPF
promoter is located 5
Volume 272, Number 14,
Issue of April 4, 1997
pp. 9131-9140
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
-Untranslated
Region, and Not Restriction of Translational Initiation per
se, Modulates the Stability of Nonaberrant mRNAs in the
Yeast Saccharomyces cerevisiae*

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
-untranslated region (UTR) of
nonaberrant mRNAs acts to modulate both these processes in
Saccharomyces cerevisiae. Two classes of functional
relationship between ribosome-5
-UTR interactions and mRNA decay
are identifiable. In the first of these, elements in the main open
reading frame (ORF) dictate how the decay process reacts to inhibitory
structures in the 5
-UTR. The same types of stability modulation can be
elicited by trans-regulation of translation via inducible
binding of the iron-regulatory protein to an iron-responsive element
located 9 nucleotides from the 5
cap. A eukaryotic translational
repressor can therefore modulate mRNA decay via the 5
-UTR. In
contrast, translational regulation mediated via changes in the activity
of the cap-binding eukaryotic translation initiation factor eIF-4E
bypasses translation-dependent pathways of mRNA
degradation. Thus modulation of mRNA stability via the 5
-UTR
depends on disruption of the scanning process, rather than changes in
translational initiation efficiency per se. In the second
class of pathway, an upstream ORF (uORF) functions as a powerful
destabilizing element, inducing termination-dependent degradation that is apparently independent of any main ORF determinants but influenced by the efficiencies of ribosomal recognition of the uORF
start and stop codons. This latter mechanism provides a regulatable
means to modulate the stability of nonaberrant mRNAs via a
UPF-dependent pathway.
1 (15) and mammalian early response genes (16) contain translation-dependent destabilizing elements within
their respective coding regions. Second, the presence of nonsense
codons in the reading frames of at least some yeast mRNAs
accelerates their degradation (17-19). In mammalian systems, nonsense
codons destabilize nuclear, rather than cytoplasmic, mRNA (20, 21). In yeast, the pathway of accelerated decay triggered by nonsense codons, referred to as nonsense-mediated decay, is dependent on trans-acting factors encoded by the UPF genes
(22, 23). One of these, Upf1p, seems to be associated with ribosomes
(4, 24). Third, an upstream open reading frame
(uORF)1 in the 5
-UTR of a bacterial
cat gene expressed in yeast destabilizes the whole mRNA
(25). Fourth, translational inhibition of the yeast PGK1
mRNA by a stem-loop or a poly(G) sequence in its 5
-UTR leads to
destabilization (26). However, the influence of such inhibitory
structures was already shown earlier not to destabilize every mRNA
(27-29), thus demonstrating that this is no straightforward relationship. Finally, two means of inhibiting translation lead to
mRNA stabilization. They involve the inhibition of elongation using
cycloheximide (2, 5, 29-31) and the use of a mutation in tRNA
nucleotidyltransferase (31). Clearly, both of these experimental
strategies impose a general block on translational elongation.
-UTR as a mediator of posttranscriptional control for diverse
nonaberrant mRNAs in the eukaryotic cell. The 5
-UTR has been known
for some time to play a pivotal role in the control and regulation of
translational initiation. Thus, cis-acting structural
elements in the 5
-UTR (34), or the binding of trans-acting
factors to specific sites in this region (35-37), can modulate
translation. We now show that the 5
-UTR also manifests a number of
regulatory properties influencing the decay of different types of
mRNA in yeast, and we provide insight into the mechanisms that are
involved. Our results are of significance to both gene-specific and
global regulation in the eukaryotic cell, demonstrating how interactions among the 5
-UTR, the translational apparatus, and the
degradation machinery determine the nature of posttranscriptional control.
Strains and Media
1 upf1::URA3 leu2-1 his4-38
ura3-52 rpb1-1; 4); SWP154(+) (a trp1-
1
upf1::URA3 leu2-1 his4-38 ura3-52 rpb1-1 <UPF1 TRP1 CEN>; 19); JMC 1/2 (a leu2 ura3-52 cdc33::LEU2
trp 1-1 <cdc33
196 URA3 CEN>; 39). The bacterial strain used
was Escherichia coli TG2 (supE hsd
5 thi
(lac-proAB)
(srl-recA)306::Tn10
(tetr) F
[traD36
proAB+ lacIq lacZ
M15]). The
yeast growth media (40) were YEPD, YEP-Gal (as YEPD, but with 2%
galactose instead of glucose), YNB (containing amino acids and/or
nucleotides as required), and LAC/GAL. Transformation of yeast was
performed using the lithium acetate method (41).
