Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zako, M.
Right arrow Articles by Kimata, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zako, M.
Right arrow Articles by Kimata, K.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 14, Issue of April 4, 1997 pp. 9325-9331
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Alternative Splicing of the Unique "PLUS" Domain of Chicken PG-M/Versican Is Developmentally Regulated*

(Received for publication, May 15, 1996, and in revised form, December 26, 1996)

Masahiro Zako , Tamayuki Shinomura and Koji Kimata Dagger

From the Institute for Molecular Science of Medicine, Aichi Medical University, Nagakute, Aichi 480-11, Japan

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

We investigated the occurrence of alternatively spliced forms (V0, V1, V2, and V3) of PG-M/versican, a large chondroitin sulfate proteoglycan in developing chicken retinas, using the reverse transcription-polymerase chain reaction. We characterized the PLUS domain, which is apparently unique to the chicken molecule and is regulated by alternative splicing. PG-M in chicken retinas consisted of four forms with (V0, V1, V2, and V3) and two forms without (V1 and V3) the PLUS domain (PG-M+ and PG-M-, respectively). The four forms of PG-M+ were found in all samples examined, but the occurrence of the two PG-M- forms was regulated developmentally. Genomic analysis has revealed that the PLUS and CS-alpha domains are encoded by a single exon, and this exon has an internal alternative 5'-splice donor site, allowing alternative spliced forms that do not include the 3'-end of the exon. Sequences corresponding to the chicken PLUS domain (plus) were not found in mouse and human and may have disappeared during evolution. Sequence similarity suggests that the PLUS domain corresponds to the keratan sulfate attachment domain of aggrecan and that it has a distinct function in the chicken eye.


INTRODUCTION

PG-M, a large chondroitin sulfate proteoglycan, is a major extracellular matrix molecule located in the mesenchymal cell condensation regions of developing chicken limb buds (1). Its expression, however, is regulated in an inverse relationship to that of aggrecan, and PG-M disappears after cartilage development (2). PG-M is also transiently expressed in various embryonic tissues during morphogenesis and differentiation (3). Therefore, PG-M may play some regulatory roles in many biological events.

Our cDNA studies on the core proteins of mouse PG-M revealed four mRNA species designated PG-M(V0), PG-M(V1), PG-M(V2), and PG-M(V3) in order of length (4, 5). All have hyaluronan-binding domains at the amino terminus and two epidermal growth factor (EGF)1-like domains, a lectin-like domain, and a complement regulatory protein (CRP)-like domain at the carboxyl terminus. The amino- and carboxyl-terminal regions show binding activity for hyaluronan (1, 6) and a C-type lectin-like activity (7), respectively. However, they have different chondroitin sulfate attachment regions in the middle of the core proteins. The differences are generated by alternative and simultaneous usage of the two different domains for the chondroitin sulfate attachment region (CS-alpha and CS-beta ).

Versican was first identified in human fibroblasts by a cDNA study (8, 9). Homology analysis of the deduced amino acid sequence demonstrated that versican corresponds to the core protein of PG-M(V1) (4). Other forms (V0, V2, and V3) of human versican have since been identified (5, 10).

Although there are four forms of mouse and human PG-M/versican, PG-M(V2) and PG-M(V3) have not yet been identified in chicken (11). We reported that the chondroitin sulfate attachment region of chicken PG-M(V1) is longer than that of mouse PG-M(V1) (4), suggesting an extra domain between the hyaluronan-binding domains and the CS-alpha domain in chicken PG-M. Whether or not this domain is a single exon and whether or not its expression is regulated by alternative splicing remain to be examined.

In this study, we investigated the occurrence of multiple forms (V0, V1, V2, and V3) of PG-M in the developing chicken retina and found alternative splicing for this domain, which we have named the "PLUS" domain. Although the significance of diverse alternative splicing for PG-M is not known, each form of PG-M may have a unique function in this developing organ. Because PG-M and aggrecan are structurally similar, the PLUS domain might be related to the keratan sulfate attachment domain of aggrecan. We discuss the evolutionary significance of this finding.


EXPERIMENTAL PROCEDURES

RNA Isolation

Total RNAs were obtained from whole eyes of chicken embryos (White Leghorn) on days 5, 7, and 9 (designated E5, E7, and E9, respectively). Total retinal RNA was obtained from chicken embryos on days 14 and 20 (designated E14 and E20, respectively) and from adult chicken. RNA was extracted using guanidinium thiocyanate (12).

cDNA Libraries

Human fetal brain, fetal liver, cerebral cortex, and skeletal muscle and mouse brain, embryonic stem cell, and skeletal muscle cDNA libraries were obtained commercially (CLONTECH, Palo Alto, CA).

RT-PCR Amplification

Primers for RT-PCR amplifications were chosen from the published sequences of chicken PG-M to detect the specific portion of each splicing form. Reverse transcription was performed using three antisense primers (see Fig. 1A, e, j, and m; and Table I) and SuperScript II RNase H- reverse transcriptase (Life Technologies, Inc.) as recommended by the manufacturer. The first PCR amplifications were carried out using pairs of outer primers (see Fig. 1A, a, d, f, i, and l; and Table I). The second PCR was performed using the first PCR products as templates and pairs of inner primers (see Fig. 1A, b, c, g, h, and k; and Table I). Conditions for PCR amplification were as described (5). We amplified chicken genomic DNAs (CLONTECH) using the LA PCR kit (Takara Biomedicals, Kyoto, Japan) as recommended by the manufacturer. The final products were resolved by electrophoresis on a 1.2% (v/w) agarose gel or on 2% (v/w) NuSieve (3:1; FMC Corp. BioProducts, Rockland, ME).


