JBC Oz Biosciences

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ali-Osman, F.
Right arrow Articles by Buolamwini, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ali-Osman, F.
Right arrow Articles by Buolamwini, J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 15, Issue of April 11, 1997 pp. 10004-10012
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Molecular Cloning, Characterization, and Expression in Escherichia coli of Full-length cDNAs of Three Human Glutathione S-Transferase Pi Gene Variants
EVIDENCE FOR DIFFERENTIAL CATALYTIC ACTIVITY OF THE ENCODED PROTEINS*

(Received for publication, June 20, 1996, and in revised form, December 5, 1996)

Francis Ali-Osman Dagger §, Olanike Akande Dagger , Gamil Antoun Dagger , Jia-Xi Mao Dagger and John Buolamwini

From the Dagger  Section of Molecular Therapeutics, Department of Experimental Pediatrics, University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030 and the  Department of Medicinal Chemistry and Research Institute of Pharmaceutical Sciences, School of Pharmacy, University of Mississippi, University, Mississippi 38677

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES


ABSTRACT

We report the isolation of three full-length cDNAs corresponding to the mRNAs of closely related glutathione S-transferase (GST) Pi genes, designated hGSTP1*A, hGSTP1*B, and hGSTP1*C, expressed in normal cells and malignant gliomas. The variant cDNAs result from A right-arrow G and C right-arrow T transitions at nucleotides +313 and +341, respectively. The transitions changed codon 104 from ATC (Ile) in hGSTP1*A to GTC (Val) in hGSTP1*B and hGSTP1*C and changed codon 113 from GCG (Ala) to GTG (Val) in hGSTP1*C. Both amino changes are in the electrophile-binding active site of the GST Pi peptide. Computer modeling of the deduced crystal structures of the encoded peptides showed significant deviations in the interatomic distances of critical electrophile-binding active site amino acids as a consequence of the amino acid changes. The encoded proteins expressed in Escherichia coli and purified by GSH affinity chromatography showed a 3-fold lower Km (CDNB) and a 3-4-fold higher Kcat/Km for the hGSTP1*A encoded protein than the proteins encoded by hGSTP1*B and hGSTP1*C. Analysis of 75 cases showed the relative frequency of hGSTP1*C to be 4-fold higher in malignant gliomas than in normal tissues. These data provide conclusive molecular evidence of allelopolymorphism of the human GST Pi gene locus, resulting in active, functionally different GST Pi proteins, and should facilitate studies of the role of this gene in xenobiotic metabolism, cancer, and other human diseases.


INTRODUCTION

Glutathione S-transferases (GSTs; EC 2.5.1.18)1 are dimeric proteins encoded by a family of distinct genes with limited structural homologies (1-4). Based on their biochemical, immunological, and structural properties, the currently known soluble human GSTs are categorized into four main classes, namely Alpha, Mu, Pi, and Theta (5). GSTs are involved in many cellular functions, the best characterized of which is their role as phase II enzymes in which they catalyze the S-conjugation of glutathione (GSH) with a wide variety of electrophilic compounds, including many mutagens, carcinogens, anticancer agents, and their metabolites (1-4, 6-13).

High GST Pi gene expression has been associated with malignant transformation, tumor drug resistance, and poor patient survival (9-17). In many human tumors and pre-neoplastic lesions, the GST Pi protein is over-expressed, even though in the corresponding normal tissues the protein either is absent or else is expressed at very low levels. The GST Pi gene has been mapped to a relatively small region of chromosome 11q13 in which is localized a number of cancer-associated genes and proto-oncogenes, including bcl1/prad1, int2, hstf1, and sea, some of which have been reported to be co-amplified with the GST Pi gene in some tumors (18, 19). In malignant gliomas, a positive correlation has been demonstrated between the level of GST Pi expression by immunocytochemistry and both the histological grade of the tumor and patient survival2 (19-21). Earlier data from our laboratory using human glioma cell lines have also shown an association between high GST Pi protein expression and 2-chloroethylnitrosourea resistance (22).

To date, the nucleotide sequences of the complete human GST Pi cDNA and GST Pi gene reported from different laboratories (23-26) have been identical, leading to the notion that only one human GST Pi gene exists (5). The isolation of two different GST Pi proteins from human placenta (27), however, strongly indicates that genetic polymorphism may exist in the human GST Pi gene locus. In the present study, we describe the isolation and molecular characterization of full-length cDNAs of three polymorphic GST Pi genes that are expressed in human malignant glioma cells and in other normal cells and tissues. The intracellular stabilities of the variant mRNAs were examined, and the proteins encoded by the variant cDNAs were expressed in Escherichia coli, purified by GSH affinity chromatography, and used in enzyme kinetic analyses to examine the functional consequences of the structural differences. Computer modeling was performed following introduction of the amino acid changes into the three-dimensional structure of the placental GST Pi protein that had been previously isolated and co-crystallized with S-hexylglutathione (28). The frequency of each of the gene variants in primary specimens and cell lines of malignant gliomas and in normal brain, normal placenta, and peripheral blood lymphocytes was investigated, and the concordance of the observed genotype and phenotype was determined by DNA- and RNA-PCR of representative specimens.


EXPERIMENTAL PROCEDURES

Cells, Tissues, and Reagents

Peripheral blood lymphocytes were isolated from the peripheral blood of healthy donors using a single step Ficoll-Hypaque gradient centrifugation (29). Full-term human placentas were obtained after normal vaginal delivery. Primary malignant glioma specimens were obtained incidental to surgery. All specimens were acquired on institutionally approved protocols. Glioma cell lines were established in our laboratories from primary specimens, as we previously described (30), and were in less than 40 in vitro passages. Unless otherwise stated, all chemicals were from Sigma. Restriction enzymes and biochemicals were from Boehringer Mannheim, and PCR reagents from Perkin-Elmer. Polyclonal antibodies against human GST Alpha, GST Mu, and GST Pi were obtained from Biotrin Inc. (Dublin, Ireland).

cDNA Library Synthesis and Screening

Polyadenylated RNA was purified on oligo(dT) cellulose columns from total RNA isolated from glioma cells by the acid guanidinium thiocyanate phenol-chloroform method (31) and used in lambda gt 11 cDNA library synthesis according to the modified procedure of Gubler and Hoffman (32), using the protocol of Clontech (Palo Alto, CA). After first and second strand cDNA synthesis, the cDNA pool was size-fractionated at a 500-bp cut-off to reduce the proportion of truncated GST Pi cDNAs. The double-stranded cDNAs were then blunt-ended with T4 DNA polymerase, methylated with EcoRI methylase, and ligated to EcoRI linkers. Following EcoRI digestion to remove excess linkers, the cDNAs were ligated into bacteriophage lambda gt 11 EcoRI arms and packaged using the Gigapack II Gold packaging extract (Stratagene, La Jolla, CA). Serial dilutions of the resulting cDNA library was screened using a rapid PCR screening procedure (33), which we had previously modified (34) by the use of the ExpandTM PCR system (Boehringer Mannheim). Positive cDNA pools were plated on E. coli strain Y109 Or-, screened with a 32P-labeled GST Pi cDNA probe, and GST Pi positive clones were amplified. The DNA was isolated, purified, and sequenced.

DNA Sequencing

Nucleotide sequencing was performed with the 35S-labeled dideoxynucleotide chain termination method (35) using the circumvent thermal cycle sequencing protocol (New England Biolabs, MA) either directly or after subcloning into Bluescript phagemid II. Sequencing primers were designed to overlap internal GST Pi cDNA regions as well as to the vector. Each clone was sequenced twice in both directions.