BamHI site,
respectively (43, 44).
Fig. 1.
Plasmid constructs encoding mRNAs whose
translation is inhibited by structures in the 5
-UTR. Different
structures were introduced into the 5
-UTR. Panel A, a
stem-loop (see Table I for sequence), either close to the 5
end (the
BamHI site, B) or close to the start codon (the
XhoI site, X). Panel B, a poly(G)
element, containing 18 G residues. Panel C, an IRE in the
AflII site (A), which was bound by the IRP whose
transcription was directed by the inducible GPF promoter
(PGPF). The TEF1 promoter (PTEF1) provided constitutive
expression. Transcription was terminated by the PGK1
terminator (TPGK1). The encoded
mRNAs therefore had defined 5
and 3
ends. Three genes were used:
S. cerevisiae PGK1
, and the genes encoding firefly
luciferase (LUC) and bacterial chloramphenicol
acetyltransferase (cat). The other restriction sites
indicated are HindIII (H), XbaI
(Xb), EcoRI (E), NdeI
(N), and ClaI (C).
[View Larger Version of this Image (23K GIF file)]
-UTR sequences used in this work
of the BamHI site, whereas that of
the TEF1 promoter lies immediately 3
of the
BamHI site. Insertion of stem-loop structures (indicated by
arrows) into the control leader FL generated the extended 5
-UTRs of B3
and X3, respectively. Alternatively, 18 G residues were introduced,
creating the poly(G) leader. Two further leaders contained two versions
of a "minimal" form (44) of the IRE (the stem-loop arms are
indicated by arrows), one with the wild-type sequence (wt), the other
with a mutant loop sequence lacking a C residue (
C). The remaining
leaders were used in studies of the influence of uORFs (compare Fig.
7). A single base change at position +7 of the control leader B10
generated an uORF (B1A). In B1AS the distance of the uORF from the 5
end was increased, whereas in OL the uORF overlaps with the main ORF.
Finally, both wild-type and mutant forms of the natural PPR1
leader were investigated. The uORF sequences are shown in capitals.
FL
aaggatccaattatctacttaagaacacaaaactcgagaacat
B3
aaggatccagaactaggaaaaaaatcctagttcttgatccaattatctacttaagaacacaaaactcgagaacat









X3
aaggatccaattatctacttaagaacacaaaactcgaagatacaggtaaaaaaatacctgtatcctcgagaacat








Poly(G)
aattatctacttaaggggggggggggggggggcttaagaacacaaaactcgagaacat
IREwt
aattatctacttaagcttcaacagtgcttgaacttaagaaacacaaaactcgagaacat





IRE
Caattatctacttaagcttcaaagtgcttgaacttaagaaacacaaaactcgagaacat






B10
aaaaaaagatccaattatctacttaagaacacaaaactcgagaacat
B1A
aaaaa ATG ATC CAA TTA TCT ACT TAA
gaacacaaaactcgagaacat
B1AS
aaattatcactagtactgacacaaaaa ATG ATC CAA TTA TCT ACT TAA
gaacacaaaactcgagaacat
OL
aaaaa ATG ATC CAA TTA TCT ACG AAC ACA
AAA CTC GAG AAC ATG
PPR1wt
aaggagtaaccctttagagtacataaaacatacgaag
ATG ATG ATT AAC ATA CT
PPR1mut
aaggagtaaccctttagagtacataaaacatacgaag
aag aag att aac atA CT
Extracts were prepared from cells grown in YNB medium to OD550 = 0.8-0.9. 2-ml samples from the cultures were pelleted by centrifugation; the pellets were washed twice using 50 mM Tris-Cl, pH 7.5, and frozen for subsequent analysis. The cells were broken by vortexing together with glass beads. Luciferase activities in the lysates were determined using standard procedures (45, 46), aided by a luminometer (Lumat-LB9501, Berthold). Chloramphenicol acetyltransferase activities were determined using either a radioactive assay (47) or an enzyme immunoassay (Boehringer chloramphenicol acetyltransferase enzyme-linked immunosorbent assay kit).