Fig. 1. RT-PCR amplifications of various forms of chicken PG-M. A, the primer positions used for RT-PCR amplification to detect various forms of chicken PG-M are schematically shown (see Table I). HABR, hyaluronan-binding region; PLUS, PLUS domain; CS, chondroitin sulfate attachment domain; EGF, epidermal growth factor-like domains; LEC, lectin-like domain; CRP, complement regulatory protein-like domain. B, RT-PCR amplification was carried out to detect the various forms of PG-M in E14, E20, and adult retinas. PCR products derived from the E14 (lanes 2-6), E20 (lanes 7-11), and adult (lanes 14-18) retinas were analyzed by agarose gel electrophoresis. Lanes 2, 7, and 14, PCR products for PG-M(V0) with the primer pair g and h; lanes 3, 8, and 15, those for PG-M(V1) with the primer pair b and h; lanes 4, 9, and 16, those for PG-M(V2) with the primer pair g and k; lanes 5, 10, and 17, those for PG-M(V3) with the primer pair b and k; lanes 6, 11, and 18, those for the PLUS domain of PG-M(V0) and PG-M(V2) with the primer pair b and c. DNA size markers are shown in lanes 1, 12, and 13. C, RT-PCR amplification was performed on four forms (V0, V1, V2, and V3) of PG-M in E5 whole eye. Lane 2, the V0 form with the primer pair g and h; lane 3, the V1 form with the primer pair b and h; lane 4, the V2 form with the primer pair g and k; lane 5, the V3 form with the primer pair b and k; lane 6, the PLUS domain of the V0 and V2 forms with the primer pair b and c. DNA size markers are shown in lanes 1 and 7. PCR products obtained from E7 and E9 whole eyes were essentially the same as those obtained from E5 eye.
[View Larger Version of this Image (47K GIF file)]


Table I.

Primers used for PCR amplification


Primera Positionb Sequencec Species

a (S) 1044-1065 TGGAAGTGTTCGTTACCCTGCC Chicken
b (S) 1087-1108 GGTGGAGGTTTACTTGGGGTGA Chicken
c (A) 1619-1598 TCCTCAGTGCTTTCAGACCTAC Chicken
d (A) 1640-1617 ACTACAGAGGTCAAGAAAGCGTCC Chicken
e (A) 1674-1645 GGAACTCTTAGCTACAGCTGTGCTATCCTG Chicken
f (S) 4007-4027 CATCTATTAGCGCTGTAGACA Chicken
g (S) 4087-4110 CCTGAGGAAGATGAGGAGGTAACA Chicken
h (A) 4477-4457 GTTCAGTCTGAGCTGATTCTG Chicken
i (A) 4577-4555 TCACAGTCCTCTTCCTCCTCTTC Chicken
j (A) 4620-4591 GATGAACTGCAAAGCTGGAGGAGTTGTAAC Chicken
k (A) 10018-9999  CTAATTCACACTGCTCACCA Chicken
l (A) 10050-10026 GCGGCATGGGTTAGACTGGCATTCA Chicken
m (A) 10080-10051 ATTGAGGCCATCTATACATGTGGCTCCATT Chicken
n (S) 1111-1145 ACCCTGTATCGCTATGAGAACCAAACAGGCTTTCC Chicken
o (A) 1590-1556 CTCGGACAATTCTGCTTCAGAGTAAGTGTGCTCCA Chicken
p (S) 1191-1225 AATTGTATCAGAGCCTACAACTGTTAAGCTGGTTA Chicken
q (A) 1645-1611 GAAAAACTACAGAGGTCAAGAAAGCGTCCTCAGTG Chicken
1 (S) 1221-1246 CTACTTGGGGTGAGAACCCTGTATCG Human
 991-1010 GAGAACCAGACATGCTTCCC Mouse
2 (S) 1250-1269 TGAGAACCAGACAGGCTTCC Human
1022-1041 GCAGATTTGATGCCTACTGC Mouse
3 (A) 1517-1498 GGTTGTCACATCAGTAGCAT Human
1264-1244 ACGGAGTAGTTGTTACATCCG Mouse
4 (A) 1604-1584 CTGGCCACGCCTAGCTTCTGC Human
1286-1266 TTCCCATTGATATACTGCACT Mouse
5 (A) 6819-6800 CATAGTCACATGTCTCGGTA Human
6486-6468 AACATAACTTGGGAGACAG Mouse
6 (A) 6848-6830 GTAGCACTGCCCTTGGAAT Human
6505-6487 CTTGTTCACAGAGTGCACC Mouse

a Letters in parentheses indicate sense (S) or antisense (A) primers.
b The numbers indicate the nucleotide positions (GenBankTM/EMBL Data Bank accession numbers D13542[GenBank], X15998[GenBank], and D16263[GenBank] for chicken, human, and mouse, respectively).
c Sequences are written from the 5' to 3' direction.