PCR

Amplification of GST Pi cDNAs for subcloning and for structural analyses was performed by PCR on templates of isolated GST Pi cDNAs or first strand cDNA synthesized from total RNA prepared, as described earlier, from cells and tissues. For the latter, first strand cDNA was synthesized by reverse transcription (RT) in a 20-µl reaction mixture containing 100 ng of reverse primer, 1 µg of total RNA, 250 µM dNTP, 3.2 mM sodium pyrophosphate, and 0.4 unit/ml each of placental RNase inhibitor and avian myeloblastosis virus reverse transcriptase. After 2 min at 94 °C, followed by 1 h at 42 °C, the mixture was heated to 95 °C for 2 min and rapidly cooled to 25 °C. The PCR reaction mixture contained approximately 200 ng of template cDNA (or 20 µl of the first strand cDNA reaction mixture), 500 ng of the appropriate forward and reverse GST Pi primers, 200 µM dNTP, 1.5 mM MgCl2, 0.025 unit/ml of Amplitaq polymerase and PCR buffer (to 100 µl). PCR amplification was performed for 34 cycles of 94 °C (1 min), 58 °C (2 min), and 72 °C (3 min).

Restriction Site Mapping of Variant GST Pi cDNAs

Computerassisted analysis of restriction endonuclease sites in the variant GST Pi cDNAs was used to identify restriction enzymes, which had gained or lost restriction motifs as a consequence of the nucleotide transitions identified from the sequence data of the cDNAs. From these, two low frequency cutting enzymes, MaeII and XcmI, were selected for restriction site mapping of the cDNAs. A 484-bp cDNA fragment, spanning positions +112 to +596 of the GST Pi cDNA, was amplified by RT-PCR from each specimen, as described earlier, using the primers: 5'-ACGTGGCAGGAGGGCTCACTC-3' (forward) and 5'-TACTCAGGGGAGGCCAGCAA-3' (reverse). The cDNA product was purified and after restriction with MaeII and XcmI was electrophoresed in 2% agarose and stained with 0.5 µg/ml ethidium bromide, and the restriction pattern was photographed under ultraviolet illumination. Fragment sizes were determined relative to marker DNA (phiX174 DNA-HaeIII digest) and the structures were confirmed, in representative cases, by nucleotide sequencing.

Southern Hybridization of GST Pi Gene Variants

Oligodeoxynucleotide probes were designed to cover the region +312 to +342 of the GST Pi cDNA and to contain the nucleotide changes specific to each of the GST Pi cDNAs. The probe sequences were: 5'-CATCTCCCTCATCTACACCAACTA-TGAGGCG-3' (hGSTP1*A), 5'-CG*TCTCCCTCATCTACACCAACTATGAGGCG-3' (hGSTP1*B), and 5'-CG*TCTCCCTCATCTACACCAACTATGAGGT*G-3' (hGSTP1*C). The asterisks indicate the transition nucleotides. Each probe was end-labeled with [gamma -32P]ATP to a specific activity of approximately 4 × 106 cpm/ml using T4 polynucleotide kinase. Southern hybridization was performed using standard methods (36) but at the higher, more stringent temperature of 65 °C. Following autoradiography photodocumentation, the membranes were stripped off the hybridized oligonucleotide probe and rehybridized with the next probe.

GST Pi Genotype Analysis

To determine the concordance between the GST Pi genotype and phenotype in a given specimen, we examined the nucleotide sequences of exons 5 and 6, which contained the nucleotide transitions observed in the GST Pi mRNA variants. For this, nine representative samples were selected to represent each of the three GST Pi mRNA variants. Using genomic DNA, a 305-bp DNA fragment spanning nucleotides +1219 to +1524 of the GST Pi gene and containing the entire exon 5 and its flanking regions in introns 4 and 6 as well as a 321-bp fragment spanning nucleotides +2136 to +2467 including all of exon 6 and its flanking regions in introns 5 and 7 were amplified by PCR. Primers for these amplifications were as follows: 5'-CCAGGCTGGGGCTCACAGACAGC-3' (forward) and 5'-GGTCAGCCCAAGCCACCTGAGG-3' (reverse) for exon 5 and 5'-TGGCAGCTGAAGTGGACAGGATT-3' (forward) and 5'-ATGGCTCACACCTGTGTCCATCT-3' (reverse) for exon 6.

Prokaryotic Expression of Variant GST Pi Proteins

Full-length cDNAs of the GST Pi gene variants were amplified by PCR from the respective GST Pi cDNA clones. To facilitate directional subcloning into the expression vector, forward and reverse primers were designed to contain restriction sites for EcoRI and XbaI at the 5'- and 3'-termini, respectively, of the resulting cDNA probes. Both restriction sites are absent in the GST Pi cDNA. After nucleotide sequencing to ensure the absence of PCR-induced mutations, the cDNA products were ligated into the pBK-CMV phagemid vector (Stratagene, La Jolla, CA), in which prokaryotic gene expression is driven by the lac promoter and eukaryotic expression by the immediate early CMV promoter. Strain XL1 Blue bacteria were transformed with the resulting cDNA constructs, screened for positive clones and bacterial cultures of these grown overnight in LB broth. Isopropyl-beta -thiogalactopyranoside was added to 1 mM in the last hour of culture. The bacteria were pelleted by centrifugation, resuspended in 50 mM Tris-HCl (pH 7.4) containing 2 µg/ml lysozyme for 1 h at 37 °C, and ultrasonicated. The crude homogenates were centrifuged at 30,000 × g for 20 min, and the supernatants were concentrated 10-fold by membrane filtration at a 10-kDa molecular mass cut-off. Protein content of the supernatants was determined (37) and GST enzyme activity was assayed as described previously (22) using CDNB as substrate. SDS-PAGE and Western blotting with polyclonal antibodies against human GST Alpha, Mu, and Pi were performed as described previously (22).

Purification and Enzyme Kinetic Analysis of Variant GST Pi Proteins

Functional consequences of the structural differences in the GST Pi variant proteins was determined by the differential ability of the recombinant GST Pi proteins to catalyze the conjugation of GSH with 1-chloro-2,4-dinitrobenzene (CDNB), a universal GST substrate. After expression in E. coli, the three GST Pi proteins were purified by GSH affinity chromatography on S-hexylglutathione linked to epoxy-activated Sepharose 6B as described previously (38) and then used for enzyme kinetic analysis.

For determining the enzyme kinetic constants for CDNB, reaction mixtures (25 °C) in 100 mM potassium phosphate buffer (pH 6.5) contained CDNB (over the range of 0.5-4 mM), 2.5 mM GSH, and 0.015 unit of purified GST Pi protein. Similar reaction mixtures were set up for determining the Km of GSH as a co-substrate, except that the concentration of GSH was varied from 0 to 5 mM, with the concentration of CDNB maintained at 0.1 mM. Changes in absorbance were monitored at 340 nm over two minutes in a Beckman DU 60 spectrophotometer equipped with a kinetic module and used to compute reaction rates. The rates of the spontaneous reactions of GSH with CDNB, determined with reaction mixtures in which the GST Pi enzyme was replaced with buffer, were subtracted from the rates of the enzyme catalyzed reactions. The resulting reaction rates were used to generate double reciprocal plots. Km, Vmax, and Kcat values were determined using standard methodology (39).