RNA Isolation and Half-life DeterminationsThe glassware and plasticware used in the following procedures were treated with diethyl pyrocarbonate and autoclaved before use. Total RNA was isolated using a modified version of the hot phenol procedure (48). Half-lives were determined using the strain YPM156B, which has a temperature-sensitive polymerase II. After growth at 25 °C, the polymerase was inactivated by rapidly raising the incubation temperature to 37 °C through the addition of hot medium. Culture samples were then taken at various times subsequent to the temperature shift and used for the preparation of RNA. Glyoxylation of RNA samples, electrophoresis through agarose gels, Northern blotting, membrane hybridization, and autoradiography were performed according to standard procedures (42). The relative amounts of specific mRNAs detected by Northern blotting were assessed by cutting out bands from blotted and hybridized membranes and counting them in a scintillation counter. Estimates of half-lives are all based on at least three independent repetitions of each experiment.
Polysomal Gradient AnalysisPolysomal gradients and subsequent analysis of the fractions were performed as described previously (25).
-UTR on mRNA
Stability Is Gene-dependent
Translational control on
eukaryotic genes is imposed by a variety of different mechanisms
involving the 5
-UTR. These mechanisms are linked to a number of
structural properties of the leader region. We wanted to assess whether
these distinct types of translational control mechanism determine
common or independent effects on mRNA decay. Since previous work
has indicated that the decay of distinct mRNAs can respond
differently to translational modulation via the 5
-UTR (26-31), we
chose three genes for a comparative study. As the results in this paper
show, the use of only one reading frame would have generated results
that are not representative of the range of translation-stability
relationships that can occur in yeast. Moreover, as we shall see, the
use of alternative reading frames helps distinguish two classes of
stability modulation mediated via the 5
-UTR. Two of the reading frames
used here are reporter genes whose products are detected readily using
sensitive and accurate assays, thus facilitating the assessment of
overall expression rates. We initiated this investigation by examining
the effects on translation and mRNA decay of inserting two types of
structural element into the 5
-UTR, both of which are known to inhibit
translation (Fig. 1). The first type of element was a stem-loop
structure with a predicted stability sufficient to inhibit translation
by more than 80%. Secondary structures in the 5
-UTR are known to restrict the translation of many naturally occurring eukaryotic mRNAs (34). Stem-loop structures have been shown previously to have
little effect on the stability of cat and MFA2
mRNAs in yeast (27-29). In contrast, a stem-loop in the 5
-UTR of
the PGK1 mRNA was found to induce accelerated decay
(26). We have now shown that LUC mRNA is stabilized when
a stem-loop structure is placed in its 5
-UTR (Fig. 2).
Two leaders were used: B3, in which the stem-loop was close to the 5
end; and X3, in which the stem-loop was close to the start codon (43).
The rationale for testing two different positions for the stem-loop is
that a structure near the cap may interfere with an earlier stage of
the scanning process than a stem-loop further downstream (49). In fact,
in both cases stabilization of LUC mRNA was observed,
indicating that there is no position effect with respect to the
influence of a stem-loop on decay. This first comparison therefore
revealed that three types of coupling between translation rate and
mRNA decay are possible in Saccharomyces cerevisiae:
positive, in which decreases in translational initiation decrease the
rate of mRNA decay (LUC); negative, where the opposite
relationship applies (PGK1); and neutral, where no link
between the two is evident (cat).
-UTR (Fig.
1A) stabilize the LUC mRNA. A hairpin
loop (see Table I for sequence) inserted either 3 nucleotides
(B3) or 33 nucleotides (X3) from the cap
stabilized the mRNA by approximately 70%. Samples were taken from
cultures at the given time points subsequent to inhibition of
transcription on the specified vectors brought about via
galactose-glucose shift. Northern blot hybridization was performed
using radioactive probes for LUC and PGK1
mRNAs, the latter being chromosomally encoded.
To determine whether these different modes of behavior are exclusive to
stem-loop structures, we compared the effects of a series of 18 G
residues in the 5
-UTRs of the same three genes (Fig.
3). Poly(G) sequences have been shown previously to
inhibit translation when placed in the 5
-UTR (50) and to block 5
3
exonuclease activity (51). The shortened version of PGK1 (PGK1
) was created by deleting the region between the two
SalI sites of its reading frame to allow independent
detection of the plasmid-encoded PGK1
mRNA, even in
the presence of the chromosomal PGK1 gene. This is
especially useful because the chromosomally encoded PGK1
mRNA serves as an internal control (see e.g. Fig. 3C). The deletion had no effect on the normal decay behavior
of the PGK1
mRNA (data not shown). The poly(G)
element, as reported previously (26), destabilized the PGK1
mRNA. Insertion of the same poly(G)-containing leader upstream of
cat and LUC resulted in measured enzyme
activities reduced by at least 99.9%. Yet it had no effect on
cat mRNA stability, and it stabilized the LUC mRNA (Fig. 3). The degree of stabilization of the LUC
mRNA was greater than that caused by the stem-loop structures (Fig.