DNA Sequencing

PCR products were purified with the EasyPrep PCR Product Prep kit (Pharmacia Biotech, Uppsala). Purified DNAs were sequenced as described (5). The sequencing primers were identical to those used for the above RT-PCR amplifications.

Sequence Similarity Analysis of the PLUS Domain

The sequence of the PLUS domain was compared with the data base compiled by the European Bioinformatics Institute using the GENETYX-MAC computer program (Software Development Co., Tokyo). The deduced amino acid sequence was compared with other protein sequences in the data base compiled by the National Biomedical Research Foundation and the European Bioinformatics Institute.


RESULTS

Development- and Age-dependent Expression of the PG-M PLUS Domain in the Chicken Retina

The second RT-PCR amplifications performed using the inner primer pairs on E14 and E20 retinal cDNAs and on retinal cDNAs from adult chicken (1-year-old) generated one or two products (Table I and Fig. 1 (A and B)). The latter indicated the presence of two transcripts with and without the exon containing ~400 nucleotides and corresponding to the PLUS domain. The shorter transcripts without the exon were found in PG-M(V1) and PG-M(V3) of E14 retina and in PG-M(V1) of adult retina. PG-M+ and PG-M- refer to PG-M with and without the PLUS domain, respectively. Four forms (V0, V1, V2, and V3) of PG-M+ were detected in all retinas (Fig. 1B). However, the occurrence of PG-M- was developmentally regulated. PG-M-(V1) was detected in E14 and adult retinas (Fig. 1B, lanes 3 and 15), but not in E20 retina (lane 8). PG-M-(V3) was detected in E14 retina (Fig. 1B, lane 5), but not in E20 and adult retinas (lanes 10 and 17). Since the primer pair b and c only gave a band corresponding to the product containing the PLUS domain (Fig. 1B, lanes 6, 11, and 18), no forms containing the exon for the hyaluronan-binding region directly spliced to that for the CS-alpha domain. A summary of the variation of PG-M forms expressed in E14, E20, and adult retinas is shown in Table II.

Table II.

Summary of various forms of PG-M expressed in chicken whole eyes and retinas at different developmental stages

Shown are the PG-M forms detected in E5, E7, and E9 whole eyes. All of them showed the same patterns. Also shown are PG-M forms detected in E14, E20, and adult retinas. The plus signs indicate the presence of each PG-M form.


PG-M Whole eyes
Retinas
E5 E7 E9 E14 E20 Adult

PG-M+(V0) + + + + + +
PG-M+(V1) + + + + + +
PG-M-(V1) + + + +  - +
PG-M+(V2) + + + + + +
PG-M+(V3) + + + + + +
PG-M-(V3) + + + +  -  -

Analysis of PG-M Forms Expressed in Chicken Embryonic Whole Eyes

We further examined the PG-M forms in E5, E7, and E9 whole eyes using RT-PCR to determine the relevance of PG-M- to the developmental stage. We also examined the presence of PG-M-(V0) and PG-M-(V2). Since the retinas of these early embryos were too small to isolate, we analyzed whole eyes. The results revealed the presence of all forms (V0, V1, V2, and V3) of PG-M+ and two forms (V1 and V3) of PG-M- (Fig. 1C). These expression profiles were the same as those in E14 retina. The variation of PG-M forms expressed in E5, E7, and E9 whole eyes is summarized in Table II.

Alternative Splicing of the PLUS Domain in Chicken PG-M

We compared the DNA sequences of the PCR products of PG-M+ and PG-M-. The results revealed alternative splicing of the PLUS domain, which was located between the hyaluronan-binding B' domain (nucleotide 1183) and the CS-alpha domain (nucleotide 1598) for PG-M+(V0) and PG-M+(V2), between the hyaluronan-binding B' domain and the CS-beta domain (nucleotide 4379) for PG-M+(V1), and between the hyaluronan-binding B' domain and the EGF-like domain (nucleotide 9905) for PG-M+(V3) (Fig. 2A). The results also showed that the PLUS domain consisted of 414 nucleotides (nucleotides 1184-1597 for PG-M+(V0)) (Fig. 2B). New termination codons and shifts of reading frames were not identified in these junctional regions (Fig. 2A). A computer-assisted sequence similarity search for the PLUS domain in nucleic acid and protein data bases did not identify other genes with significant homology.


Fig. 2. Alternative splicing of the PLUS domain. A, boundary sequences of PCR products for four forms (V0, V1, V2, and V3) of PG-M+ and two forms (V1 and V3) of PG-M-. Triplet nucleotides encoding two different domains are underlined. Splicing points are indicated by arrowheads. There is no new termination codon or a shift of reading frame. Numbers indicate the terminal nucleotide position of each domain. B, nucleic acid and predicted amino acid sequences for the PLUS domain. The plus exon is composed of 414 nucleotides.
[View Larger Version of this Image (38K GIF file)]


