![]()
|
|
||||||||
(Received for publication, November 22, 1996)
From the The 33-kDa matrix protein BM-40 (SPARC,
osteonectin) consists of an acidic N-terminal domain I, a central
cysteine-rich follistatin-like module, and a C-terminal extracellular
calcium-binding (EC) module. Previous studies attributed collagen IV
and high affinity calcium binding of BM-40 to its EC module, which was
shown by x-ray crystallography to consist of an EF-hand pair surrounded
by several The small calcium-binding glycoprotein (33 kDa) referred to as
BM-40, SPARC, or osteonectin has been shown to have a widespread occurrence in extracellular matrices of various organs with a particularly high expression found during morphogenesis, tissue remodeling, and repair. The protein exhibits anti-adhesive properties in cell culture and modulates the expression of certain extracellular receptors. Several extracellular ligands have been identified for BM-40
including some collagen types and cytokines (1). This indicated various
binding sites on BM-40 in agreement with a previous proposal of a
mosaic structure for the protein (2). The most recent interpretation of
the domain structure based on recombinant deletion mutants and a
crystal structure of a fragment encompassing the C-terminal 150 residues (3, 4) demonstrated an acidic and flexible N-terminal domain I
(~50 residues) followed by a follistatin-like
(FS)1 module (~75 residues) and a novel
extracellular calcium-binding (EC) module (~150 residues). X-ray
crystallography of this EC module demonstrated two opposing
calcium-binding EF hands, as found in many intracellular proteins (5),
which were in close contact to an extended The binding of BM-40 to the fibril-forming collagens I, III, and V and
basement membrane collagen IV has been demonstrated and depended on
moderate calcium concentrations indicating the involvement of the EC
module (6-11). This conclusion was supported by studies with collagen
IV and proteolytic fragments and deletion mutants of BM-40 (3, 9, 12).
However, further factors may modulate collagen affinities as indicated
in studies with BM-40 obtained from human bone and platelets which
differed considerably in their binding to collagen V and in their
N-linked oligosaccharides being either of the mannose-rich
or complex type (11). This indicated involvement in collagen V binding
of the FS module containing these sites as also shown by
deglycosylation achieved either enzymatically or by mutation (13). This
study also provided evidence that the N-terminal domain I and/or the FS
module are essential for binding which was subsequently restricted to
an N-terminal 17-residue segment in a synthetic and recombinant
analysis (14). The controversial nature of these data could still be
attributed to the different collagen types used in the binding
analyses. A 15-fold affinity difference was noticed in surface plasmon
resonance binding assays between recombinant human BM-40 and
tissue-derived mouse BM-40 regardless whether human or mouse collagen
IV was used as a ligand (3). Since no evidence could be obtained for
conformational or glycosylation differences between both preparations
of BM-40 (3, 10), the possibility remained that a substantial
endogenous proteolytic cleavage in the EC module of mouse BM-40 (15)
could be responsible for this effect.
The controversial issue of collagen binding was addressed in the
present study by two types of experiments. First, we could demonstrate
similar equilibrium dissociation constants for the binding of human
BM-40 or its EC module to collagens I, III, IV, and V supporting the
interpretation of a single collagen binding site. Furthermore, cleavage
of BM-40 by several matrix metalloproteinases mimicked the endogenously
observed cleavage of mouse BM-40 and was accompanied by a comparable
increase in collagen affinity. This was of particular interest since
BM-40 has been shown to increase the production of stromelysin,
collagenase, and gelatinase in cell culture (16) suggesting a positive
feedback loop. The structural data of the EC module (4) may now in
addition allow us to map the collagen binding site of BM-40 by
site-directed mutagenesis.
The
production and purification of recombinant human BM-40 (10) and the
deletion mutants Human BM-40
cDNA encoding mutant Protein samples were dissolved in
0.05 M Tris-HCl, pH 7.4, 0.15 M NaCl, 2 mM CaCl2 and digested at 37 °C at different
enzyme-substrate ratios (1:10, 1:50, or 1:100) for 5 or 24 h. The
reactions were stopped by adding EDTA to a final concentration of 4 mM. The cleavage was then examined by SDS-gel
electrophoresis in 10-20% polyacrylamide gradient gels under
nonreducing and reducing conditions. Subsequently sufficient
CaCl2 was added to yield a surplus of 2 mM
CaCl2 for the measurements by surface plasmon resonance
assay.