2).
-UTR bearing little secondary structure (25, 28).
Overall, the above data show that any assessment of the influence of
5
-UTR structure on mRNA decay must take into account the role
played by stability determinants present in the body of the mRNA.
Three different types of relationship between translation and decay are
possible. Although not the main theme of the present study,
understanding this essential principle was of immediate relevance to
the subsequent analysis of the effects of mRNA-binding proteins on
mRNA decay.
It has been established that an important
principle of specific gene regulation in eukaryotes involves
translational inhibition mediated by the binding of a repressor protein
to a site in the 5
-UTR of the target mRNA (35-37). For example,
previous work has shown that the higher eukaryotic iron-regulatory
protein (IRP) can be targeted to the 5
-UTR of an mRNA in yeast,
where it interferes with translation of the reporter mRNA (44).
Transcription of the gene encoding this cytoplasmic repressor can be
placed under the control of an inducible promoter (44; Fig.
1C). Using this system, we could determine whether a
5
-UTR-specific RNA-binding protein can regulate gene expression via
modulation of mRNA decay. Insertion of an iron-responsive element
(IRE), which is tightly bound by IRP, into the 5
-UTRs of
cat, LUC, and PGK1
allowed us to
achieve inducible repression of the translation of the corresponding mRNAs (see e.g. Fig. 4B). As
controls, we used a 5
-UTR containing a mutant derivative of IRE that
is missing a C in the loop (
C; 44, 52), and a 5
-UTR lacking an IRE
sequence (FL; Fig. 5). The effects of IRP binding to an
IRE in the 5
-UTR of PGK1
and LUC were
investigated by means of polysomal gradient analysis (as illustrated in
Fig. 5). Once IRP had reached its maximal abundance in the cell, the
major part of both mRNAs was localized in the 40 S/43 S fraction,
consistent with strong inhibition of translational initiation. The
equivalent IRE-LUC (Fig. 4) and IRE-cat (data not
shown) constructs directed the synthesis of greatly reduced enzyme
activities. For the sake of simplicity, the luciferase activity
obtained with the LUC IRE
C construct was normalized to
100% in Fig. 4 but was in fact 10% lower than that of the FL control.
IRP binding to the wild-type IRE induced accelerated decay of the
PGK1
mRNA (Fig. 4D), stabilization of the
LUC mRNA (Fig. 4A), and no change in the
stability of the cat mRNA (Fig. 4C). In other
words, translational inhibition by a cytoplasmic repressor protein
targeted to the 5
-UTR brought about effects that are equivalent to
those observed when translation of these three mRNAs was inhibited
by a stable stem-loop structure alone. This means that the binding
energy of an RNA-binding protein can substitute for intrinsic
structural elements of the mRNA.
-UTR
(Fig. 1C) not only inhibits translational initiation
(panel B), but also elicits modulatory effects on the
stability of the LUC (panel A), cat (panel C), and PGK1 (panel D)
mRNAs that are equivalent to those seen with strongly inhibitory
intramolecular structures (Figs. 2 and 3). The
C mutant form of
IRE is taken here as a reference. However, this mutant IRE structure,
which is effectively inactive in mammalian cells, still results in some
inhibition of translation and modulation of mRNA decay (compare
Fig. 10). wt, wild-type.
-UTR of the
LUC mRNA results in a shift in the distribution of the
LUC mRNA to the monosomal region of the polysomal
gradient (panel A); in contrast, the control LUC mRNA, which lacks an IRE, shows a normal polysomal
distribution in the presence of IRP (panel B). Each
diagram shows the fractional distribution of optical absorbance in a
sucrose gradient experiment above a Northern blot prepared using the
numbered fractions. In these blots, cohybridization with a
PGK1-specific probe reveals the polysomal distribution of
chromosomally encoded PGK1 mRNA.
Effects on mRNA Stability of Changes in the Binding Activity of eIF-4E
IRP functions as a translational repressor protein that is
specifically targeted to only those mRNAs bearing one or more IREs. We next addressed the question whether an mRNA-binding protein essential to the translational initiation process, and involved in
global translational regulation, could also influence mRNA stability. eIF-4E mediates binding of the cytoplasmic cap-binding complex (eIF-4F) to the mRNA cap. Apart from the potential role of
this factor as a translational regulatory factor (53-57), its interactions with the cap structure might conceivably influence the
decapping reaction, which is thought to be an intrinsic step of a major
pathway of mRNA decay (13). We took advantage of a series of
CDC33 deletion mutants that encode truncated versions of
yeast eIF-4E with reduced binding affinities for the 5
cap structure
(39). In mutant haploid strains carrying these truncated eIF-4E
proteins there is constitutive, partial inhibition of translation, and
the translational apparatus shows a reduced ability to distinguish between capped and noncapped mRNAs that have been introduced
electrophoretically into the cells (39). Such mutants are therefore
appropriate for analysis of the effects of modulation of eIF-4E
activity on the stability of mRNA.
Two different types of eIF-4E mutation were used:
196, which lacks
the COOH-terminal 18 amino acids of the wild-type protein sequence, and
19/206, in which both the first 18 and the last 8 amino acids are
missing. Given the potential significance of eIF-4E-cap interactions in
terms of both translation and mRNA decapping, we assessed the
ability of these mutants to bind capped, as opposed to uncapped,
mRNA. This was achieved by means of an in vitro assay
that uses biotinylated mRNAs synthesized in vitro (57).
Both types of mutation reduce this protein's absolute cap binding
affinity and selectivity for capped mRNAs (see e.g. the
comparison between wild-type eIF-4E and
196 in Fig.
6A). This mimics the effects expected when
the wild-type activity of eIF-4E is regulated by means of interactions
with regulatory proteins (54, 55) or via changes in its phosphorylation
status (53-56). Expression of these mutant forms of eIF-4E from the
relatively weak TRP1 promoter in S. cerevisiae
supports reduced rates of translation in vivo (Fig.
6B). On the other hand, overexpression of the mutant
CDC33 mutants using the GPF1 promoter leads to a dosage compensation effect, so that translation is either partially (
196) or completely (
19/206) restored. Overexpression of
wild-type eIF-4E partially depresses translation (compare Ref. 57).
Analysis of the decay rates of the LUC mRNA in these
respective strains revealed that translational attenuation mediated via
mutations in eIF-4E does not influence the stability of this mRNA
(Fig. 6B). Moreover, the PGK1
mRNA was only minimally
destabilized, showing a reduction in half-life of maximally 10%. The
generally shorter half-life estimated for PGK1
mRNA
in these experiments is attributable to the fact that we used a
galactose-glucose shift (as opposed to heat inactivation of polII) in
the experimental procedure (compare e.g. Ref. 26). The
minimal change in stability caused by reduced eIF-4E activity is in
stark contrast to the effects of translational repression via IRP or of
inhibitory structures introduced into the 5
-UTR (see above). We
conclude that eIF-4E activity, which is known to be regulated in
eukaryotic cells, exerts a modulating effect on translation without
interfering with the mRNA decay process, irrespective of the type
of mRNA species involved.
196
was found to have greatly reduced absolute binding activity as well as
cap specificity. This resulted in 70% inhibition of translation
(panel B) when the mutant eIF-4E was present at a
physiologically normal level (TRP1 promoter), whereas
partial dosage compensation was seen with the GPF promoter. The mutant
19/206 had generally less significant effects. The mutations resulted in at most minimal effects on mRNA stability (panel B).
An Upstream ORF Can Destabilize a Range of mRNAs
The
translational modulation mechanisms considered above all involve
inhibition of an early stage of interaction between the 40 S ribosomal
subunit and/or the blockage of the process of scanning toward the first
AUG in the mRNA. However, these are not the only mechanisms
available to the cell for the attenuation and regulation of
translational initiation. A considerable number of mRNAs in yeast
(58-62) and higher cells (34) have uORFs in their 5
-UTRs. Previous
work showed that a short uORF not only inhibits the translation of
cat mRNA in yeast, but also destabilizes it (25). We
made use of the same uORF-containing leader to investigate whether this
destabilizing effect also applies to other mRNAs (Fig.
7). Both the LUC and PGK1
mRNAs were indeed destabilized in the presence of the uORF (Fig.
8 and Table II), whereby the effect on
the already very unstable LUC mRNA was comparatively
small. The efficiency with which ribosomes recognize the start codon of
an uORF can be expected to be determined by a number of factors, one of
which is its distance from the 5
end of the mRNA (compare Refs. 63 and 64). We found that the degree of destabilization was dependent on
the position of the uORF relative to the 5
end of the mRNA. In one
type of leader (B1A), the uORF was only 6 nucleotides from the 5
end,
in which position it inhibited translation of the main ORF less
effectively then when this distance was increased to 28 nucleotides
(B1AS) via the introduction of a spacer (Fig. 7 and Table II). The
former position also led to less significant destabilization than the
latter (Fig. 8).