Location of the Exon Coding for the PLUS Domain in the Chicken PG-M Gene

To confirm the presence of the exon gene for the PLUS domain in the chicken PG-M gene, which we named plus, we performed PCR studies on chicken genomic DNA. Primers specific to exons for the hyaluronan-binding B' domain and the CS-alpha domain were used together with internal primers to the exon for the PLUS domain to determine the position of the plus exon in the PG-M gene. Analysis of the PCR products indicated that the exon was ~12 kilobases downstream of the exon for the B' domain (Fig. 3A, lane 2), but adjacent to that for the CS-alpha domain (lane 4). We then sequenced the PCR product amplified with the primer pair p and q. The results showed no intron between the PLUS and CS-alpha domain-encoding sequences, suggesting that they are encoded by a single exon (Fig. 3B). We named this domain "PLUS-alpha ." The nucleotide sequence of the boundary region between the two domains is shown in Fig. 3B. Although there was an exon terminus-like sequence (AAG) in the 3'-terminal portion of the PLUS domain and a splicing donor site-like sequence in the 5'-terminal portion of the CS-alpha domain (Fig. 3B, boldface letters), there was no typical acceptor site-like sequence in the 3'-terminal portion of the PLUS domain. This sequence causes similar alternative splicing in other genes and is termed an internal alternative 5'-splice donor site (13-15).


Fig. 3. Location of the plus exon in the chicken PG-M gene. A, agarose gel electrophoresis of the amplification products obtained from genomic DNAs. To determine the distance between the exons for the B' and PLUS domains, primers n and o were used (lane 2), and for that between the exons for the PLUS and CS-alpha domains, primers p and q were used (lane 4). To examine whether or not the PLUS domain consists of one exon, primers o and p were applied as internal primers (lane 3). DNA size markers are shown in lanes 1 and 5 (lane 1, lambda -EcoT14I digest; lane 5, 100-bp DNA ladder). Lanes 1 and 2, 1.2% agarose gel; lanes 3-5, 2% NuSieve (3:1). The schema shows the approximate positions of exons in the chicken PG-M gene. Boxes indicate exons, and lines represent introns. kb, kilobases. B, DNA sequence determined from the PCR product of lane 4 in A. A single exon encodes the PLUS and CS-alpha domains. This exon has an internal alternative 5'-splice donor site, allowing alternative spliced forms that do not include the 3'-end of the exon. The site is indicated by boldface letters. The splicing site is shown by an arrowhead.
[View Larger Version of this Image (30K GIF file)]


Absence of the PLUS Domain in Human and Mouse cDNA Libraries

Sequences corresponding either to an internal alternative 5'-splice donor site or to the PLUS domain in human or mouse PG-M/versican have not been described (16, 17). To confirm that there is no PLUS domain in human and mouse PG-M, we amplified the relevant cDNAs from several cDNA libraries of various human and mouse tissues using appropriate primers (Table I and Fig. 4). The products showed a single band or no band (Fig. 4), confirming that cDNAs for the PLUS domain were absent in those cDNA libraries (no PG-M+ forms). Although cDNA libraries of mouse and human retinas were not examined, cDNAs for PG-M+ were found in cDNA libraries of various chicken tissues corresponding to those of the human and mouse tissues tested in the above experiment. Therefore, the PLUS domain may be unique to chicken PG-M.


Fig. 4. Demonstration of the absence of the PLUS domain in human and mouse PG-M/versican by PCR analysis of the V1 and V3 forms. Arrows indicate the primer positions used for RT-PCR amplification to detect the human and mouse V1 and V3 forms of PG-M+ (left) and PG-M- (right). The primer positions and sequences are shown in the schematic diagram (see Table I). PCR products were derived from cDNA libraries of the following human and mouse tissues; lanes 2 and 12, human fetal brain; lanes 3 and 13, human fetal liver; lanes 4 and 14, human adult cerebral cortex; lanes 5 and 15, human adult skeletal muscle; lanes 7 and 17, mouse adult brain; lanes 8 and 18, mouse embryonic stem cell; lanes 9 and 19, mouse adult skeletal muscle. Lanes 2-5 and 7-9 have PCR products with single bands showing only the human and mouse V1 forms of PG-M-, respectively (human, 268 bp; mouse, 243 bp). Lanes 12-15 and 17-19 have PCR products with single bands showing only the human and mouse V3 forms of PG-M-, respectively (human, 308 bp; mouse, 236 bp). DNA size markers are shown in lanes 1, 6, 10, 11, 16, and 20. HABR, hyaluronan-binding region; PLUS, PLUS domain; CS, chondroitin sulfate attachment domain; EGF, epidermal growth factor-like domains; LEC, lectin-like domain; CRP, complement regulatory protein-like domain.
[View Larger Version of this Image (48K GIF file)]



DISCUSSION

Mechanisms of Characteristic Alternative Expression of the PLUS Domain

This study revealed that there is an internal alternative 5'-splice donor site at the boundary of the PLUS and CS-alpha domains in the exon for the PLUS-alpha domain (Fig. 3B). The absence of a typical 3'-splice acceptor site at the boundary is the reason why the V0 and V2 forms of PG-M- are absent (Fig. 5). The exon for the PLUS-alpha domain functions as a single exon in the expression of the V0 and V2 forms of PG-M+, but this exon is spliced out in the expression of the V1 and V3 forms of PG-M- (Fig. 5). An internal alternative 5'-splice donor site in the exon for the CS-alpha domain functions like the beginning of an intron ("pseudo intron") in the expression of the V1 and V3 forms of PG-M+. During the splicing, the plus sequence remains as an exon for the V1 and V3 forms of PG-M+ (Fig. 5). Since we found that PG-M+(V1) is the major form of PG-M in 10-day chicken embryonic fibroblasts (11), this splicing event does not seem to be rare.