Surface plasmon resonance
binding studies (26) were performed with BIAcore instrumentation
(BIAcore AB). Collagens were coupled covalently via amine coupling to
sensor chips CM5 (Pharmacia Biosensor). After activation of the
carboxymethylated dextran layer by addition of 35 µl of a mixture of
0.05 M N-hydroxysuccinimide and 0.2 M
N-ethyl-N Digested and undigested EC
modules were dialyzed against 5 mM Tris-HCl, pH 7.4. Protein concentrations were calculated from the absorption at 280 nm as
described (12). CD spectra in the far UV region were recorded at
25 °C on an JASCO 715 CD spectropolarimeter in a thermostatted
quartz cell of 1-mm optical pathlength. Spectra were measured after
adding 2 mM CaCl2 and after subsequent addition of 6 mM EDTA. Molar ellipticities [ Protein samples were hydrolyzed (16 h at
110 °C) with either 6 or 3 M HCl to determine protein or
hexosamine concentrations, respectively, on a LC3000 analyzer
(Biotronik). Protease digests were separated by electrophoresis and
electroblotted onto Immobilon PSQ membranes (Millipore). N-terminal
sequences of individual bands were then determined by 8-12 Edman
cycles on 473 A or Procise sequencers (Applied Biosystems) following
the manufacturer's instructions.
Previous collagen binding studies have all been carried out
in solid phase assays using either radioactive labeling or specific antibodies for the detection of binding (6-14). Since such assays are
difficult to evaluate in quantitative terms, we have recently used a
surface plasmon resonance assay to demonstrate a moderate binding
activity of recombinant human BM-40 (Kd about 3 µM) and of the BM-40 deletion mutant
Surface plasmon resonance assay of the binding of BM-40 and its mutant
Collagens were immobilized at the sensor chips, and soluble BM-40
ligands were used at 10-30 µM. Several values are
expressed as mean ± S.D. of 3-4 independent determinations.
Other values are based on single measurements.
Effect of N-glycosylation of BM-40 on collagen binding using the
mutant Binding was determined by surface plasmon resonance assay with
immobilized human collagens. Soluble ligands were used at a concentration of 10 µM. Stromelysin-1, matrilysin, gelatinase A and B,
and collagenase-1 and -3 were used to examine the possibility that
limited tissue proteolysis could enhance collagen affinity of BM-40.
Exposure of BM-40 in calcium-saturated form to these proteases at the
usual enzyme-substrate ratio of 1:100 for 24 h showed remarkably
little cleavage when examined by electrophoresis under nonreducing or reducing conditions (not shown). After a 10-fold increase in the amounts of proteases, distinct cleavage patterns were observed by
electrophoresis for five of the matrix metalloproteinases but not for
collagenase-1. Analysis under nonreducing conditions revealed a shift
of the BM-40 band to various extents to one or two bands of slightly
higher mobility (Fig. 1A). Cleavage became
more distinct after reduction (Fig. 1B) which showed one to
three prominent bands with migration positions corresponding to 28-38
kDa as compared with 40 kDa for intact BM-40. This demonstrated rather
complete conversion of BM-40 by stromelysin-1, matrilysin, and
collagenase-3, whereas substantial amounts of uncleaved BM-40 were
still present in the digests with both gelatinases. Most prominent was,
however, the presence of a distinct uniform band of about 10 kDa in
these digests indicating its release from a large disulfide-bonded
loop.
The nature of the various cleavage products was examined after
reduction and electroblotting by Edman degradation (Fig.
2). This demonstrated for all the larger fragments
cleavage within the N-terminal domain I (N-terminal residues at
positions 21, 31, 33, or 38). A few fragments, however, retained the
original N terminus of recombinant BM-40 (APQQEA) indicating that they are generated by an exclusive C-terminal fragmentation. This postulated C-terminal fragment could be identified as the common 10-kDa band which
started at position 198. A further C-terminal fragment (about 5 kDa)
started at position 238 but was a faint band by electrophoresis indicating a very minor cleavage site in BM-40. Both of these cleavage
sites are located within a large disulfide-bonded loop of the EC module
bordered by Cys-138 and Cys-248 (9, 15), indicating from the size of
both small fragments that they extend to the C-terminal end of BM-40
(Ile-286). Together the data demonstrate two routes of BM-40
degradation through a limited number of scissile peptide bonds in the
N- and C-terminal region. Collagenase-3 executed both cleavages in
rather equivalent fashion, whereas matrilysin and stromelysin-1 in
increasing order preferred the N-terminal route. The gelatinases showed
a preference for C-terminal cleavage that was less efficient with
gelatinase B leaving substantial amounts of uncleaved BM-40.