Computer Structural Modeling of Variant GST Pi Proteins

To determine possible effects of the amino acid changes on the three-dimensional architecture of the three GST Pi proteins, the x-ray crystallographic co-ordinates (2.8 Å resolution) of the placental GST Pi (GSTP1a) co-crystallized with S-hexylglutathione (28) were imported from the Brookhaven Protein Data Bank into the SYBYL molecular modeling program (version 6.2, 1995; Tripos Associates, St. Louis, MO) running on a Silicon Graphics Indigo 2 workstation (IRIX 5.2, 64 MB). GSTP1b was created by substituting Ile with Val at amino acid residue 104, and GSTP1c was obtained by substituting Val for Ile at amino acid residue 104 and Val for Ala at 113, using the SYBYL BIOPOLYMER module. Each monomeric subunit of 209 amino acids was energy minimized using the amber all-atom force field in SYBYL. The energy minimized structures were superimposed using the match function of SYBYL. Changes in atomic co-ordinates and in interside chain distances of amino acid residues lining the putative H-site were examined to determine how these structural changes might predict changes in functional activity.

Stability of Variant GST Pi Gene Transcripts

Transcriptional block by actinomycin D has been shown in previous studies to be a reliable method with which to determine mRNA turnover and stability in cells (40). We therefore applied this technique to investigate differences in the intracellular stability of the transcripts of the different GST Pi genes. Three glioma cell lines expressing different GST Pi gene variants were grown to approximately 70% confluency and then refed with fresh culture medium containing 5 µg/ml actinomycin D. Controls were similarly set up but without actinomycin D treatment. At 0, 6, 12, and 24 h after actinomycin D exposure, total RNA was isolated from each culture and electrophoresed as described earlier at 7.5 µg of RNA/lane. After electrophoresis, the gels were stained with ethidium bromide, viewed under ultraviolet light to ensure equal RNA loading of the lanes, and transferred to nylon filters. Northern hybridization for GST Pi transcript levels was performed as described previously. Hybridization bands were quantitated by densitometry and plotted against time.

Thermostability of Variant GST Pi Proteins

To further determine the effects of the amino acid changes on the variant GST Pi proteins, we compared the thermal stabilities of the enzymatic function of the three variant GST Pi proteins based in part on the expected differences in alpha -helix stability of the region of the GST Pi peptides containing the amino acid changes and on a previous study (41) that showed that a recombinant GST Pi enzyme corresponding to GSTP1b-1b, created by site-directed mutagenesis, was functionally more heat-stable than the parent enzyme. Each variant GST Pi protein was incubated at approximately 0.1 unit/ml at 45 °C in phosphate-buffered saline (pH 7.2) in a water bath. Every 15 min, over 1 h, a 50-µl aliquot was removed from each incubate, and total GST activity was determined as described previously using CDNB as substrate. Residual GST activity was computed relative to the activity of controls maintained at 25 °C and plotted against time. SDS-PAGE and Western blotting were performed as described earlier to determine if degradation of the GST Pi peptides had occurred during the incubation.


RESULTS

Isolation and Sequencing of Variant GST Pi cDNA Clones

We analyzed approximately 3 × 106 plaque forming units of each cDNA library using the rapid PCR procedure and obtained GST Pi positive clones, from which selected clones were subjected to secondary and tertiary screening and subsequent sequencing. Three clones, Pi 3A-7, Pi 3B-2, and Pi 3C-9, corresponding to each of three GST Pi mRNA variants, were obtained containing full-length GST Pi cDNAs and including both 5'- and 3'-termini. The cDNAs were designated hGSTP1*A, hGSTP1*B, and hGSTP1*C, in accordance with the proposed nomenclature for allelic GST gene variants (5). The nucleotide transitions giving rise to the three cDNA variants are shown in the sequence autoradiographs in Fig. 1 . The sequencing strategy is shown in Fig. 2A, and the complete nucleotide and deduced amino acid sequences of the cDNAs are shown in Fig. 2B. Each cDNA contained an open reading frame of 630 nucleotides, encoding 210 amino acids, including the initiating methionine. hGSTP1*A was completely identical in nucleotide sequence to the previously reported human GST Pi cDNA (23, 24). It consisted of 712 nucleotides, of which 9 were in the 5' noncoding region. hGSTP1*B differed from hGSTP1*A by having an A right-arrow G transition at nucleotide +313, thus changing codon 104 from ATC (Ile) right-arrow GTC (Val). Of the 719 nucleotides, 12 were in the 5' noncoding region. hGSTP1*C was characterized by two active nucleotide transitions, the A right-arrow G transition at +313 observed in hGSTP1*B and a C right-arrow T transition at +341, resulting in changes of ATC (Ile) right-arrow GTC (Val) GTC in codon 104 and of GCG (Ala) right-arrow GTG (Val) in codon 113. hGSTP1*C consisted of 723 nucleotides, 13 of which were 5' of the ATG start codon. The 3' noncoding regions of all three cDNAs were similar and contained the AATAAA polyadenylation signal at +689 to +696. In 8 cases examined, there was complete concordance between the nucleotide sequences of exons 5 and 6 in the genomic DNA and that of the corresponding regions of the mRNA. In addition to the transitions at nucleotide positions +313 and +341, a silent C right-arrow T transition at +555 was observed in hGSTP1*B and hGSTP1*C. This transition, also previously observed in the GST Pi cDNA isolated by Moscow et al. (24), does not alter the encoded amino acid (serine) in the affected codon 185. 


Fig. 1. Sequence autoradiographs of cDNA regions containing nucleotide transitions in variant GST Pi cDNAs, namely, hGSTP1*A with A at +313 and C at +341, hGSTP1*B with an A right-arrow G transition at +313, and hGSTP1*C with an A right-arrow G transition at +313 and a C right-arrow T transition at +341. The cDNAs were isolated by a rapid PCR screening of cDNA libraries prepared as described in the text. Nucleotide sequencing was performed by the 35S-labeled dideoxynucleotide chain termination method.
[View Larger Version of this Image (57K GIF file)]



Fig. 2. A, strategy used to obtain the entire nucleotide sequences of the three GST Pi cDNA variants. The arrows indicate both the directions and the regions sequenced. B, nucleotide and deduced amino acid sequences of full-length GST Pi cDNAs. The sequences were obtained from clones Pi 3A-7 (hGSTP1*A), Pi 3B-2 (hGSTP1*B), and Pi 3C-9 (hGSTP1*C). Nucleotide position +1 is assigned to the first nucleotide of the initiating ATG codon. Nucleotides identical to all three cDNAs are given once and only for hGSTP1*A. The transition nucleotides and the altered codons are in bold type. The polyadenylation signal sequences present in all three cDNAs is underlined. Codons are numbered beginning with the first one after the ATG start codon.
[View Larger Version of this Image (49K GIF file)]