Fig. 5. Alternative splicing of PG-M+ and PG-M- forms in the chicken PG-M gene. Open triangles indicate donor sites or an internal alternative 5'-splice donor site. Filled triangles indicate acceptor sites. Solid lines and boxes indicate introns and exons, respectively. Each solid line does not indicate the correct size of each intron.
[View Larger Version of this Image (14K GIF file)]


This study showed that all forms (V0, V1, V2, and V3) of PG-M+ were present in all samples examined. On the other hand, the V1 and V3 forms of PG-M- are expressed in a developmentally regulated manner and tend to be expressed at the earlier stages (Table II), suggesting that alternative splicing skipping the exon for the PLUS-alpha domain is regulated developmentally. The size of the intron between exon VI (B' domain) and exon VII (CS-alpha domain) in human or mouse PG-M is ~6 kilobases (16, 17). This study also showed that the size of the intron between the exons for the B' and PLUS-alpha domains is ~12 kilobases in chicken PG-M/versican. Considering the difference, a region of the gene containing the PLUS domain sequence and an intron of ~6 kilobases might have been removed during evolution by some mechanism. The sequence similarity between the PLUS domain (414 nucleotides and 137 amino acids) and the first part of the mouse or human CS-alpha domain (the same numbers of nucleotides and amino acids) is fairly low, not only in nucleotide sequences (48.6 and 48.8% identity to human and mouse, respectively), but also in amino acid sequences (19.0 and 10.3% identity to human and mouse, respectively), which supports the above notion. However, it is still possible that the PLUS domain is not a separately defined domain, but is simply an alternatively spliced part of the chicken CS-alpha domain.

Possible Functions of the PLUS Domain

Sequence similarity analysis has not not identified any nucleotide or amino acid sequences in the data bases similar to those for the PLUS domain, except for some identity in the nucleotide sequence to the KS domain of aggrecan as discussed below. Since the PLUS domain was detected in chicken PG-M/versican, but not in human or mouse PG-M/versican as far as we investigated in available cDNA libraries, it is likely that this domain is unique to chicken PG-M/versican. Genomic analysis of human and mouse PG-M/versican proteins has shown that the total number of exons is identical (15 exons) (16, 17). Comparisons of nucleotide sequences of the cDNAs and deduced amino acid sequences among chicken, human, and mouse PG-M/versican proteins suggested that chicken PG-M/versican may have the same number of exons because the PLUS and CS-alpha domains are derived from a single exon (PLUS-alpha ) (Fig. 3A).

Aggrecan contains several domains that are highly homologous to PG-M/versican (18-23). This structural identity suggested that the PLUS domain might correspond to the KS attachment domain of aggrecan. Comparisons of the nucleotide and amino acid sequences between the PLUS domain and the KS attachment domain of human, rat, mouse, or chicken aggrecan revealed significant identity among their nucleotide sequences (44.1, 47.6, 57.4, and 51.6% to human, rat, mouse, and chicken domains, respectively) and amino acid sequences (20.0, 23.5, 23.5, and 40.0% to human, rat, mouse, and chicken domains, respectively). A comparison of the frequency of serine plus threonine residues (potential O-glycosylation sites) to the total amino acid residues of the respective domains between chicken PG-M/versican and human aggrecan also revealed significant similarity with respect to the potential for O-glycosylation between the PLUS domain of chicken PG-M/versican and the KS attachment domain of human aggrecan (Table III). Furthermore, the phylogenetic tree (Fig. 6) constructed as described by Saitou and Nei (24) suggests that the chicken KS domain is more closely related to the PLUS domain than it is to the human, mouse, and rat KS domains. The distance between a pair of sequences is the sum of the branch lengths. Thus, the PLUS domain of PG-M/versican could be considered to correspond to the KS attachment domain of aggrecan. Interestingly, PG-M/versican regulates molecular forms by alternative splicing of the PLUS, CS-alpha , and CS-beta domains, while aggrecan does so by alternative splicing of the EGF and CRP domains (21, 25, 26). With regard to comparisons of the PLUS domain of PG-M/versican with the KS domain of aggrecan, two reports describe the relationship between exon boundaries and the functional domains of aggrecan (27, 28). According to Valhmu et al. (27), the KS domain is composed of two regions, KS-1 and KS-2. The former is encoded by exon 11 and is well conserved among various animal species (bovine, mouse, rat, and chicken), while the latter is composed of variable numbers of poorly conserved hexapeptide repeats and is encoded by the 5'-end of the large exon 12, which also encodes the CS-1 and CS-2 domains of aggrecan. Considering our finding that the PLUS and CS-alpha domains of PG-M/versican are encoded by a single exon, the PLUS domain appears to be rather comparable to the KS-2 domain. However, Li and Schwartz (28) seemed to limit the definition of the KS domain to the sequence encoded by exon 11 of the chicken gene.

Table III.