Because of the limited complexity of cleavage patterns we used the
C-terminal EC module (mutant
Since cleavage in the EC module could interfere with calcium binding to
its EF hand pair and thus influence
Digests of
BM-40 obtained with matrilysin, stromelysin-1, gelatinase A, or
collagenase-3, all of them with only little intact protein left (Fig.
2), were examined in surface plasmon resonance assay for their binding
to collagen IV (Table II). This demonstrated Kd values in the range of 0.1-0.3 µM
and thus a 7-20-fold increase in affinity over BM-40. Similarly low
Kd values were previously obtained for collagen IV
binding of tissue-derived mouse BM-40 which was also modified in a
limited fashion by endogenous proteolysis (3, 15). An increase in the
association rate constant was in all these cases mainly responsible for
the enhanced binding activity.
Change in affinity of collagen IV binding of human BM 40 after cleavage
with matrix metalloproteinases
Binding was determined by surface plasmon resonance assay with mouse
collagen IV immobilized at the sensor chip. Soluble ligands were BM-40
(6 µM) and the respective digests (2 µM).
Volume 272, Number 14,
Issue of April 4, 1997
pp. 9237-9243
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
,
,
,
,
and
**
Max-Planck-Institut für Biochemie,
Strangeways Research Laboratory,
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
-helical and loop segments. This module was now shown by
surface plasmon resonance assay to bind with similar affinities to
collagens I, III, and V. Cleavage of recombinant BM-40 and its EC
module by collagenase-3, gelatinases A and B, matrilysin, and
stromelysin-1 showed similar fragment patterns, whereas collagenase-1
was inactive. Some differences were, however, observed in cleavage
rates and the preference of certain cleavage sites. Edman degradation
of fragments demonstrated only three to four major cleavage sites in
the central region of domain I and a single uniform cleavage in helix C
of the EC module. Cleavage is accompanied by a 7-20-fold increase in
binding activity for collagens I, IV, and V but revealed only small
effects on calcium-dependent
-helical changes in the EC
module. The data were interpreted to indicate that helix C cleavage is
mainly responsible for enhancing collagen affinity by exposing the
underlying helix A of the EC module. A similar activation may also
occur in situ as indicated previously for tissue-derived
BM-40.
helix (4). A combination
of adjacent FS and EC modules has been detected in the cDNA
sequences of several more extracellular proteins suggesting the
existence of a protein family (1, 3, 4). Yet it is not known so far
whether they are functionally related to BM-40.
Sources of Extracellular Matrix Ligands and Proteases
I and
I, II (3) have been described. Collagens
I, III, and V were solubilized from human placenta by pepsin and
separated from each other by fractional NaCl precipitation (17).
Collagen V was further purified by chromatography on a Mono-Q column
(18). Collagen IV tetramers that lack the globular NC1 domain were also
isolated from a pepsin digest of human placenta (19). Previously
described procedures were followed for the recombinant production,
purification, and activation of matrix metalloproteinases (MMP)
including collagenase-1 (MMP-1) (20), collagenase-3 (MMP-13) (21),
gelatinase A (MMP-2) (22), gelatinase B (MMP-9) (23), stromelysin-1
(MMP-3), and matrilysin (MMP-7) (24).
I (3) in the pBluescript II SK
vector
(Stratagene) was used to generate two overlapping subfragments by
polymerase chain reaction with Vent polymerase (New England Biolabs) to
introduce an N99Q mutation following a previously described strategy
(25). The 5
-fragment was generated by polymerase chain reaction using
primer 1 GATCGCTAGCAAATCCCTGCCAGAAC and primer 2 CGAAGGTCTTcTgGTCATTGC
and the 3
-fragment was generated using primer 3 GCAATGACcAgAAGACCTTCG
and primer 4 GTCAGAATTCGGTCAGCTCAGAGTC (in primers 2 and 3, lowercase
letters show mutated sequences). About 100 ng of each agarose
gel-purified fragment were mixed, denatured, annealed, and initially
extended without primers followed by polymerase chain reaction
amplification with primers 1 and 4. The product was restricted with
NheI and EcoRI and inserted into the vector
described above. The insert was then restricted with NheI
and XhoI and cloned into the episomal expression vector pCEP-Sh (25) that contained the puromycin instead of the phleomycin resistance gene.2 The correctness of the
insert was verified by DNA cycle sequencing. Transfection of human
EBNA-293 cells (Invitrogen) and purification of the recombinant mutant
followed established protocols (3, 25).