Restriction Endonuclease Mapping

The partial restriction endonuclease maps of the 484-bp cDNA region containing the nucleotide transitions in the three GST Pi cDNAs are shown in Fig. 3A. The A right-arrow G transition at +313 created a MaeII recognition sequence (A'CGT) in hGSTP1*B and hGSTP1*C, whereas the C right-arrow T transition at +341 resulted in the gain of an XcmI recognition sequence (CCANNNNN'NNNNTGG) in hGSTP1*C. The 484-bp GST Pi cDNA was amplified by RNA-PCR from representative normal and malignant specimens and after purification was subjected to MaeII or XcmI digestion. As expected from the restriction map (Fig. 3A), MaeII or XcmI did not restrict the cDNAs from specimens that express hGSTP1*A alone (lanes 1, 2, 3, and 8), because both restriction endonuclease sites are absent in this cDNA variant. However, following MaeII digestion, cDNAs from specimens that expressed hGSTP1*B (lane 6) and hGSTP1*C genes (lane 9) alone were cleaved completely to yield the two fragments, 199 and 285 bp in size, as expected from the restriction endonuclease map in Fig. 3A. Similarly, XcmI digestion of hGSTP1*C cDNA (lane 9) yielded the expected 224- and 260-bp fragments. In contrast to the specimens that expressed only one GST Pi gene variant, specimens expressing two different GST Pi genes yielded, upon digestion of their cDNAs with MaeII or XcmI, restriction fragments representative of the mixture of mRNAs. Thus, cDNA from specimens that express a mixture of hGSTP1*A and hGSTP1*B genes (lane 5) is partially restricted by MaeII and is unrestricted by XcmI. On the other hand, cDNAs from specimens expressing a mixture of hGSTP1*A and hGSTP*1C genes (lanes 4, 7, and 10) are partially restricted by both MaeII and XcmI. Fig. 4 shows nucleotide sequence autoradiographs obtained by direct sequencing of cDNAs obtained by RT-PCR from specimens expressing a mixture of hGSTP1*A and hGSTP1*B (left panel) and hGSTP1*A and hGSTP1*C (right panel).


Fig. 3. A, MaeII and XcmI restriction endonuclease maps of variant GST Pi cDNAs. A 484-bp cDNA was designed to include the region containing the nucleotide transitions giving rise to the variant GST Pi mRNAs, such that cleavage of hGSTP1*B and hGSTP1*C cDNA variants with MaeII would yield two fragments, 199 and 285 bp in size, and digestion of the hGSTP1*C cDNA with XcmI yields 224- and 260-bp fragments. hGSTP1*A is not cleaved by either enzyme. B, total RNA was isolated from different specimens, and the 484-bp cDNA fragment described above was amplified by RNA-PCR, purified, and restricted with MaeII or XcmI. After electrophoresis in 2% agarose and staining with 0.5 µg/ml ethidium bromide, the restriction patterns were photographed under UV illumination. The gene variants in the lanes are: hGSTP1*A, lanes 1-3 and 8; hGSTP1*B, lane 6; hGSTP1*C, lane 9; hGSTP1*A + hGSTP1*B, lane 5; and hGSTP1*A + hGSTP1*C, lanes 4, 7, and 10. The cells and tissues in the lanes were: lanes 1-4, normal lymphocytes; lanes 5 and 6, placenta; and lanes 7-10, gliomas.
[View Larger Version of this Image (46K GIF file)]



Fig. 4. Nucleotide sequence autoradiographs of cDNAs from glioma specimens expressing a mixture of GST Pi genes. Left panel, hGSTP1*A and hGSTP1*B. Right panel, hGSTP1*A and hGSTP1*C. The cDNAs were generated by RNA-PCR performed with total RNA from each specimen. The RNA was purified and subjected to direct nucleotide sequencing, as described in the text.
[View Larger Version of this Image (49K GIF file)]


Detection of Expressed GST Pi Genes by Southern Hybridization

The results of the Southern hybridizations of the cDNAs generated by RT-PCR from specimens expressing different GST Pi genes are shown in Fig. 5. The lane designations are: lanes 1 and 2, hGSTP1*A; lane 3, hGSTP1*B; lane 4, hGSTP1*A and hGSTP1*C; lanes 5 and 6, hGSTP1*C. Oligonucleotide probes specific for both hGSTP1*A and hGSTP1*C genes hybridized strongly to their respective target DNAs. When either of the two GST Pi gene variants was expressed alone in a given specimen, as in lanes 1 and 2 (hGSTP1*A) and lanes 5 and 6 (hGSTP1*C), no significant cross-hybridization with each other's specific probe was observed. In contrast, GSTP1*B (lane 3) hybridized not only to its own specific probe but also to the probes specific for hGSTP1*A and hGSTP1*C. Similar to its target DNA, the hGSTP1*B specific probe also showed little specificity and hybridized to all three GST Pi DNA variants as shown by the positive bands in lanes 1-6 of Fig. 5 (second row of Southern blots). These results demonstrate that under our hybridization conditions hGSTP1*A and hGSTP1*C can be detected by Southern analysis with specific oligonucleotide probes but that detection of hGSTP1*B is limited by a high degree of probe and DNA target cross-hybridization, possibly because hGSTP1*B differs from hGSTP1*A and hGSTP1*C by only one nucleotide, whereas the latter two differ from each other by two nucleotides.


Fig. 5. Southern hybridization of variant GST Pi cDNAs from representative gliomas. Total RNA was isolated from the specimens, and the full-length GST Pi cDNA amplified by PCR. After electrophoresis in 2% agarose and transfer onto filters, the cDNAs were hybridized successively with oligonucleotide probes specific to the different GST Pi gene variants. Membranes were first hybridized with the hGSTP1*A-specific probe, as described in the text. After autoradiography, the membranes were stripped of the probe, and the hybridization was repeated with the hGSTP1*B- and hGSTP1*C-specific probes, successively. The lanes contain cDNAs from specimens expressing hGSTP1*A (lane 1), both hGSTP1*A and hGSTP1*B (lane 2), hGSTP1*B (lanes 3), both hGSTP1*A and hGSTP1*C (lane 4), and hGSTP1*C (lanes 5 and 6).
[View Larger Version of this Image (58K GIF file)]


Expression, Purification, and Functional Analysis of Variant GST Pi Proteins

The GST Pi peptides encoded by the three GST Pi genes were designated GSTP1a, GSTP1b and GSTP1c, as previously recommended (5). The cDNAs were expressed in E. coli, and the expressed proteins were purified by GSH affinity chromatography. We achieved approximately a 200-fold purification for all three GST Pi proteins, with yields of 78, 63, and 72% for GSTP1a-1a, GSTP1b-1b, and GSTP1c-1c, respectively. Lanes a, b, and c in panels A, B, and C of Fig. 6 represent the proteins encoded by hGSTP1*A, hGSTP1*B, and hGSTP1*C, respectively. SDS-PAGE of each isolated protein showed a single band after Coomassie Blue staining (Fig. 6B), and Western analysis showed that they were all immunoreactive with anti-GST Pi antibodies (Fig. 6C) but not with antibodies against GST Mu or GST Alpha (data not shown). The enzyme kinetic analysis of the GSH affinity purified recombinant proteins yielded, for CDNB, Km and Vmax values of 0.98 mM ± 0.06 and 62.53 ± 5.3 µmol·min-1·mg-1, respectively, for GSTP1a-1a, 2.7 ± 0.23 mM and 50.25 ± 4.8 µmol·min-1·mg-1 for GSTP1b-1b, and 3.1 ± 0.17 mM and 53.81 ± 6.3 µmol·min-1·mg-1 for GSTP1c-1c. For the co-substrate GSH, the Km values were 0.45 ± 0.05, 0.42 ± 0.03, and 0.51 ± 0.06 mM, respectively, for GSTP1a-1a, GSTP1b-1b, and GSTP1c-1c. Kcat (CDNB) values were 53.99 ± 5.1 s-1, 45.1 ± 3.3 s-1, and 41.01 ± 4.7 s-1, respectively, for GSTP1a-1a, GSTP1b-1b, and GSTP1c-1c. The utilization ratio (Kcat/Km) of GSTP1a-1a was 3- and 4-fold higher than that for GSTP1b-1b and GSTP1c-1c, respectively. These results are summarized in Table I.


Fig. 6. E. coli were transformed with the pBK-CMV phagemid eukaryotic expression vectors, each containing a different GST Pi cDNA variant. Lysates from overnight bacterial cultures, containing 1 mM isopropyl-1-thio-beta -D-galactopyranoside in the last hour of culture, were lysed and subjected to GST purification by GSH affinity chromatography. A and B show Coumassie Blue-stained SDS-PAGE gels of crude bacterial lysates (A) and GSH affinity purified GSTs (B). C shows Western blotting of the purified GSTs using antibodies raised against human placental GST Pi. The lanes a, b, and c contain proteins encoded by hGSTP1*A, hGSTP1*B, and hGSTP1*C, respectively. In C, the lane designated HP contains purified human placental GST Pi as a control.
[View Larger Version of this Image (74K GIF file)]


Table I.

Enzyme kinetics of recombinant variant GST Pi proteins

Each protein was isolated by GSH affinity chromatography and examined for its ability to catalyze the conjugation of GSH with CDNB. The reactions were performed at 25 °C in 0.1 M potassium phosphate buffer. Km for GSH was at 0-5 mM GSH and 1 mM CDNB. Km and Vmax for CDNB were determined over a concentration of 0-5 mM CDNB and 2.5 mM GSH.


GST-pi protein variant Km (GSH) Km (CDNB) Vmax Kcat/Km

mM µmol · min-1 · mg-1 mM-1 · s-1
GSTP1a-1a 0.45  ± 0.05 0.98  ± 0.06 62.53  ± 8.7 55.10  ± 4.6
GSTP1b-1b 0.42  ± 0.03 2.7  ± 0.23 53.25  ± 4.8 16.67  ± 1.4
GSTP1c-1c 0.51  ± 0.06 3.1  ± 0.17 50.81  ± 6.3 13.23  ± 1.7

Structural Analysis of Variant GST Pi Proteins

Data from the previously reported x-ray crystallographic structure of GSTP1a (28, 45) have shown the key amino acid residues lining the putative H-site of human placental GST Pi to consist of Tyr7, Tyr108, Val10, Val35, Phe8, and Gly205. We modeled the effects of the amino acid substitutions in the variant GST Pi proteins on the structure of the resulting peptides, particularly in the H-site pocket. The superimposed energy-minimized structures of the H-site region are shown in Fig. 7A for GSTP1a and GSTP1b and in Fig. 7B for GSTP1a and GSTP1c. The substitutions of Val104 right-arrow Ile104 in GSTP1b and GSTP1c and of Val113 right-arrow Ala113 in GSTP1c caused significant deviations in the atomic co-ordinates of side chains of the key H-site residues (Table II). The deviations caused by the Val104 for Ile104 substitution are magnified in the same direction as but to a lesser degree than those caused by the Ala113 to Val113 substitution. The highest deviations involved the side chains of Tyr108 and Tyr7, which, relative to GSTP1a, had shifted by 0.153 and 0.116 Å in GSTP1b and 0.242 and 0.185 Å in GSTP1c. Phe8 was the least affected by the amino acid changes. Overall, the deviations in atomic co-ordinates in the active site residues were larger going from GSTP1a to GSTP1c than from GSTP1b to GSTP1c.


Fig. 7. Superimposed energy-minimized three-dimensional architecture of the H-site region of the GSTP1a (blue), GSTP1b (red), and GSTP1c (black), showing the deviations in the amino acid side chains relative to each other. GSTP1b and GSTP1c were created by substituting Val104 for Ile104 and both Ile104 and Ala113 with Val, respectively, in the x-ray crystallographic structure of the human placental GSTP1a (28, 45), imported from the Brookhaven Protein Data Bank. The structural modeling was performed using the SYBYL molecular modeling program.
[View Larger Version of this Image (23K GIF file)]


Table II.

Deviations in atomic co-ordinates of key amino acid side chains in H-site amino acid residues of variant GST Pi peptides

GSTP1b was created by substituting Val104 for Ile104, and GSTP1c by substituting both Ile104 and Ala113 with Val in the x-ray crystallographic structure of the human placental GSTP1a, co-crystallized with S-hexylglutathione (28, 45). The resulting three-dimensional structures were energy minimized. The reference group of the amino acid side chain is in parenthesis, and the reference atom is boldfaced and underlined. The reference CH3 for Val10 is the one proximal to Phe8, and for Val35, it is the one proximal to Val10 in Fig. 7.


Position in GSTP1a Co-ordinate deviation
GSTP1b GSTP1c

Å
Tyr108 (H) 0.153 0.242
Val10 (H3) 0.099 0.188
Phe8 (Ph-4) 0.034 0.098
Tyr7 (H) 0.116 0.185
Val35 (H3) 0.101 0.133
Pro11 (beta -H2) 0.108 0.126

Changes in interside chain distances within the three-dimensional structure of the variant peptides are summarized in Table III, and are also evident in Fig. 7 (A and B). The distances between the residues Tyr108 and Val10 and between Tyr108 and Val35 decreased progressively going from GSTP1a to GSTP1b and GSTP1c. From the superimposed structures in Fig. 7 (A and B), it is apparent that in GSTP1b and GSTP1c, the methyl group of Val104 proximal to Tyr108 is closer to several of the putative H-site residues than is the secondary methyl group of Ile104 in GSTP1a. The orientation of the methyl group of Val104 in GSTP1b and GSTP1c toward Tyr108 causes a decrease in the distances between Val104 and both Val10 and Val35 and a restriction of the region of the active site bordered by Tyr108, Val10, and Val35. The replacement of Ile104 with the less bulky Val104 also opens up the region lined by Tyr7, Tyr10, and Phe8. The distances between side chains of the paired residues Tyr7 and Val10 is shorter in GSTP1a than in both GSTP1b and GSTP1c, whereas the distances between Tyr7 and Tyr108 and between Tyr7 and Phe8 are longer.

Table III.

Changes in interside chain distances of amino acid residues lining the H-site of variant GST Pi peptides

GSTP1b and GSTP1c were created by amino acid substitutions in the x-ray crystallographic structure of GSTP1a, and energy was minimized, as described in the text. The distances are those between the closest atom pair (one in each side chain).


H-site amino acid residue Interside chain distance
GSTP1a GSTP1b GSTP1c

Å
Tyr108 and Val10 4.358 4.211 4.156
Tyr108 and Val35 8.883 8.683 8.638
Tyr7 and Val10 2.489 2.613 2.660
Tyr7 and Tyr108 9.761 9.751 9.715
Tyr7 and Phe8 2.958 2.936 2.935

Intracellular Stability of Variant GST Pi mRNAs

The intracellular decay of the three variant GST Pi mRNAs in malignant glioma cell lines, each of which expressed different GST Pi mRNAs, was determined following inhibition of de novo RNA synthesis by exposure of the cells to actinomycin D. The decay curves (Fig. 8) showed only a modest difference in the intracellular stabilities of transcripts of the three variant GST Pi genes under these conditions. The decay of the GST Pi message in each cell line followed first order kinetics with half-lives of 9.4, 14.1, and 11.8 h for hGSTP1*A, hGSTP1*B, and hGSTP1*C mRNA, respectively.