Comparison of potential O-glycosylation site frequency in chicken PG-M and human aggrecan

Nucleotide positions of chicken PG-M are as follows: hyaluronan-binding region, 250-1183; PLUS domain, 1184-1597; CS-alpha domain, 1598-4378; CS-beta domain, 4379-9904; EGF, 9905-10132; lectin-like domain, 10133-10519; and CRP, 10520-10702 (11). Some nucleotide positions of human aggrecan are as follows: G1, 202-1110; G2, 1492-2079; KS, 2089-2643; CS-1, 2650-4590; and CS-2, 4591-6546 (22). Other nucleotide positions of human aggrecan are as follows: EGF, 683-795; lectin-like domain, 796-1182; and CRP, 1183-1368 (19). The numbers represent percent frequency of Ser plus Thr residues per total amino acid residues in each domain.


Chicken PG-M
Human aggrecan
Domain Frequency Domain Frequency

% %
HABRa 13.2 G1 + G2 13.0
PLUS 26.3 KS 25.4
CS-alpha 27.6 CS-1 20.9
CS-beta 26.5 CS-2 28.8
EGF 12.0 EGF 10.5
LEC 10.9 LEC 7.0
CRP 6.7 CRP 11.3

a HABR, hyaluronan-binding region; LEC, lectin-like domain.


Fig. 6. Phylogenetic tree of the PLUS domain and the KS attachment domains of aggrecan based upon nucleotide sequences. The tree was constructed by the neighbor-joining method (24). The distance between a pair of sequences is the sum of the branch lengths. Nucleotide positions of the KS domains are compared: nucleotides 2171-2353 for chicken (26), nucleotides 2095-2313 for human (22), nucleotides 2161-2343 for rat (18), and nucleotides 2194-2391 for mouse (21).
[View Larger Version of this Image (12K GIF file)]


Roles of Multiple Forms of PG-M

Chondroitin sulfate proteoglycans in the retina have been extensively studied (29-44), and possible functions have been suggested (34, 35, 44-47). We demonstrated not only the presence of various forms of PG-M in the developing chicken retina, but also their developmental stage- and age-dependent variations by immunofluorescent staining with polyclonal and monoclonal antibodies to PG-M and by Northern blotting.2 This study showed for the first time the presence of the V2 and V3 forms of PG-M+ and the V1 and V3 forms of PG-M- mRNAs in the chicken retina. The tissue-, developmental stage-, and age-dependent expression of each PG-M form suggests that each plays specific roles.


FOOTNOTES

*   This work was supported in part by special coordination funds from the Science and Technology Agency of the Japanese Government, by a grant-in-aid from the Ministry of Education, Culture, and Science of the Japanese Government, and by a special research fund from Seikagaku Corp.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Dagger    To whom correspondence should be addressed. Tel.: 81-52-264-4811 (ext. 2088); Fax: 81-561-63-3532.
1   The abbreviations used are: EGF, epidermal growth factor; CRP, complement regulatory protein; CS, chondroitin sulfate; RT-PCR, reverse transcription-polymerase chain reaction; KS, keratan sulfate; bp, base pair(s).
2   M. Zako, T. Shinomura, O. Miyaishi, M. Iwaki, and K. Kimata, unpublished observations.

ACKNOWLEDGEMENTS

We are grateful to Drs. S. Nishida and M. Iwaki (Aichi Medical University) and Dr. Y. Honda (Kyoto University) for continuous support and encouragement.