-(3-dimethylaminopropyl)carbodiimide
at a flow rate of 5 µl/min, 60 µl of collagen solution in 0.5 M sodium acetate, pH 4.0, at a concentration of 200 µg/ml
was added. Residual activated carboxylic groups of the chip were
saturated by reaction with 35 µl of 1 M ethanolamine,
adjusted to pH 8.5. These immobilization reactions resulted in
6,000-12,000 resonance units, equivalent to about 6-12
ng/mm2 of immobilized protein on the surface of the chip.
Binding assays were performed in neutral buffer containing 2 mM CaCl2 and 0.05% P20 surfactant, at a flow
rate of 20 µl/min. As soluble ligands 10 µM solutions
of proteins were applied resulting in signals of 30-650 resonance
units. Kinetic rate constants were calculated from the binding and the
dissociation curves by BIAevaluation software version 2.1 supplied by
the manufacturer.
] (expressed in
degrees cm2 dmol
1) were calculated on the
basis of a mean residue molecular mass of 110 Da.
Binding of BM-40 and Its EC Module to Different Collagen
Types
I, II, which
corresponds to its EC module, to collagen IV (3). The same procedure
and ligands were now used for a comparative binding analysis including the fibrillar collagen types I, III, and V as immobilized ligands (Table I). This demonstrated similar affinities of BM-40
(Kd about 2-3 µM) for the collagens
except for a small decrease for collagen III (Kd = 6.6 µM). Several independent assays with collagens IV and
V demonstrated that the error range of single measurements was not
larger than ±50% (Table I) indicating a sufficient reproducibility of
the assay. All four collagens also bound the BM-40 mutant
I, II,
either with unchanged affinity, as for collagen III, or with a 5-fold
reduced affinity (Table I). The lower affinities could be accounted for
by a distinct increase in the dissociation rate constants which was
only in part compensated by a smaller increase in the association
rates. Further binding tests were performed with BM-40 mutant
I
which consists of both the FS and EC module. This mutant showed either the same or a slightly reduced affinity to collagens I, IV, and V when
compared with BM-40 and a significantly stronger affinity than mutant
I, II (cf. Tables I and IV).
I, II to different human collagen types
Immobilized
ligand
BM-40
BM-40
I, II
kd
ka
Kd
kd
ka
Kd
s
1M
1
s
1µM
s
1M
1
s
1µM
Collagen
I
2.4
× 10
3840
2.8
1.6
× 10
21100
14
Collagen III
2.5
× 10
3380
6.7
0.79
× 10
21200
6.6
Collagen IV
0.6 ± 0.3
× 10
3300 ± 120
2.0 ± 1.0
1.7
± 0.3 × 10
21250 ± 560
13.6 ± 4.4
Collagen V
1.8 ± 0.8 × 10
3690
± 310
2.6 ± 1.3
0.69 ± 0.31
× 10
2580 ± 40
11.9 ± 4.7
I N99Q
Soluble
ligand
Immobilized
ligand
kd
ka
Kd
s
1M
1
s
1µM
BM-40
ICollagen IV
0.74
× 10
21250
5.9b
Collagen
I
0.28 × 10
21200
2.3
Collagen
V
0.84 × 10
23200
2.6
Digesta
Collagen IV
0.14
× 10
22100
0.67
Mutant
I
N99QCollagen IV
0.49 × 10
21100
4.5
Collagen I
0.50 × 10
2590
8.5
Collagen V
1.12 × 10
2541
21
a
Digest of BM-40
I with collagenase-3.
b
A value of 0.6 µM was determined in a previous
study (3) but subsequently found to be erroneous due to a mistake in
the software used for calculations. Proper analysis of the previous data showed now Kd = 6.3 µM in
agreement with the data shown above.
Fig. 1.