-UTR
of the PTEF1 expression vector containing either the
LUC or the PGK1 gene (panel A). Thus
the control leader (B1O) was converted to B1A by means of a single A
U substitution. Extension of the distance of the uORF to the cap
from 6 to 28 nucleotides yielded B1AS. An overlapping form of uORF (OL)
was also created or is present in the PPR1 leader. Mutation
of the two AUG codons in the PPR1 leader eliminated this overlapping uORF (PPR1mut). wt, wild-type.
end of the
mRNA, so that inhibition of translation of the main ORF is less
than when the cap-uORF distance is increased (B1AS; Table II).
Accordingly, the B1AS leader has a considerably stronger destabilizing
effect (compare panels A and B). In each case,
the destabilization is partially reversed in a
upf1
host. Extending the uORF of B1A into the
main reading frame (OL) also leads to enhanced destabilization, despite
the short cap-uORF distance (compare Tables I and II).
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
An example of a natural yeast mRNA bearing an uORF is that of
PPR1, which is one of the least stable yeast mRNAs known
(65). The upstream uORF of PPR1 is in the +1 reading frame
with respect to the main ORF and terminates within the tetranucleotide
A, which also includes the start codon of the main ORF.
Insertion of this leader upstream of PGK1
necessitated
modification of the second codon of the PGK1
reading
frame (to ACU; Table I). Again, the presence of an uORF rendered the
half-life of the PGK1 mRNA immeasurably short (data not
shown). Mutagenesis of the two consecutive start codons of the
PPR1 uORF to AAGAAG nullified the destabilization effect.
Thus both natural and synthetic uORFs act as destabilizing elements via
a mechanism that is independent of other elements in the body of the
mRNA.
Destabilization caused by nonsense codons within the main reading frame
is dependent on a number of gene products encoded by the UPF
genes. We therefore investigated the influence of the UPF1
gene product on the uORF-dependent changes in stability. Comparison of the stabilities of the uORF-containing mRNAs in the
presence or absence of a functional UPF1 gene in otherwise isogenic strains revealed at least a partial dependence on this gene
(Table II). This contrasted with the results obtained with the
PGK1
reading frame preceded by a leader containing a
poly(G) sequence; in this case, UPF1 had no effect on the
half-life.
-UTR
In this paper we have analyzed how events on the 5
-UTR
normally associated with the regulation of eukaryotic translation can
also exert modulatory effects on gene expression by influencing mRNA decay. Our data therefore reflect cellular regulatory
mechanisms operating at the post-transcriptional level. These
principles could only be recognized using an experimental strategy that
compares alternative modes of translational control, taking into
account the important observation that the influence of translation on the fate of different mRNAs can be a function of their internal structure. Three of the inhibitory strategies used in our experiments, i.e. those involving the implementation of hairpin-loops,
poly(G), or the IRE-IRP interaction in the 5
-UTR, block access of
ribosomes to the start codon via mRNA-specific mechanisms. The
poly(G) element used in this work was positioned 15 nucleotides from
the cap and therefore interferes with scanning on the 5
-UTR (compare
Ref. 50). This is also likely to be the main effect of stem-loops, especially when these are not situated close to the cap (Fig. 9B). It is as yet unclear whether a stem-loop
structure at a cap-proximal site (as in B3) can significantly inhibit
the initial interactions of the yeast 40 S subunit with the mRNA
which precede scanning (66). On the other hand, in vitro
experiments have indicated that the IRP-IRE interaction directly or
indirectly blocks this early docking interaction (Fig. 9C
and Ref. 67). Despite the differences in their modes of action, all
three inhibitory mechanisms destabilize PGK1
mRNA and
seem likely to achieve this destabilization by virtue of their
influence on events in the 5
-UTR involved in the translational
initiation pathway. An indirect analysis of the quantitative
relationship between translation and mRNA stability demonstrates a
negative correlation between translation rate and PGK1
mRNA decay rate, whereby the activity of the PGK1 destabilization mechanism can be varied over a wide range, apparently as a continuous function of the translation rate (Fig.
10).
There are several possible mechanisms of
post-transcriptional control mediated by the 5
-UTR in the eukaryotic
cell. The schematic representation of eukaryotic translation
illustrates that there are a number of alternative steps at which
control can be imposed (panel A). The present work focuses
on modulatory effects involving translational initiation and
termination. Structural elements (a hairpin loop or poly(G)) in the
5
-UTR are most likely to interfere with the overall rate
(k2) of the scanning process (panel
B). In contrast, binding of IRP to an IRE located near the 5
end
interferes with an earlier step (k1, panel
C; compare Ref. 67). In the extreme case of 100% inhibition, this
could theoretically result in loss of at least all ribosomal subunits involved in active translation of the mRNA. Modulation of translation via eIF-4E would not be expected to interfere
directly with any of the individual steps of translation indicated but
rather to limit the availability of preinitiation complexes containing
the 40 S subunit (panel D). Other studies have shown that
the eIF-4E mutants allow accumulation of translationally inactive 80 S
pairs, thus reducing the pool of active subunits available for
initiation. Functional interactions between the 5
-UTR and the body of
the mRNA determine the influence of structures in the 5
-UTR on
mRNA stability. None of the inhibitory mechanisms is likely to
affect the rate of elongation (k4). In contrast,
the disruptive effects of an uORF in the 5
-UTR act via an independent
pathway that involves the products of the UPF genes. The
destabilizing effect of an uORF is dependent on the termination event
(k5, k6) and not
determined by reinitiation downstream of the stop codon (panel
E). On the other hand, ribosomal subunits that resume scanning
(k7) might contribute to the maintenance of
structure and function typical of normal polysomes. This model predicts
that the degree of destabilization associated with a stop codon will be
linked to the efficiency of termination and/or ribosomal release
directed by it. The effect of premature termination within the 5
-UTR
will be redirection of the mRNA to the Upfp-dependent
decay pathway (panel F). This will involve rapid decapping
of at least some mRNAs (compare Ref. 74), whereas the kinetics of
deadenylation will be a function of the nature of the mRNA. 5
3
exonucleolytic activity will degrade the mRNA further, including
fragments generated by endonucleolytic cleavage.
at the 5
end
represents the cap.
-UTR which result in translational inhibition. The
same four 5
-UTRs were inserted in front of the PGK1 and
LUC main reading frames. This enabled us to compare the effects of IRP-IRE interactions on translational initiation
(panel B, estimated on the basis of luciferase activity) and
on decay of the PGK1 mRNA (panel A). The IRE
itself exerts a small inhibitory effect on translational initiation in
yeast which already suffices to destabilize the PGK1
mRNA partially in the absence of IRP (IREwtLUC). IRP has been
estimated to have an approximately 100-fold lower affinity for the
C
IRE stem-loop than for the wild-type IRE sequence (52), but in yeast
this suffices to allow inhibition of translation by approximately 10%
(IRE
CLUC+IRP).
At first sight, the mechanism of translational inhibition responsible
for IRP-IRE-mediated repression seems closely related to that imposed
by the cdc33 mutations. Both are thought to interfere, directly or indirectly, with the earliest stage of ribosome-mRNA interaction. Yet translational modulation via eIF-4E hardly influences mRNA stability, thus showing that regulation via this factor
bypasses the normal translation dependence of key stability
determinants. Sucrose gradient analysis of polysomes in the
cdc33 mutant strains has revealed a marked shift toward
monosomes. In particular, the reduced eIF-4E activity in these strains
allows accumulation of nontranslating 80 S pairs (Ref. 39 and Fig.
9D). Binding of IRP to an IRE in the 5
-UTR of an mRNA
in yeast, on the other hand, results in a redistribution of the target
mRNA toward monomeric 40 S and 60 S subunits (Figs. 5 and
9C). Given that IRP is a cytoplasmic repressor, it is
evident that cytoplasmic blocking of the 5
-UTR suffices to trigger the
observed changes in mRNA stability. By analogy, secondary
structures in the 5
-UTR are also likely to modulate
post-transcriptional gene expression via their influence on
cytoplasmic, rather than nuclear, events. eIF-4E may be one of the
first cytoplasmic proteins to interact with mRNA in a eukaryotic cell. Indeed, the fact that this protein may be partially nuclear (57,
68) may even allow it to interact with mRNA before the latter is
exported from the nucleus (69). Most importantly, reductions in eIF-4E
activity will influence the frequency of ribosomal binding to the
5
end of the mRNA without interfering with the progress of the
40 S subunit along the leader. In contrast, the common denominator of
the inhibitory elements in the 5
-UTR is the disruption of the normal
function of this region, which will be accompanied by restructuring of
the mRNP-ribosome complex.