Fig. 8. Intracellular stability of variant GST Pi mRNAs. Cells expressing different GST Pi gene variants were treated with 5 µg/ml actinomycin D to block de novo RNA synthesis, and at various time-points over 48 h, total RNA was isolated and subjected to Northern blotting. The cell lines each expressed only one GST Pi mRNA variant. The decay of the mRNA followed first order kinetics and the half-life (t1/2) of each protein was computed from the slope of the curves (k) using the equation t1/2 = 0.693/k.
[View Larger Version of this Image (17K GIF file)]


Thermostability of Variant GST Pi Proteins

The time-dependent loss of enzymatic activity of the three variant recombinant GST Pi proteins at 45 °C followed first order kinetics and was relatively rapid. As summarized in Fig. 9, the rates of decay of GST enzyme activity was significantly different between the three GST Pi variant proteins. The decay rates were 1.81·h-1 for GSTP1a-1a, 1.01·h-1 for GSTP1b-1b, and 0.89·h-1 for GSTP1c-1c, with half lives of 23, 47, and 51 min, respectively. SDS-PAGE and Western blotting showed no detectable degradation in the GST peptides associated with the loss in enzyme activity under these conditions.


Fig. 9. Thermal stability of variant GST Pi proteins. Recombinant GSTP1a-1a, GSTP1b-1b, and GSTP1c-1c expressed in E. coli and purified by GSH affinity chromatography. 0.1 unit/ml GST was incubated at 45 °C in phosphate-buffered saline (pH 7.2). Every 15 min, over 1 h, residual GST activity was determined as described in the text using CDNB as substrate.
[View Larger Version of this Image (18K GIF file)]


Expression and Distribution of Variant GST Pi mRNA in Normal Cells, Tissues, and Tumors

The frequencies with which the three GST Pi gene variants were observed in malignant gliomas and normal specimens (lymphocytes and placentas) are summarized in Table IV. The frequency of hGSTP1*A homozygosity was 0.22 for gliomas compared with 0.51 for normal specimens. In contrast, hGSTP1*C homozygosity was at a frequency of 0.07 in normal specimens and 0.25 in gliomas. hGSTP1*A/hGSTP1*C heterozygosity was observed at frequencies of 0.34 for gliomas and 0.09 for normal specimens. Thus, overall, hGSTP1*C was present at a frequency of 0.59 in gliomas compared with 0.16 in normal specimens. Two of 43 normal specimens and none of the gliomas were homozygous for hGSTP1*B. However, the frequency of hGSTP1*A/hGST1*B heterozygosity was significantly higher, 0.19 in gliomas and 0.28 in normal specimens, respectively. None of the 75 specimens were heterozygous for hGSTP1*B and hGST1*C. These differences between gliomas and normal specimens in the frequency of expression of the variant GST Pi gene variants are statistically significant (p value = 0.001) by the Fisher exact test.

Table IV.

Distribution frequency of polymorphic GST Pi gene variants among normal specimens (peripheral blood lymphocytes, normal brain, and placenta) and malignant gliomas

The Fisher exact test showed a statistically significant (p value = 0.0001) difference in the frequency of the gene variants between malignant gliomas and normal specimens.


GST Pi gene variant Frequency of expressed GST Pi gene variant
All Specimens
Gliomas
Normal
Tumor: Normal
n Frequency n Frequency n Frequency

hGSTP1*A 29 /75 0.39 7 /32 0.22 22 /43 0.51 0.43
hGSTP1*B 2 /75 0.027 0 /32 0 2 /43 0.05
hGSTP1*C 11 /75 0.15 8 /32 0.25 3 /43 0.07 3.6
hGSTP1*A + hGSTP1*B 18 /75 0.24 6 /32 0.19 12 /43 0.28 0.68
hGSTP1*B + hGSTP1*C 0 /75 0 0 /32 0 0 /43 0
hGSTP1*A + hGSTP1*C 15 /75 0.20 11 /32 0.34 4 /43 0.09 3.80


DISCUSSION

Amino acid sequence analyses of GST Pi proteins isolated from human placenta have indicated the existence of at least two variant GST Pi proteins, one with Ile and the other with Val at codon 104 (27). Despite these findings, the complete GST Pi cDNA and gene isolated by different laboratories (23-26) have been identical, both in nucleotide sequence and in the sequence of the encoded peptide. This study describes for the first time the isolation and characterization of three different full-length GST Pi cDNA variants corresponding to mRNAs of GST Pi genes expressed in human cells and tissues and provides conclusive molecular evidence for polymorphism of the human GST Pi gene locus. The presence and expression of the variant GST Pi genes in both normal and malignant specimens indicate that they represent allelopolymorphism of the GST Pi gene locus, rather than tumor-associated or random mutations. One of the placental tissues examined in this study expressed hGSTP1*B exclusively. In a prior report (27), a GST Pi protein was isolated from human placenta and shown to have the same amino acid sequence as that encoded by hGSTP1*B. However, because neither the gene encoding this GST Pi peptide nor the cDNA corresponding to its mRNA had been identified, it was inconclusive as to whether this protein was the result of a point mutation in the GST Pi gene or represented a naturally occurring polymorphism of the GST Pi gene. Similarly, until now, there had been no report of the isolation of the full-length hGSTP1*C cDNA or gene, although a truncated cDNA encoding 176 amino acids of the N terminus of a peptide homologous to hGSTP1*C had been described (42). Comparison of the nucleotide sequences of the human GST Pi cDNAs reported here with that of the rat orthologue, GSTP (43), showed codons 104 and 113 to be among those altered in the GST Pi cDNAs of the two species, with changes from human to rat of Ile104 right-arrow Gly104 and Ala113 right-arrow Asn113, suggesting that these positions are among the evolutionarily least conserved in the GST Pi gene.

Our data show that the alterations in restriction endonuclease sites caused by the nucleotide transitions in the GST Pi gene variants provide a simple, rapid, and specific technique for determining the GST Pi gene variant(s) expressed in cells and tissues. The method is suitable for screening large numbers of specimens. Alternatively, GST Pi phenotype/genotype can be determined by Southern or Northern hybridizations with oligonucleotide probes specific for the different genes, as was also demonstrated in this study. However, because of cross-hybridization, the specificity of the latter procedure is limited, particularly for differentiating hGSTP1*B from the other two GST Pi gene variants. Furthermore, Southern hybridization is not suitable for detection of mixtures of GST Pi genes in a single specimen. Genotype analysis is best achieved by restriction mapping, single strand conformational analysis3 and nucleotide sequence determination. In the absence of variant specific antibodies, GST Pi phenotype is best determined by RT-PCR of the polymorphic region, followed by restriction site mapping and/or sequencing of the resultant cDNA as described in this study. In this regard, it is an advantage that transcripts of the three variant GSTP1 genes were found to be relatively stable intracellulary, with half-lives of the mRNAs between 9.4 and 11.8 h, which are slightly longer than those previously reported for GST Pi transcripts in other cell types (44).

The Km (CDNB) of GSTP1a-1a observed in this study for the conjugation of GSH with CDNB was approximately 3-fold lower than that of either GSTP1b-1b or GSTP1c-1c. The Km for the co-substrate GSH, on the other hand, did not differ significantly between the variant GST Pi proteins. These results are similar to those in a previous report in which a recombinant GSTP1b-1b protein expressed from a cDNA obtained artificially by site-directed mutagenesis of hGSTP1*A, was shown to have a 4-fold higher Km (CDNB) than the hGSTP1*A encoded protein (41). At high substrate (CDNB) concentration, Vmax of the reaction catalyzed by all three GST Pi proteins differed only modestly and was in the range reported in other studies of both tissue and recombinant GST Pi proteins (41, 45-47). Kcat for CDNB was also similar for all three proteins, thus resulting in utilization ratios, Kcat/Km, for GSTP1b-1c and GSTP1c-1c that were 3.3- and 4-fold lower, respectively, than that of GSTP1a-1a. These data indicate that the process of conjugation of GSH with CDNB was unaffected by the amino acid substitutions in the proteins, as was previously observed with recombinant GSTP1a-1a and GSTP1b-1b (41), but that the catalytic center activity was significantly higher for GSTP1a-1a than for GSTP1b-1c and GSTP1c-1c.

The functional differences between the variant GST Pi proteins observed in the enzyme kinetic studies are supported by the results of the analyses of the three-dimensional structures obtained by modeling the amino acid substitutions into the crystal structure of the GST Pi peptide. These data suggest that the functional consequences of the nucleotide transitions are at least in part the result of steric effects caused by the resultant changes of Ile104 to Val104 and of Ala113 to Val1113 in the GST Pi H-site. The Ile104 right-arrow Val104 substitution in GSTP1b-1b and GSTP1c-1c caused significant shifts in the side chains of several active site amino acid residues and resulted in a steric restriction of the region of the H-site bordered by Tyr108, Val35, Val10, and to a lesser extent Phe8, while opening up the region bordered by Tyr7 and Val10. These findings suggest that bulky substrates may fit better in the space lined by these residues and Ile104, whereas less bulky ones may bind better in the larger space lined by Val104 and might explain previous findings that the Km of GSTP1a-1a for CDNB was lower than that for GSTP1b-1b, whereas the opposite was true for the bulkier bromosulphthalein (41). Additional structural deviations were observed with the amino acid changes of alanine to valine at codon 113 in hGSTP1c-1c; however, these were of a lower magnitude than the codon 104 changes and did not have a major additional impact in catalyzing the GSH-CDNB conjugation reaction.

An additional basis for the functional differences observed between the variant GST Pi proteins could reside in the fact that domain II of the GST Pi peptide in which the H-site is localized, contains five alpha -helices, two of which, alpha D (AA81-107) and alpha E (AA109-132), contain the amino acid substitutions of Ile104 right-arrow Val104 and Ala113 right-arrow Val113 (28, 48). A right-handed superhelix exists in this region, generated in part by an up-down arrangement of alpha D and alpha E and a cross-over connection between alpha E and a third helix, alpha F to form a superhelix (28, 48). In a previous study, it had been shown that the thermodynamic propensities of Ile, Ala, and Val to contribute to the alpha -helical structure in a protein differ significantly (49), as indicated by the computed free energy, Delta Delta G, when the protein folds to the native alpha -helix structure. Consequently, the changes of Ile or Ala to Val could result in subtle alterations in the alpha -helical and/or superhelical structure that can affect H-site architecture and ultimately result in differences in substrate binding affinities and catalytic activities between the GST Pi enzymes. This will be consistent with the different enzyme kinetic data observed for the variant proteins in this study. At 45 °C, the enzymatic activity of recombinant GSTP1a-1a was lost at a rate significantly faster than that of GSTP1b-1b or GSTP1c-1c, as had been previously reported for GSTP1a-1a and GSTP1b-1b (41). We speculate that this might be due to differential H-site stability due to differences in the free energy, Delta Delta G, of the a-helix formed with the different amino acids at codons 104 and 113 at the higher temperature.

The 4-fold higher frequency of hGSTP1*C observed in malignant gliomas than in normal tissues warrant further studies to determine if this represents clonal selection or a loss of heterozygosity associated with the malignant process and whether a similar high hGSTP1*C frequency is present in other tumor types, such as breast carcinoma, in which GST Pi expression is not only high but is also associated with poor prognosis. In contrast to the other two GST Pi genes, hGSTP1*B appears to be a relatively rare allele, and intriguingly, none of the specimens examined was heterozygous for hGSTP1*B and hGSTP1*C. The functionally different GST Pi proteins may provide a mechanism for fine tuning/regulation of cellular GST Pi function, and as such, because of the similar catalytic properties of GSTP1b-1b and GSTP1c-1c, no biological advantage exists in co-expressing these two GST Pi proteins in a single cell or tissue. It will be interesting, in future studies, to determine whether the different GST Pi peptides dimerize to yield GST Pi proteins with different catalytic activities for different substrates.

It is reasonable to expect that the ability of the variant GST Pi proteins to catalyze the conjugation of different mutagens, carcinogens, and alkylating anticancer agents with GSH will differ; however, the contribution of this to the biological behavior, therapeutic response of gliomas, and increased cancer risk remains to be determined. Since the isolation of the cDNA variants reported in this study, we have also isolated and characterized the complete hGSTP1*C gene from a cosmid genomic library of a glioblastoma cell line (GenBankTM/EMBL Data Bank accession number U21689[GenBank]). We believe that the findings and the data presented in this report represent an important advance in the study of this important gene and of its function and its role in human malignancy.


FOOTNOTES

*   This work was supported by Grants CA55835 and CA55261 from NCI, National Institutes of Health and by a research grant award from the Kleberg Foundation.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) U30897[GenBank] and U62589[GenBank].


§   To whom correspondence should be addressed. Tel.: 713-0792-3495; Fax: 713-794-5514.
1   The abbreviations used are: GST, glutathione S-transferase; GSH, glutathione; CDNB, 1-chloro-2,4-dinitrobenzene; PCR, polymerase chain reaction; H-site, electrophile-binding active site; bp, base pair(s); RT, reverse transcription; PAGE, polyacrylamide gel electrophoresis.
3   F. Ali-Osman and L. Pleasants, manuscript in preparation.
2   F. Ali-Osman, J. M. Bruner, T. Cutluk, K. Hess, manuscript in preparation.

REFERENCES

  1. Mannervik, B. (1985) Adv. Enzymol. 57, 357-417
  2. Mannervik, B., and Danielson, U. G. H. (1988) CRC Crit. Rev. Biochem. 23, 283-337 [Medline] [Order article via Infotrieve]
  3. Pickett, C. B., and Lu, A. Y. H. (1989) Annu. Rev. Biochem. 58, 743-764 [CrossRef][Medline] [Order article via Infotrieve]
  4. Daniel, V. (1993) Crit. Rev. Biochem. Mol. Biol. 28, 173-207 [Medline] [Order article via Infotrieve]
  5. Mannervik, B., Awasthi, Y. C., Board, P. G., Hayes, J. D., Illio, C. D., Ketterer, B., Listowsky, L., Morgenstern, R., Muramatsu, M., Pearson, W. R., Pickett, C. B., Sato, K., Widerstern, M., and Wolf, C. R. (1992) Biochem. J. 282, 305-307
  6. Boyland, E., and Chasseaud, L. F. (1969) Adv. Enzymol. 32, 173-219
  7. Coles, S., and Ketterer, B. (1980) CRC Crit. Rev. Biochem. Mol. Biol. 25, 47-70
  8. Ketterer, B, and Sies, H. (1987) Glutathione Conjugation. Mechanisms and biological significance., Academic Press, London, San Diego, New York
  9. Sato, K. (1989) Advances in Cancer Res. 52, 205-255 [Medline] [Order article via Infotrieve]
  10. Morrow, C. S., and Cowan, K. H. (1990) Cancer Cells 2, 15-22 [Medline] [Order article via Infotrieve]
  11. Waxman, D. J. (1990) Cancer Res. 50, 64449-6454
  12. Tsuchida, S., and Sato, K. (1992) Crit. Rev. Biochem. Mol. Biol. 27, 337-384 [Medline] [Order article via Infotrieve]
  13. Commandeur, J. N., Stijntjes, J. N. M., and Vermeulen, N. P. E. (1995) Pharmacol Rev. 47, 271-330 [Medline] [Order article via Infotrieve]
  14. Tidefelt, U., Elmhorn-Rosenberg, A., Paul, C., Hao, X-Y., Mannervik, B., and Erikson, L. C. (1992) Cancer Res. 52, 3281-3285 [Abstract/Free Full Text]
  15. Muramatsu, M., Morimura, S., Suzuki, T., Imagawa, M., and Kitagawa, T. (1993) in Structure and function of Glutathione transferases (Tew, K. D, Pickett, C. B., Mantle, T. J., Mannervik, B., and Hayes, J. D., eds), pp. 297-308, CRC Press, Boca Raton, Ann Arbor, London, Tokyo
  16. Gilbert, L., Elwood, Lori, J., Merino, M., Masood, S., Barnes, R., Steinberg, S. M., Lazarous, D. F., Pierce, L., d'Angelo, T., Moscow, J. A., Townsend, A. J., and Cowan, K. H. (1993) J. Clin. Oncol. 11, 49-58 [Abstract]
  17. Tew, K. (1994) Cancer Res. 54, 4313-4320 [Abstract/Free Full Text]
  18. Lammie, G. A., and Peters, G. (1991) Cancer Cells 3, 413-420 [Medline] [Order article via Infotrieve]
  19. Saint-Ruf, C., Malfoy, B., Scholl, S., Zafrani, B., and Dutrillaux, B. (1991) Oncogene 6, 403-406 [Medline] [Order article via Infotrieve]
  20. Hare, A., Yamaha, H., N., H., and Tank, T., and, H. (1990) Cancer 66, 2563-2568 [CrossRef][Medline] [Order article via Infotrieve]
  21. Strange, R. C., Fryer, A. A., Matharoo, B., Zhao, L., Broome, J., Campbell, D. A., Jones, P., Pastor, I. C., and Singh, V. P. (1992) Biochim. Biophys. Acta 1139, 222-228 [Medline] [Order article via Infotrieve]
  22. Ali-Osman, F., Stein, D., and Renwick, A. (1990) Cancer Res. 50, 6976-6980 [Abstract/Free Full Text]
  23. Kano, T., Sakai, M., and Muramatsu, M. (1987) Cancer Res. 47, 5626-5630 [Abstract/Free Full Text]
  24. Moscow, J. A., Townsend, A. J., Goldsmith, M. E., Whang-Peng, J., Vickers, P. J., Legault-Poisson, S., Myers, C. E., and Cowan, K. H. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 6518-6522 [Abstract/Free Full Text]
  25. Cowell, I. G., Dioxin, K. H., S. E., Ketterer, B., and Taylor, J. B. (1988) Biochem. J. 255, 79-83 [Medline] [Order article via Infotrieve]
  26. Morrow, C. S., Cowan, K. H., and Goldsmith, M. E. (1989) Gene 75, 3-11 [CrossRef][Medline] [Order article via Infotrieve]
  27. Ahmad, H., Wilson, D. E., Fritz, R. R., Singh, S. V., Medh, R. D., Singh, S. V., Nagle, G. T., Awasthi, Y. C., and Kurosky, A. (1990) Arch. Biochem. Biophys. 278, 398-448 [CrossRef][Medline] [Order article via Infotrieve]
  28. Reinemer, P., Dirr, H. W., Ladenstein, R., Lo Bello, M., Federici, G., and Parker, M. W. (1992) J. Mol. Biol. 227, 214-226 [CrossRef][Medline] [Order article via Infotrieve]
  29. Ali-Osman, F. (1996) in J. Mol. Biol.Methods in Molecular Medicine. Human Cell Culture Protocols (Jones, GE, ed), pp. 63-80, Human Press Inc.
  30. Maurer, H. R., Maschler, R., Dietrich, R., and Goebel, B. (1977) J. Immun. Meth. 18, 353 [CrossRef][Medline] [Order article via Infotrieve]
  31. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular cloning: A laboratory manual., Cold Spring Harbor Laboratory Press
  32. Gubler, U., and Hoffmann, B. J. (1983) Gene 25, 263-267 [CrossRef][Medline] [Order article via Infotrieve]
  33. Takumi, T., and Lodish, H. F. (1994) Biotechniques 17, 443-444 [Medline] [Order article via Infotrieve]
  34. Ali-Osman, F., and Akande, O. (1995) Biochimica 4, 28
  35. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 5463-5467 [Abstract/Free Full Text]
  36. Chomcznski, P, and Saachi, N. (1987) Anal. Biochem. 162, 156-159 [Medline] [Order article via Infotrieve]
  37. Lowry, O. H., Rosebrough, N. J., Farr, A. L., and Randall, R. J. (1951) J. Biol. Chem. 193, 265-275 [Free Full Text]
  38. Simons, P. C., and Van der Jagt, D. L. (1981) in Methods in Enzymology (Jacoby, W, ed), Vol. 77, pp. 235-237
  39. Segel, I. H. (1976) Biochemical Calculations., pp. 208-318, John Wiley and Sons, New York, Chicheter, Brisbane, Singapore
  40. Dani, Ch, Blanchard, J. M., Piechaczyk, M., Sabouty, S. E., Marty, I., and Jeanteur, P. (1984) Proc. Natl. Acad. Sci. (U. S. A.) 81, 7046-7050 [Abstract/Free Full Text]
  41. Zimniak, P, Pikula, S., Bandorowicz Pikula, J., Singhal, S. S., Srivastava, S. K., Awasthi, S., and Awasthi, Y. C. (1994) Eur. J. Biochem. 224, 893-899 [Medline] [Order article via Infotrieve]
  42. Board, P. G., Webb, G. C., and Coggan, M. (1989) Ann. Hum. Genet. 53, 205-213 [Medline] [Order article via Infotrieve]
  43. Okuda, A., Sakai, M., and Muramatsu, M. (1987) J. Biol. Chem. 262, 3858-3863 [Abstract/Free Full Text]
  44. She, H, Ranganathan, S, Kuzmich, S., and Tew, K. D. (1995) Biochem. Pharmacol. 50, 1233-1238 [CrossRef][Medline] [Order article via Infotrieve]
  45. Widerstern, M., Kolm, R. H., Bjornestedt, R., and Mannervik, B. (1992) Biochem. J. 285, 377-381
  46. Kolm, R. H., Stenberg, G., Widerstern, M., and Mannervik, B. (1995) Protein Expression and Purification 6, 265-271 [CrossRef][Medline] [Order article via Infotrieve]
  47. Battistoni, A, Mazzetti, A. P., Petruzelli, R., Muramatsu, M., Federi