SDS-gel electrophoresis of matrix
metalloproteinase digests of BM-40 under nonreducing (A)
and reducing conditions (B). Lanes were loaded with
undigested BM-40 (lane 1) or digests prepared with
collagenase-3 (lane 2), gelatinase A (lane 3),
gelatinase B (lane 4), matrilysin (lane 5),
collagenase-1 (lane 6), and stromelysin-1 (lane
7). The digests were obtained at an enzyme/substrate ratio of 1:10
at 37 °C for 24 h except for matrilysin (5 h). Migration positions of calibrating proteins are denoted on the left
margin (in kDa).
[View Larger Version of this Image (37K GIF file)]
Fig. 2.
Correlation of the reduced electrophoretic
band patterns of BM-40 digests (A) with their N-terminal
sequences (B) determined after electroblotting.
A, lanes were loaded with digests prepared with
collagenase-3 (lane 1), gelatinase A (lane 2),
gelatinase B (lane 3), matrilysin (lane 4), or
stromelysin-1 (lane 5) which were prepared as in Fig. 1.
Numbers to the right of each band refer to the
novel N-terminal sequence positions with N denoting the N
terminus of recombinant BM-40 (APQQEA). The slowest migrating bands in
each digest except in lane 1 correspond to undigested BM-40.
Migration positions of calibrating proteins are denoted on the
left margin (in kDa). B, partial sequences of
BM-40 showing the major cleavage sites in domain I (positions 18-42)
and the EC module (positions 196-205 and 236-245). Cleaved peptide
bonds are identified by arrowheads and the position number
of the novel N terminus. Each sequence was determined by 8-12 Edman
degradation cycles.
[View Larger Version of this Image (29K GIF file)]
I, II) for further studies with
stromelysin-1, gelatinase A, and collagenase-3. Electrophoresis patterns under nonreducing conditions demonstrated the appearance of a
novel band of slightly reduced mobility that showed the original N-terminal sequence of mutant
I, II and that starting at position 198 as found for the 10-kDa fragment indicating a single cleavage (band a, Fig. 3A). Unfolding of a
compact EC module structure (4) by SDS may explain the reduction in
mobility. A second prominent component of some faster electrophoretic
mobility (band b, Fig. 3A) was particularly
prominent in the collagenase-3 and gelatinase A digests and showed the
N-terminal and an internal sequence (position 238) indicating the
release of a fragment comprising positions 198-237. Both digests
contained in addition a few faster but weak bands that were not
identified. The fragment pattern became more uniform after reduction
showing variable amounts of uncleaved material, a double band at 8-10
kDa (band c, Fig. 3B), and a weaker band of about
5 kDa (band d, Fig. 3B). The double band showed
in equal proportions two sequences starting at the N terminus and
position 198 and the 5-kDa band mainly the sequence starting at
position 238. Compared with BM-40 (Fig. 2) the same two peptide bonds
were obviously also cleaved in mutant
I, II but with higher
efficiency.
Fig. 3.
SDS-gel electrophoresis of matrix
metalloproteinase digests of BM-40 mutant
I, II under nonreducing
(A) and reducing conditions (B) and correlation
with cleaved peptide bonds. Lanes were loaded with undigested
I, II (lane 1) and with digests prepared with
stromelysin-1 (lane 2), collagenase-3 (lane 3),
or gelatinase A (lane 4) at an enzyme/substrate ratio of
1:50 (37 °C, 24 h). Migration positions of calibrating proteins
are denoted on the left margin (in kDa). Bands subjected to
Edman degradation are marked by a-d at the
right margin. Sequences determined for the nonreduced
gelatinase A digest corresponded to the N terminus of
I, II and
position 198 (band a) or to the N terminus and position 238 (band b). Sequences determined for the reduced collagenase-3 and gelatinase A digests corresponded to the N terminus and position 198 (double band c) or mainly to position 238 (band
d). See Fig. 2 for explanation of sequence positions.
[View Larger Version of this Image (26K GIF file)]
-helical conformation (3, 12),
we compared mutant
I, II and the three proteolytic digests by CD
spectroscopy (Fig. 4). This demonstrated for all samples
a typical and similar
-helical spectrum when examined in the
presence of 2 mM CaCl2. The
-helical
content, as judged from the ellipticity at 222 nm, of the undigested
and stromelysin-treated samples was about the same and was slightly
reduced after digestion with gelatinase A or collagenase-3.
Furthermore, the addition of an excess of EDTA caused a similar,
reversible reduction in
-helicity (44-48%) in all samples (Fig.
4). This indicated that the overall structure of the EC module as well
as the affinity for calcium were maintained after cleavage.