Although the mechanisms underlying the differences in response of the
overall decay rate to interference with ribosomal scanning are not the
main theme of this study, we suggest that they relate to the respective
degradation pathways of the individual mRNAs. As illustrated by the
comparison of a stem-loop and a poly(G) element as stabilizers for the
LUC mRNA, this mRNA is highly sensitive to the
introduction of structures into the 5
-UTR known to attenuate 5
3
exonucleolytic degradation (26, 51). Since these elements do not
trigger destabilization events in the LUC mRNA of the
type reported for the PGK1 mRNA, stabilization via the
blockage of exonucleolytic activity is the dominant observable effect.
Degradation of the cat mRNA, on the other hand, remains
unaffected because rate control on the decay pathway is determined by a
step involving the main ORF. This could, for example, take the form of
an endonucleolytic cleavage process within the reading frame (28), as
has been proposed for decay of the cat mRNA in E. coli (70). This suggests that there are
translation-dependent destabilization elements in the
PGK1 mRNA which are not present in the cat or
LUC mRNAs.
Why should the destabilization induced by an uORF be capable of
affecting all mRNAs, irrespective of the differences seen in their
respective responses to the presence of upstream inhibitory structural
elements? We propose that it is the termination process that causes the
common destabilization response (Fig. 9E). As we have shown,
increasing the efficiency of recognition of the uORF start codon
results in more marked upf1-dependent
destabilization. However, since previous work with this uORF-bearing
leader revealed that blocking subsequent (re-)initiation (Fig.
9E) using a stem-loop structure does not prevent
destabilization (25), it is evidently the release of terminating
ribosomal subunits which triggers the nonsense-dependent
decay process. Thus changing the efficiency of uORF recognition will
influence the termination rate on the 5
-UTR and thereby modulate
mRNA decay. The termination of translation by 80 S ribosomes
changes the fate of the affected mRNAs, redirecting them into a
decay pathway involving the UPF gene products (Fig. 9F). This is probably the same pathway that is followed by
aberrant mRNAs whose translation is terminated by nonsense codons
in the first two-thirds of the reading frame (23).
The mRNAs we have so far found to be destabilized by a short uORF
in yeast are PGK1, cat, and LUC. Both
synthetic and natural uORF-containing leaders induce this form of
destabilization. Yun and Sherman (71) found that the CYC1
mRNA is also less stable in the presence of an uORF, which
indicates that this mRNA is also destabilized by the same
mechanism. The demonstration that uORFs can strongly influence mRNA
stability reveals a new dimension to the role of the 5
-UTR in
post-transcriptional control. Fine regulation of both the translation
and the stability of any given mRNA should be possible via
manipulation of the properties of individual uORFs. Yet a number of
known 5
-UTRs contain more than one uORF. The most intensively studied
example is that of the yeast gene GCN4 (62). This 5
-UTR
manifests no obvious destabilizing function (25), and the stability of
the GCN4 mRNA is not affected by inactivation of
UPF1 (23). This lack of destabilization is likely to be due
to specific properties of the GCN4 leader. The first uORF in
this 5
-UTR directs only inefficient release of terminating ribosomes
(62, 72), meaning that the downstream regions are amply populated by
scanning ribosomes (compare Fig. 9). On the other hand, a
GCN4-PGK1 hybrid mRNA can be destabilized by introducing
a destabilizing element derived from PGK1 downstream of
uORF1 in the GCN4 5
-UTR (73). Finally, our work highlights a new feature of nonsense-dependent destabilization,
showing that it is not merely responsible for ridding the cell of
mRNAs that have been incorrectly spliced or whose translation is
prematurely terminated by nonsense codons. It also provides a mechanism
for the post-transcriptional control of nonaberrant mRNAs. The
degree to which this second type of destabilization mechanism
influences the decay of an uORF-bearing mRNA depends on the
efficiencies of initiation and termination (ribosomal release) on the
uORF.
To whom correspondence should be addressed: Dept. of Biomolecular
Sciences, UMIST, P.O. Box 88, Manchester M60 1QD, U. K. Fax:
44-161-200-8918.
We thank Dr. Peter Müller and Birep Aygün-Yücel for helpful discussions, Dr. Carla Oliveira for providing the IRP/IRE constructs, Dr. Peter Müller for the strain YPM156B, Dr. Marina Ptushkina for the strains JMC1 and JMC2, and Dr. Stuart Peltz for the SWP154 strains. We are also grateful to Astrid Hans for synthesizing the oligodeoxyribonucleotides, and to Antje Scholz for assistance with some of the figures.