REFERENCES

  1. Kimata, K., Oike, Y., Tani, K., Shinomura, T., Yamagata, M., Uritani, M., and Suzuki, S. (1986) J. Biol. Chem. 261, 13517-13525 [Abstract/Free Full Text]
  2. Shinomura, T., Jensen, K. L., Yamagata, M., Kimata, K., and Solursh, M. (1990) Anat. Embryol. 181, 227-233 [Medline] [Order article via Infotrieve]
  3. Yamagata, M., Shinomura, T., and Kimata, K. (1993) Anat. Embryol. 187, 433-444 [Medline] [Order article via Infotrieve]
  4. Ito, K., Shinomura, T., Zako, M., Ujita, M., and Kimata, K. (1995) J. Biol. Chem. 270, 958-965 [Abstract/Free Full Text]
  5. Zako, M., Shinomura, T., Ujita, M., Ito, K., and Kimata, K. (1995) J. Biol. Chem. 270, 3914-3918 [Abstract/Free Full Text]
  6. LeBaron, R. G., Zimmermann, D. R., and Ruoslahti, E. (1992) J. Biol. Chem. 267, 10003-10010 [Abstract/Free Full Text]
  7. Ujita, M., Shinomura, T., Ito, K., Kitagawa, Y., and Kimata, K. (1994) J. Biol. Chem. 269, 27603-27609 [Abstract/Free Full Text]
  8. Krusius, T., Gehlsen, K. R., and Ruoslahti, E. (1987) J. Biol. Chem. 262, 13120-13125 [Abstract/Free Full Text]
  9. Zimmermann, D. R., and Ruoslahti, E. (1989) EMBO J. 8, 2975-2981 [Medline] [Order article via Infotrieve]
  10. Dours-Zimmermann, M. T., and Zimmermann, D. R. (1994) J. Biol. Chem. 269, 32992-32998 [Abstract/Free Full Text]
  11. Shinomura, T., Nishida, Y., Ito, K., and Kimata, K. (1993) J. Biol. Chem. 268, 14461-14469 [Abstract/Free Full Text]
  12. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156-159 [Medline] [Order article via Infotrieve]
  13. Smith, C. W., Patton, J. G., and Nadal-Ginard, B. (1989) Annu. Rev. Genet. 23, 527-577 [CrossRef][Medline] [Order article via Infotrieve]
  14. McKeown, M. (1990) Genet. Eng. 12, 139-181
  15. Nadal-Ginard, B., Smith, C. W., Patton, J. G., and Breitbart, R. E. (1991) Adv. Enzyme. Regul. 31, 261-286 [Medline] [Order article via Infotrieve]
  16. Naso, M. F., Zimmermann, D. R., and Iozzo, R. V. (1994) J. Biol. Chem. 269, 32999-33008 [Abstract/Free Full Text]
  17. Shinomura, T., Zako, M., Ito, K., Ujita, M., and Kimata, K. (1995) J. Biol. Chem. 270, 10328-10333 [Abstract/Free Full Text]
  18. Doege, K., Sasaki, M., Horigan, E., Hassell, J. R., and Yamada, Y. (1987) J. Biol. Chem. 262, 17757-17767 [Abstract/Free Full Text]
  19. Baldwin, C. T., Reginato, A. M., and Prockop, D. J. (1989) J. Biol. Chem. 264, 15747-15750 [Abstract/Free Full Text]
  20. Chandrasekaran, L., and Tanzer, M. L. (1992) Biochem. J. 288, 903-910
  21. Walcz, E., Deak, F., Erhardt, P., Coulter, S. N., Fülöp, C., Horvath, P., Doege, K. J., and Glant, T. T. (1994) Genomics 22, 364-371 [CrossRef][Medline] [Order article via Infotrieve]
  22. Doege, K. J., Sasaki, M., Kimura, T., and Yamada, Y. (1991) J. Biol. Chem. 266, 894-902 [Abstract/Free Full Text]
  23. Watanabe, H., Gao, L., Sugiyama, S., Doege, K., Kimata, K., and Yamada, Y. (1995) Biochem. J. 308, 433-440
  24. Saitou, N., and Nei, M. (1987) Mol. Biol. Evol. 4, 406-425 [Abstract]
  25. Fülöp, C., Walcz, E., Valyon, M., and Glant, T. T. (1993) J. Biol. Chem. 268, 17377-17383 [Abstract/Free Full Text]
  26. Li, H., Schwartz, N. B., and Vertel, B. M. (1993) J. Biol. Chem. 268, 23504-23511 [Abstract/Free Full Text]
  27. Valhmu, W. B., Palmer, G. D., Rivers, P. A., Ebara, S., Cheng, J. F., Fisher, S., and Ratcliffe, A. (1995) Biochem. J. 309, 535-542
  28. Li, H., and Schwartz, N. B. (1995) J. Mol. Evol. 41, 878-885 [Medline] [Order article via Infotrieve]
  29. Morris, J. E., and Ting, Y. P. (1981) J. Neurochem. 37, 1594-1602 [CrossRef][Medline] [Order article via Infotrieve]
  30. Morris, J. E., Ting, Y. P., and Birkholz-Lambrecht, A. (1984) J. Neurochem. 42, 798-809 [CrossRef][Medline] [Order article via Infotrieve]
  31. Morris, J. E. (1984) Arch. Biochem. Biophys. 235, 127-140 [CrossRef][Medline] [Order article via Infotrieve]
  32. Morris, J. E., Yanagishita, M., and Hascall, V. C. (1987) Arch. Biochem. Biophys. 258, 206-218 [CrossRef][Medline] [Order article via Infotrieve]
  33. Aquino, D. A., Margolis, R. U., and Margolis, R. K. (1984) J. Cell Biol. 99, 1117-1129 [Abstract/Free Full Text]
  34. Porrello, K., and LaVail, M. M. (1986) Curr. Eye Res. 5, 981-993 [Medline] [Order article via Infotrieve]
  35. Porrello, K., Yasumura, D., and LaVail, M. M. (1989) Invest. Ophthalmol. & Visual Sci. 30, 638-651 [Abstract/Free Full Text]
  36. Varner, H. H., Rayborn, M. E., Osterfeld, A. M., and Hollyfield, J. G. (1987) Exp. Eye Res. 44, 633-642 [CrossRef][Medline] [Order article via Infotrieve]
  37. Hageman, G. S., and Johnson, L. V. (1987) Curr. Eye Res. 6, 639-646 [Medline] [Order article via Infotrieve]
  38. Stramm, L. E. (1987) Invest. Ophthalmol. & Visual Sci. 28, 618-627 [Abstract/Free Full Text]