Fig. 4.
Conformational analysis of the BM-40 EC
module after proteolytic cleavage by CD spectroscopy. The spectra
are shown for undigested mutant
I, II (A) and after
digestion with stromelysin-1 (B), gelatinase A
(C), or collagenase-3 (D). Spectra were recorded in buffer containing either 2 mM CaCl2 or 6 M EDTA. Arrows indicate the decrease in
ellipticity upon calcium binding.
[View Larger Version of this Image (13K GIF file)]
Treatment of
BM-40
kd
ka
Kd
s
1M
1
s
1µM
None
0.54
× 10
3220
2.5
Matrilysin
2.8
× 10
39.300
0.31
Stromelysin-1
1.5
× 10
35.200
0.29
Gelatinase A
4.7
× 10
31.600
0.29
Collagenase-3
1.6
× 10
316.000
0.10
Similar binding studies including in addition collagen I and V as
ligands were performed with the three matrix metalloproteinase digests
of mutant
I, II shown in Fig. 3. This demonstrated a distinct
increase in collagen IV affinity to about the same extent as found for
BM-40 digests (Table III). A similar activation for collagen I and V binding was, however, only found after treatment with
stromelysin-1 or collagenase-3 but not with gelatinase A even though
the latter two digests appeared similar by electrophoresis and sequence
analysis (Fig. 3). It could indicate some differences at C-terminal
regions which we would not detect by these analyses.
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Previous
studies have shown that BM-40 (osteonectin) binding to collagen V can
be modulated by the nature and extent of N-glycosylation of
the single amide-acceptor site present in the FS module of BM-40 (11,
13). For a comparison to the proteolytic activation described here, we
used BM-40 mutant
I that consisted of the FS module and the collagen
binding EC module. Collagenase-3 treatment of
I produced a limited
set of fragments including a 10-kDa component starting at position 198 (data not shown) and caused a 10-fold increase in binding to collagen
IV (Table IV). Mutant
I was therefore used to
introduce a single N99Q mutation previously shown to prevent N-glycosylation (13). The purified mutant
I-N99Q was
slightly faster in electrophoretic mobility than
I, and its
glucosamine content was reduced from 4.1 residues to less than 0.5 residues consistent with the lack of N-glycosylation. The
I-N99Q mutant showed only an insignificant change in the binding to
collagen I and IV and an ~8-fold loss in its affinity for collagen V
(Table IV). A similar mutation in another BM-40 fragment was previously shown to enhance binding to collagen V (13).
Application of a surface plasmon resonance assay demonstrated a remarkably similar affinity of BM-40 for four different collagen types including several that form larger interstitial fibrils (I, III, and V) or networks in basement membranes (IV). Some larger variability was reported in previous solid phase assays (8, 9) which may be due to differences in coating efficiencies or the detection systems used. Binding was localized to the C-terminal EC module of BM-40 consistent with previous evidence that calcium depletion as well as large deletions in the EC module abolish collagen IV binding (9, 10, 12). The involvement of the same module as well as similarities in the proteolytic enhancement of binding suggests a single collagen binding site for BM-40 that may be represented by a single or several overlapping epitopes. The collagens used in the present study were obtained by solubilization with pepsin which strongly indicates that their BM-40 binding epitopes reside in their triple helical domains. Their number is unknown except for some electron microscopic evidence suggesting two sites along the triple helix of collagen IV (9).
Enhancement of collagen binding by roughly an order of magnitude could be observed following cleavage with several matrix metalloproteinases of either full-length BM-40 or the EC module. This effect can very likely be attributed to cleavage of a single peptide bond, 197-198. Cleavage at this position is not accompanied by large changes in conformation and its calcium-induced change, indicating only minor structural rearrangements in the nicked protein. Similar small changes result from cleavage at position 237-238 in the isolated EC module. This peptide bond is largely protected in full-length BM-40, most likely by interactions with the adjacent FS module, and its cleavage may not have any biological significance.
The recent elucidation of the EC module structure (4) allows us to speculate on the structural consequences of proteolytic cleavage at position 197-198. The central feature of the EC module structure is a pair of EF-hands interacting intimately with a long amphiphilic helix A. The connection between these two substructures is provided by several loops and helices B and C. The crucial cleavage site 197-198 is located at the N terminus of the latter helix, and both residues 197 and 198 are exposed to solvent in the EC module structure. Matrix metalloproteinases are believed to bind their substrates in an extended conformation (27), and some structural rearrangement of helix C and the preceding loop is presumably required for proteolysis.
It has been noted that the loop connecting helices B and C makes only
weak contacts with the body of the EC module structure (4). Cleavage
within the first turn of helix C is therefore likely to result in an
increased exposure of the hydrophilic residues on helix A opposite the
EF-hand pair. This would in particular expose residues Glu-145,
Arg-149, and Asp-152, whose side chains are partly (60-80%) buried by
the B-C loop and helix C in the intact EC module. Fig. 5
shows that these three residues, together with Glu-142, form a highly
charged and very shallow groove bordered on one side by the B-C loop.
We speculate that this is part of the collagen binding epitope. This
proposal, which can now be tested by site-directed mutagenesis, is
consistent with the observation that enhanced binding in the nicked
protein is mainly due to an increase in the association rate constants,
indicating the removal of steric constraints. Of course, the collagen
binding site must already be substantially accessible in BM-40, as
collagens do bind to the intact protein. We have previously shown that
deletion of helices A to C strongly reduces the affinity of BM-40 for
both calcium and collagen IV (12). Although this observation is
consistent with the above proposal for the collagen binding site, the
drastic consequences of such a large deletion preclude a simple
structural interpretation, and more subtle deletions and/or alterations
will be required in future mapping studies.
trace. In this view, the N-terminal
helix A runs horizontally from left to right; the
loop connecting helices B and C and the EF-hand pair are
above and below helix A, respectively. The
scissile bond for matrix metalloproteinase (MMP) cleavage,
197-198, is indicated, as are the positions of four charged residues
proposed to contribute to the collagen binding epitope (see text).
Produced with GRASP (39).
Collagen V binding was also shown for a recombinant human BM-40 fragment lacking the EC module (13, 14). In these studies prevention of N-glycosylation by an N99Q mutation increased, and deletions in the N-terminal domain I abolished collagen V binding. As shown here the N99Q mutation had no effect or slightly decreased collagen binding when mediated through the EC module. Both sets of data are not necessarily in conflict and could indicate two collagen V binding sites in BM-40, one of which is located in domain I. For collagen IV, however, no evidence for a domain I binding site in BM-40 could be obtained in studies with proteolytic and recombinant fragments (3, 9, 12).
Our present study started in part from the observation (3) that tumor tissue-derived mouse BM-40 showed a 15-fold higher affinity for mouse and human collagen IV than recombinant human BM-40 which remained unexplained. Mouse BM-40 was, however, known to be cleaved at position 198/199 to a substantial degree presumably by endogenous proteolysis (15). This site is just one residue apart from the human BM-40 site sensitive to several matrix metalloproteinases described here. This would provide a sufficient explanation for this difference that was supported by recent studies showing identical binding activities of nondegraded recombinant mouse and human BM-40 for several collagen types.3 The small difference in the N-terminal ends could be explained by the further action of aminopeptidases or the involvement of other matrix metalloproteinases than used here since both human and mouse BM-40 show complete sequence identity in the region involved (28). Limited proteolysis of BM-40 accompanied by enhanced collagen affinity was also observed in calvarial cell culture (29, 30). Yet these data need also to be explored in the context of whether similar endogenous cleavages of BM-40 occur in normal tissues and thus resemble a physiological process. This would require antibodies specific for the cleavage site or at least for the cleaved 10-kDa fragment released by reduction which are not yet available.
The effect of limited BM-40 cleavage by matrix metalloproteinases on collagen affinity is also of interest in the context of a recent study (16) which showed up-regulation of stromelysin, gelatinase, and collagenase expression in fibroblasts by exogenously added BM-40. This process is apparently dependent on a complex cascade of interactions including a mediator secreted into the culture medium. This suggests an autocrine or paracrine way how BM-40 could regulate its affinity for collagens. The moderate affinity of BM-40 for collagens (Kd = 2-6 µM) and its limited increase after proteolysis (Kd = 0.1-0.3 µM) needs to be considered in relation to the concentrations of the ligands when present in the extracellular space. As discussed previously (3) the concentration of collagen IV in basement membranes is about 5 µM, which should be high enough for efficient binding of undegraded BM-40 if present in comparable amounts. Such concentrations are also very likely to exist for fibrillar collagens that are the most abundant proteins in vertebrates. Yet situations of lower BM-40 tissue concentrations could exist and become dependent on proteolytic activation for efficient binding. Of course, this also raises the question of the biological consequences for BM-40 binding to collagens which so far are not known. Possibilities could include a structural function or sequestration of BM-40 and the regulation of its cytokine binding and cell-modulating activities (1).
BM-40 was remarkably stable against several matrix metalloproteinases when compared with other extracellular substrates such as nidogen (31) and fibulin-2 (32), considering the limited number of peptide bonds cleaved and the high protease concentrations required to achieve this. Yet trypsin and leukocyte elastase caused a more extensive degradation particularly of the EC module (9), indicating that BM-40 conformation is not designed to prevent proteolysis. There was also the interesting aspect that most matrix metalloproteinases cleaved identical peptide bonds, particularly that in the EC module equated with collagen binding activation, which is an uncommon observation. Matrix metalloproteinases were for a long time considered to have mainly a catabolic function during tissue remodeling or to activate precursor forms of proteases and cytokines (33, 34). Other functions may include the exposure of cryptic integrin cell binding sites on collagen and fibronectin (35, 36) indicating a more versatile function as also proposed in the present study. More recent data (37, 38) demonstrated the existence of several membrane-type matrix metalloproteinases and other membrane-bound metalloproteinases connected to a disintegrin-like domain (ADAMS family of proteinases). They could be good candidates for examining the modulation of BM-40 in the context of its cellular activities (1).
We are grateful to the expert technical assistance of Vera van Delden and Albert Ries.
This article has been cited by other articles:
![]() |
C. Giudici, N. Raynal, H. Wiedemann, W. A. Cabral, J. C. Marini, R. Timpl, H. P. Bachinger, R. W. Farndale, T. Sasaki, and R. Tenni Mapping of SPARC/BM-40/Osteonectin-binding Sites on Fibrillar Collagens J. Biol. Chem., July 11, 2008; 283(28): 19551 - 19560. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Arnold, E. Mira, S. Muneer, G. Korpanty, A. W. Beck, S. E. Holloway, S. Manes, and R. A. Brekken Forced Expression of MMP9 Rescues the Loss of Angiogenesis and Abrogates Metastasis of Pancreatic Tumors Triggered by the Absence of Host SPARC Experimental Biology and Medicine, July 1, 2008; 233(7): 860 - 873. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Dean and C. M. Overall Proteomics Discovery of Metalloproteinase Substrates in the Cellular Context by iTRAQTM Labeling Reveals a Diverse MMP-2 Substrate Degradome Mol. Cell. Proteomics, April 1, 2007; 6(4): 611 - 623. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Xiao, H. Junfeng, L. Tianhong, W. Lu, C. Shulin, Z. Yu, L. Xiaohua, J. Weixia, Z. Sheng, G. Yanyun, et al. Cathepsin K in Adipocyte Differentiation and Its Potential Role in the Pathogenesis of Obesity J. Clin. Endocrinol. Metab., November 1, 2006; 91(11): 4520 - 4527. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. F. Rocnik, P. Liu, K. Sato, K. Walsh, and C. Vaziri The Novel SPARC Family Member SMOC-2 Potentiates Angiogenic Growth Factor Activity J. Biol. Chem., August 11, 2006; 281(32): 22855 - 22864. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. E. Van den Steen, I. Van Aelst, V. Hvidberg, H. Piccard, P. Fiten, C. Jacobsen, S. K. Moestrup, S. Fry, L. Royle, M. R. Wormald, et al. The Hemopexin and O-Glycosylated Domains Tune Gelatinase B/MMP-9 Bioavailability via Inhibition and Binding to Cargo Receptors J. Biol. Chem., July 7, 2006; 281(27): 18626 - 18637. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. E. Gruber, E. H. Sage, H. J. Norton, S. Funk, J. Ingram, and E. N. Hanley Jr. Targeted Deletion of the SPARC Gene Accelerates Disc Degeneration in the Aging Mouse J. Histochem. Cytochem., September 1, 2005; 53(9): 1131 - 1138. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Cruz, J. Chen, J. L. Whitelock, L. D. Morales, and J. A. Lopez The platelet glycoprotein Ib-von Willebrand factor interaction activates the collagen receptor {alpha}2{beta}1 to bind collagen: activation-dependent conformational change of the {alpha}2-I domain Blood, March 1, 2005; 105(5): 1986 - 1991. [Abstract] [Full Text] [PDF] |
||||