  39. Needham, L. K., Adler, R., and Hewitt, A. T. (1988) Dev. Biol. 126, 304-314 [CrossRef][Medline] [Order article via Infotrieve]
  40. Tawara, A., Varner, H. H., and Hollyfield, J. G. (1989) Exp. Eye Res. 48, 815-839 [CrossRef][Medline] [Order article via Infotrieve]
  41. Tawara, A., and Hollyfield, J. G. (1990) Exp. Eye Res. 51, 301-315 [CrossRef][Medline] [Order article via Infotrieve]
  42. Landers, R. A., Tawara, A., Varner, H. H., and Hollyfield, J. G. (1991) Exp. Eye Res. 52, 65-74 [CrossRef][Medline] [Order article via Infotrieve]
  43. Landers, R. A., and Hollyfield, J. G. (1992) Exp. Eye Res. 55, 345-356 [CrossRef][Medline] [Order article via Infotrieve]
  44. Iwasaki, M., Rayborn, M. E., Tawara, A., and Hollyfield, J. G. (1992) Exp. Eye Res. 54, 415-432 [CrossRef][Medline] [Order article via Infotrieve]
  45. Hollyfield, J. G., Varner, H. H., Rayborn, M. E., and Osterfeld, A. M. (1989) Retina 9, 59-68 [Medline] [Order article via Infotrieve]
  46. Brittis, P. A., Canning, D. R., and Silver, J. (1992) Science 255, 733-736 [Abstract/Free Full Text]
  47. Lazarus, H. S., and Hageman, G. S. (1992) Invest. Ophthalmol. & Visual Sci. 33, 364-376 [Abstract/Free Full Text]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
IOVSHome page
A. Ohno-Jinno, Z. Isogai, M. Yoneda, K. Kasai, O. Miyaishi, Y. Inoue, T. Kataoka, J.-S. Zhao, H. Li, M. Takeyama, et al.
Versican and Fibrillin-1 Form a Major Hyaluronan-Binding Complex in the Ciliary Body
Invest. Ophthalmol. Vis. Sci., July 1, 2008; 49(7): 2870 - 2877.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
W. Sheng, G. Wang, D. P. La Pierre, J. Wen, Z. Deng, C.-K. A. Wong, D. Y. Lee, and B. B. Yang
Versican Mediates Mesenchymal-Epithelial Transition
Mol. Biol. Cell, April 1, 2006; 17(4): 2009 - 2020.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Kamiya, H. Watanabe, H. Habuchi, H. Takagi, T. Shinomura, K. Shimizu, and K. Kimata
Versican/PG-M Regulates Chondrogenesis as an Extracellular Matrix Molecule Crucial for Mesenchymal Condensation
J. Biol. Chem., January 27, 2006; 281(4): 2390 - 2400.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
M. Yamagata and J. R. Sanes
Versican in the Developing Brain: Lamina-Specific Expression in Interneuronal Subsets and Role in Presynaptic Maturation
J. Neurosci., September 14, 2005; 25(37): 8457 - 8467.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Cattaruzza, M. Schiappacassi, A. Ljungberg-Rose, P. Spessotto, D. Perissinotto, M. Morgelin, M. T. Mucignat, A. Colombatti, and R. Perris
Distribution of PG-M/Versican Variants in Human Tissues and de Novo Expression of Isoform V3 upon Endothelial Cell Activation, Migration, and Neoangiogenesis in Vitro
J. Biol. Chem., November 27, 2002; 277(49): 47626 - 47635.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Wu, L. Chen, P.-S. Zheng, and B. B. Yang
beta 1-Integrin-mediated Glioma Cell Adhesion and Free Radical-induced Apoptosis Are Regulated by Binding to a C-terminal Domain of PG-M/Versican
J. Biol. Chem., March 29, 2002; 277(14): 12294 - 12301.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
C. E. Bandtlow and D. R. Zimmermann
Proteoglycans in the Developing Brain: New Conceptual Insights for Old Proteins
Physiol Rev, October 1, 2000; 80(4): 1267 - 1290.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
D Perissinotto, P Iacopetti, I Bellina, R Doliana, A Colombatti, Z Pettway, M Bronner-Fraser, T Shinomura, K Kimata, M Morgelin, et al.
Avian neural crest cell migration is diversely regulated by the two major hyaluronan-binding proteoglycans PG-M/versican and aggrecan
Development, January 7, 2000; 127(13): 2823 - 2842.
[Abstract] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
J. M. Lemire, K. R. Braun, P. Maurel, E. D. Kaplan, S. M. Schwartz, and T. N. Wight
Versican/PG-M Isoforms in Vascular Smooth Muscle Cells
Arterioscler. Thromb. Vasc. Biol., July 1, 1999; 19(7): 1630 - 1639.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Schmalfeldt, M. T. Dours-Zimmermann, K. H. Winterhalter, and D. R. Zimmermann
Versican V2 Is a Major Extracellular Matrix Component of the Mature Bovine Brain
J. Biol. Chem., June 19, 1998; 273(25): 15758 - 15764.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Wu, Y. Zhang, L. Cao, L. Chen, V. Lee, P.-S. Zheng, C. Kiani, M. E. Adams, L. C. Ang, F. Paiwand, et al.
Identification of the Motif in Versican G3 Domain That Plays a Dominant-negative Effect on Astrocytoma Cell Proliferation through Inhibiting Versican Secretion and Binding
J. Biol. Chem., April 20, 2001; 276(17): 14178 - 14186.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zako, M.
Right arrow Articles by Kimata, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zako, M.
Right arrow Articles by Kimata, K.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement