![]()
|
|
||||||||
(Received for publication, August 30, 1996, and in revised form, December 12, 1996)
From the We have cloned a novel serine/threonine protein
kinase (PK428) which is highly related (65%) within the kinase domain
to the myotonic dystrophy protein kinase (DM-PK), as well as the cyclic AMP-dependent protein kinase (33%). Northern blots
demonstrate that PK428 mRNA is distributed widely among
tissues and is expressed at the highest levels in pancreas, heart, and
skeletal muscle, with lower levels in liver and lung. Two
PK428 mRNAs 10 and 3.8 kilobase pairs in size are seen
in a number of cell lines, including hematopoietic and breast cancer
cells. An antibody generated to a glutathione
S-transferase-PK428 fusion protein detects a 65-kDa protein
in these cell lines, and a similarly sized protein when the cloned
cDNA is transiently expressed in Cos 7 cells. Immunoprecipitation of the transiently expressed PK428 protein and incubation with [ Myotonic dystrophy (DM)1 is a systemic
disease characterized by muscle weakness, myotonia, cardiac conduction
defects, cataracts, testicular atrophy, insulin-resistant diabetes, and
male baldness (1, 2), with an incidence of 1 in 8000 (1). This disease can present either as a slowly progressive form in adults or as a
congenital form in childhood (1, 2). The molecular basis of DM involves
the mutation and expansion of a trinucleotide sequence (CTG)n
located in the 3 Another protein kinase related to the DM-PK, p160ROCK, has
been shown to bind the small GTP-binding protein Rho, and it contains a
protein kinase domain that shares 44% similarity to the DM-PK, an
amphipathic Signaling through the granulocyte-macrophage colony-simulating factor
(GM-CSF) receptor is mediated by two subunits, an We have cloned a novel protein kinase, PK428, which is highly related
to the DM-PK amino-terminal kinase domain, but which diverges in its
carboxyl terminus. This novel protein kinase is highly expressed in
skeletal muscle and heart, but it is also expressed in the brain,
pancreas, and at lower levels in the lung. Northern blots demonstrate
that this kinase is expressed as two separate mRNAs, 3.8 and 10 kb
in size, in both leukemic and breast cancer cells, but not in HeLa
(cervical carcinoma) cells. Transfection of this cDNA into Cos 7 cells results in the production of a 65-kDa protein, which is capable
of autophosphorylation, as well as phosphorylation of histone H1 and a
peptide substrate that contains a cyclic AMP-dependent protein kinase phosphorylation site. An antibody generated to the PK428
protein kinase immunoprecipitated a 65-kDa protein (corresponding closely to the predicated size of the open reading frame in a 3.8-kb
PK428 mRNA) in both hematopoietic and breast cancer
cells, as well as a larger 200-kDa protein (which presumably
corresponds to a larger 10-kb PK428 mRNA). The
chromosomal gene corresponding to the 3.8-kb PK428 mRNA
was isolated by PCR screening of a human genomic P1 phage library. Two
identical clones were isolated, and their identity was confirmed by
partial DNA sequence analysis. Using fluorescence in situ
hybridization (FISH) of the PK428 P1 phage clones, we found
that the PK428 gene encoding the 3.8-kb mRNA and 65-kDa
protein localizes to the long arm of human chromosome 1, specifically
the q41-42 region. This area has previously been implicated in some
forms of genetically acquired mental retardation (16), as a possible
location for a second human senescence gene localized to the long arm
of chromosome 1 (17), and most interestingly, as a location of a
gene(s) involved in Rippling muscle disease (18).
The PK428
cDNA fragment was identified using the yeast two-hybrid system (a
gift of Dr. Steven Elledge). The 54-amino acid intracytoplasmic tail of
the GM-CSF The pcDNA3PK428/2.8 plasmid was
constructed by digesting pBK/CMV PK428, the longest clone from The plasmids encoding either single proline mutants or an 8-amino acid
deletion in the A human tissue blot with
mRNAs from different tissues was purchased from Clontech (a gift
from Dr. J. Han, University of Alabama at Birmingham). Each lane
contained 2 µg of poly(A)+ mRNA. Total RNA was
prepared from various cell lines by lysing the cells in guanidinium
isothiocyanate solution and pelleting the RNA through a cesium chloride
cushion. The human cell lines used were U937 (a histiocytic lymphoma),
K562 (a chronic myelogenous leukemia), MDA-MB-231 (a breast cancer cell
line), A549 (a lung cancer cell line), G-401 (a Wilms' tumor cell
line), Colo 320 (a colon cancer cell line), SK-OV-3 (an ovarian
adenocarcinoma cell line), MOLT-4 (T cell line), HL-60 (a promyelocytic
leukemia cell line), PLB985 (a myeloid leukemia cell line), HeLa (an
epithelial cancer), and IE8 and OB5 BLIN-1 (pre-B cell lines). All cell
lines were obtained from the ATCC, with the exception of IE8 and OB5 which were a gift of Dr. M. Cooper, (University of Alabama at Birmingham). 20 µg of total RNA were electrophoresed on a 1%
agarose-formaldehyde gel and transferred onto nylon membranes. The
filters was prehybridized and hybridized as described previously
(12).
Cos 7 cells
were maintained in Dulbecco's modified Eagle's medium containing 10%
bovine calf serum. For transfections, 3-5 µg of the PK428 cDNA
plus 20 µg of Lipofectin reagent (Life Technologies, Inc.) were
incubated with 7 × 105 Cos 7 cells for 6 h.
Forty-eight hours after transfection, the cells were lysed, and the
lysate was used as a source of the expressed PK428 protein.
An antibody to the
PK428 protein was raised by injecting an SDS-gel-purified fusion
protein of glutathione S-transferase and amino acids
154-496 of PK428 into a New Zealand White rabbit every 3 weeks. The
method for immunogen injection has been described previously (13).
Immunoprecipitations were carried out by lysing the Cos 7 cells in TNE
buffer (50 mM Tris, pH 8.0, 150 mM NaCl, 1%
Nonidet P-40 2 mM EDTA) containing inhibitors (12). The
anti-PK428 antibody was added to the supernatant of the cell lysate at
a 1:100 dilution and incubated at 4 °C for 1 h. 30 µl of a
protein A-Sepharose (Pharmacia) slurry were used to adsorb the immune
complexes, and the beads were then washed five times in lysis buffer
prior to their elution in Laemmli sample buffer. The eluted proteins
were electrophoresed on an 8% SDS-PAGE and, for Western blots,
electrophoretically transferred to a polyvinylidene difluoride membrane
filter (Millipore, Bedford, MA). The blotted filter was incubated in
TBS (20 mM Tris, pH 7.6, 137 mM NaCl)
containing 3% bovine serum albumin (fraction V, Sigma) for 1 h.
The filter was incubated with the PK428 antibody at 1:200 dilution.
Bound antibodies were visualized by using the enhanced
chemiluminescence (ECL) system (Amersham Corp.).
Cos 7 cells were transfected with pcDNA3PK428/1.5,
pcDNA3PK428/2.0, or pcDNA3 vector only, and labeled with 0.5 mCi/ml [32P]orthophosphate (Amersham) for 4 h prior
to cell lysis and then immunoprecipitated with the PK428 antibody or
preimmune serum. For autophosphorylation, the immunoprecipitated PK428
protein was washed twice in TNE lysis buffer and twice in kinase buffer (20 mM Tris, 100 mM NaCl, 1 mM
dithiothreitol) followed by incubation in 50 µl of the assay buffer
containing 20 mM Tris, pH 7.5, 100 mM NaCl, 10 mM MgCl2, 1 mM dithiothreitol, 10 µM cold ATP, and 5 mCi of [ A human genomic P1 phage
library (Genome Systems, St. Louis, MO) was screened by PCR using a
pair of oligonucleotide primers (forward,
5 Bromodeoxyuridine-synchronized and
phytohemagglutinin-stimulated peripheral blood lymphocytes from a
normal male donor were used as a source of metaphase chormosomes.
Purified DNA from the P1 phage clones containing the human
PK428 gene (11499 and 11500) were labeled for FISH analysis
by nick translation with digoxigenin-11-UTP (Boehringer Mannheim). To
localize the human PK428 gene, one set of metaphase
chromosomes was simultaneously hybridized with a control genomic
centromeric clone corresponding to alphoid sequences of human
chromosome 1, D1Z1 (Oncor, Inc.). Specific hybridization signals were
detected by applying fluorescein-conjugated sheep antibodies to
digoxigenin (Boehringer Mannheim) and avidin-Texas Red (Vector
Laboratories, Inc., Burlingame, CA), followed by counterstaining in
DAPI (Sigma). Fluorescence microscopy was performed with a Nikon
microscope equipped with a cytovision image analysis system (Applied
Imaging, Pittsburgh, PA) and a fluorescence filter wheel that
sequentially captures the fluorescein, Texas Red, and DAPI images and
electronically superimposes them.
The
PK428 clone was isolated using the yeast two-hybrid screen
designed to identify proteins that bind to the intracytoplasmic portion
of the
The catalytic domain of the PK428 protein kinase corresponds to a
263-amino acid region that is located in the amino terminus of the
protein. The GXGXXG sequence motif characteristic
of many protein kinases is found in subdomain I. An invariant lysine at position 106 of the protein that is necessary for the ATP binding is
also present (15), as well as the conserved amino acids DIKPEN in
subdomain VI and GTPDYLSPE in subdomain VIII. These features of the
predicted PK428 open reading frame strongly suggest that this protein
is a serine/threonine protein kinase. A sequence homology search
demonstrated that the kinase domain of PK428 was 65% homologous to the
kinase domain of the myotonic dystrophy protein kinase (23), 50%
homologous to the kinase domain of p160ROCK (10), 51%
homologous to the rat ROK To examine the
tissue expression of PK428 mRNA, Northern blot analysis
of poly(A)+ RNA from different human tissues and cell lines
was performed. A 10-kb mRNA was most abundant in the heart, brain,
skeletal muscle, kidney, and pancreas, with little or no expression in
the lung and liver (Fig. 3A). Northern blot
analysis of various human cell lines demonstrates the presence of 3.8- and 10-kb hybridizing bands (Fig. 3B), and both are
expressed in the hematopoietic cell lines U937, K562, and PLB985, the
breast cancer cell line MDA-MB-231, A549 lung carcinoma cells, and the
Wilms' tumor cell line, G-401. The 3.8-kb mRNA for
PK428 was not found in HeLa cells, the T cell line MOLT-4,
or the pre-B cell lines IE8 and OB5.
To verify the identity and molecular weight of this putative protein
kinase, a polyclonal antibody was generated using a GST-PK428 fusion
protein. MDA-MB-231 and U937 cells were lysed, and PK428 protein was
immunoprecipitated and Western blotted with this antibody (Fig.
4A). In both cell lines a protein with a
apparent molecular mass of 65 kDa, as well as a less intense band at 78 kDa, were immunoprecipitated. In addition, in the U937 cells, a 200-kDa band was also seen. To determine which of these polypeptides was encoded by the cloned cDNA, and its molecular weight on SDS-PAGE gels, Cos 7 cells were transfected with each of two PK428
cDNA clones (2.0 and 1.5 kb), which contained the entire
PK428 predicted open reading frame and varying lengths of
the 5
Since many protein kinases are capable of
autophosphorylation, the in vivo phosphorylation state of
the PK428 protein was examined. Cos 7 cells were transfected with the
PK428 cDNA and labeled with [32P]orthophosphate, and
the PK428 protein was immunoprecipitated with the PK428-specific
antibody. A 65-kDa phosphorylated protein was detected in the Cos 7 cells transfected with the cDNA (Fig. 5A,
lane 3), but it was not present in either preimmune cells (lane 2) or when this antibody was used for
immunoprecipitation from the untransfected cells (lane 1).
To demonstrate in vitro that this protein was capable of
autophosphorylation, the PK428 protein from transfected and unlabeled
Cos 7 cells was immunoprecipitated with the PK428 antibody, and the
resulting protein was incubated in a kinase reaction buffer containing
[
Since the PK428 protein was homologous to the protein kinase domain to
the cyclic AMP-dependent protein kinase, the ability of the
PK428 protein kinase to phosphorylate a cyclic AMP protein kinase
substrate was examined (25). Demonstration of PK428 protein kinase
activity was measured by the incorporation of
[32P]phosphate from [ Using oligonucleotide primers specific for a region
of the 5
A novel protein kinase whose kinase domain is highly related, but
not identical, to the DM-PK has been isolated by the two-hybrid analysis using a 54-amino acid region of the GM-CSF In addition to the 65-kDa form of the PK428 protein, a 70-80-kDa
protein was immunoprecipitated from breast and hematopoietic cells. The
myotonic dystrophy protein kinase is 71-80 kDa in size (26), and it is
possible that the PK428 antibody detects this protein as well.
Furthermore, the PK428 antibody detects a 200-kDa protein in U937
cells. This larger protein could be another member of the DM-PK family.
Recently, a 160-kDa protein with significant homology to the DM-PK
kinase domain, p160ROCK, has been shown to interact with
the small GTP-binding protein Rho, suggesting that there are larger
members of this family of protein kinases (8-10). It is also possible
that this 200-kDa protein is derived by alternative splicing of the
PK428 gene, or that it corresponds to a PK428-related gene
and protein. In fact alternative splicing of the DM-PK gene has been
reported (27). The identity of these PK428-related mRNAs may be
revealed by analysis of its corresponding gene and/or related
genes.
Protein kinase activity of the PK428 protein was demonstrated by
immunoprecipitation of PK428 produced by transient transfection. This
kinase activity stimulated autophosphorylation and demonstrated that
PK428 protein is phosphorylated in vivo. This PK428 protein kinase is also capable of phosphorylating a substrate for the cyclic
AMP-dependent protein kinase and histone H1. However, we have not eliminated the possibility that another protein that coimmunoprecipitates with this protein kinase is responsible for some
of the effects we have described. Although difficult to quantify, the
phosphorylation of cyclic AMP-dependent protein kinase
substrate that was seen with the PK428 immunoprecipitates was
relatively weak when compared with the catalytic subunit of the cyclic
AMP-dependent kinase (data not shown). These results
suggest that "better," more physiological, substrates for this
protein kinase may exist.
Using FISH we have mapped this gene to human chromosome 1q41-42. A
number of diseases have been localized to this region, including
Usher's syndrome type IIa, which is associated with hearing loss, and
retinitis pigmentosa (28), a syndrome of mental retardation associated
with trisomy 1q42 (16), arrythmogenic right ventricular cardiomyopathy
(29), and a Rippling muscle disease gene (18). Because of the
similarity of PK428 with the DM-PK it is interesting to speculate that
PK428 gene may also encode a protein which has an important
role in muscle physiology.
Overexpression of the DM-PK has been shown to induce a skeletal muscle
phenotype in BC3H1 cells (30). The neuromuscular junction
location of the DM-PK protein (31) also suggests that it may be
involved in signaling integrating extracellular events to cytoskeleton
and the nucleus. Mutations in either the N. crassa Cot-1 or
the D. melanogaster warts genes, which are related to DM-PK,
result in abnormal cell growth and changes in cell morphology, supporting a possible role for this protein kinase in cytoskeletal morphology and signal transduction to the nucleus. In addition, the Rho
protein regulates stress fibers and focal contacts in cells, presumably
through its interaction with a protein kinase that shares sequence
homology with the DM-PK. These signals appear to help to control cell
shape. Furthermore, the DM-PK-like protein kinase that binds to Rho,
p160ROCK, may coordinate responses to specific external
stimuli such as lysophosphatidic acid (32). Thus, it would appear that
this family of protein kinases regulates responses to external stimuli that are involved in potential changes of the actin cytoskeleton and,
subsequently, cell morphology. Identification of PK428 by two-hybrid
interactive cloning, using the short intracytoplasmic tail of the
GM-CSF The addition of GM-CSF The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) U59305[GenBank]. We appreciate the help of Dr. Bill
Weaver in reviewing this manuscript. We also thank Dr. M. Cooper,
University of Alabama, Birmingham, for the gift of the two pre-B cell
lines, and Dr. C. Franklin, University of Colorado, Denver, for
providing the GST-TK clone.
Volume 272, Number 15,
Issue of April 11, 1997
pp. 10013-10020
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
§,
,


Division of Medical Oncology, University of
University of Colorado Health Sciences Center, Denver, Colorado
802621 and the Departments of ¶ Tumor Cell Biology and
** Experimental Oncology, St. Jude Children's Hospital,
Memphis, Tennessee 38105
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
-32P]ATP demonstrate that it is capable of
autophosphorylation. In addition, immunoprecipitates of the PK428
protein kinase also phosphorylated histone H1 and a peptide encoding a
cyclic AMP-dependent protein kinase substrate. The gene
corresponding to the 3.8-kb PK428 mRNA, and its
corresponding 65-kDa protein, was isolated by polymerase chain reaction
screening of a P1 phage human genomic library. Using this P1 phage
clone as a probe, the PK428 gene was located on 1q41-42, a
possible location for a human senescence gene, a gene associated with
Rippling muscle disease, as well as a region associated with
genetically acquired mental retardation.
-untranslated region of the corresponding mRNA (3,
4). The DM gene encodes a putative serine-threonine protein kinase
(DM-PK) which is located in chromosome 19q13.3 (3-5). This protein
kinase is predicted to contain a protein kinase catalytic domain near
the amino terminus, a central
-helical coiled domain, and a
potential carboxyl-terminal transmembrane domain (3). Consistent with
the systemic nature of this disease, transcripts of the gene are
expressed in various tissues, including the heart, skeletal muscle,
liver, and brain, both in human and mouse (6, 7).
-helix, a pleckstrin domain, and a cysteine-rich region
(8-10). Since the activation of Rho regulates the actin cytoskeleton,
it is possible that the DM-PK has a similar or parallel function. The
warts protein kinase, which is found in Drosophila melanogaster, is also related to the DM-PK (46% identity);
however, the biologic function of this protein is unknown. Deletion of the warts gene in Drosophila leads to the
formation of cell clones that are fragmented, rounded, and greatly
overgrown (11).
subunit, which
binds GM-CSF and interacts with the
subunit containing the binding
site for the JAK2 protein kinase. The JAK2 protein kinase has been
shown to regulate at least some of the signaling mediated by this
receptor. The
subunit has a short intracytoplasmic carboxyl-terminal tail (54 amino acids), which is essential for GM-CSF-mediated growth stimulation (12-15). Within this 54-amino acid
tail is a short stretch of prolines, a sequence that is conserved in
the
subunits of both the interleukin-3 and -5 receptors. Mutation
of one or more of these proline residues blocks the ability of these
hormones to signal and act as stimulators of growth (14, 15). Because
the intracytoplasmic region of the
subunit is essential for the
function of GM-CSF, we have used this portion of the receptor in a
two-hybrid yeast interaction screen to search for proteins that may be
essential for signal transduction by this hormone.
Cloning of Full-length cDNA
subunit was cloned into plasmid pAS1-CYH2 as the bait.
The yeast Y190 cells were cotransformed with a peripheral B lymphocyte
library fused to the DNA activation domain of GAL4 that is contained
within the plasmid pACT II. The two-hybrid screen was carried out as
described previously (19). This screening yielded 10 positive cDNA
clones, of which three were identified as PK428 cDNA
clones. To obtain a full-length cDNA, the largest PK428 fragment
was used as probe to screen a
ZAP expression cDNA library
constructed from five breast cancer cell lines (a gift of Dr. M. Ruppert, University of Alabama) using the ZAP ExpressTM
cDNA synthesis kit (Stratagene). The prehybridization and
hybridization were carried out in blotto buffer (0.05% heparin, 1%
SDS, 0.5% non-fat dry milk, 6% PEG8000, 5 × SSPE, 10%
formamide, 2 mg/ml salmon sperm single-strand DNA) at 65 °C for 3 and 16 h, respectively. The filters were washed with 0.1 × SSC, 0.3% SDS for 5 min at room temperature and 0.3 × SSC, 0.3%
SDS for 60 min at 65 °C. DNA sequence analysis was performed by the
dideoxy method using Sequenase 2.0 according to the manufacturer's
(U. S. Biochemical Corp.) specifications. Homology searches were
performed with the BLAST network service at National Center for
Biotechnology Information.
ZAP
breast cancer cell line cDNA library screening, with
BamHI/XhoI and inserting the released 2.8-kb
fragment into the BamHI/XhoI site of pcDNA3.
The pcDNA3PK428/2.0 was constructed by digesting
pcDNA3PK428/2.8 with SmaI/XhoI and inserting
the about 2.0-kb fragment into EcoRV/XhoI site of
pcDNA3. The pcDNA3PK428/1.5 was constructed by digesting the
pcDNA3PK428/2.8 with AflIII followed by Klenow enzyme
treatment, and the resulting product was then digested with
XhoI. The released 1.5-kb fragment was then ligated into the
EcoRV/XhoI site of pcDNA3. The GSTPK428 used
for raising polyclonal antibody was constructed by inserting a PCR
fragment from nucleotide 1748-2818 of pcDNA3PK428/2.8 with BamHI and EcoRI sites at its 5
and 3
ends,
respectively, into the BamHI/EcoRI site of pGEX2T
(Pharmacia Biotech Inc.). The plasmid pGEX2TK encoding a fusion protein
between GST and a cAMP-dependent protein kinase
substrate (20) (GST-TK) was kindly provided by Dr. C. Franklin
(University of Colorado, Denver).
subunit intracytoplasmic domain (pAS/
7400, pAS/
7401, and pAS/
7402) were constructed by first cloning the intracytoplasmic domain of the receptor into M13mp19 phage, which was
then used to prepare single-stranded DNA for site-directed mutagenesis
(Amersham Corp.). The oligonucleotides used for the mutagenesis were as
follows: GTCTTTGATCTGTATCCTAAGGAACC (7402), GGAACTGGACCGAACAGC
(7401), and CTTTGATCTGACCAACTGGCGG (7400). The cytoplasmic
regions of the resulting mutants were cloned into the
NcoI/BamHI site of pAS/CYH2 plasmid by polymerase
chain reaction.
-32P]ATP at a
specific activity of 3000 mCi/mM (Amersham) for different time periods at 30 °C. The immunokinase assay was performed at 30 °C using the assay buffer described for autophosphorylation with
or without 5 µg of each substrate. The reactions were stopped by
dilution with Laemmli sample loading buffer. The phosphorylated proteins were then separated by SDS-PAGE and visualized by
autoradiography.
-TATTCATTAATGATGCAACCGGAT-3
, and reverse,
5
-GTTATTCAAACAACTGTCATGCAA-3
), the sequences of which were derived
from the PK428 cDNA corresponding to nucleotides
870-893 and 1162-1185, respectively. These sequences are located in
the 5
-untranslated region of the cDNA and give rise to a single
315-base pair PCR product using normal human genomic DNA (data not
shown). Conditions for the genomic PCR using the PK428
primers were as follows: 0.25 µg of template DNA, 1000 ng of each
primer, 200 µM of each dNTP, and 1.5 mM
MgCl2 in a 50-µl reaction volume. The PCR cycles used for
these reactions were 95 °C initial denaturation to 3 min, 95 °C
denaturation for 30 s, 62 °C annealing for 1 min, and a
72 °C extension for 30 s for 35 cycles. Two P1 phage clones
containing the human PK428 gene (11499 and 11500) were
isolated and analyzed further by direct DNA sequence analysis to
confirm their identity (data not shown).
Isolation of a Full-length cDNA Clone for PK428
subunit of the GM-CSF receptor. This 54-amino acid
intracytoplasmic domain of the GM-CSF
subunit appears to play an
important role in signal transduction, although the proteins that bind
to this domain remain unknown (12, 13). We fused the 54-amino acid
intracytoplasmic domain to the DNA binding portion of GAL4 as the bait
for the two-hybrid analysis, and a B cell library fused to the GAL4 DNA
transactivation domain was used as the prey. Ten positive clones were
obtained, three of which encoded PK428. The PK428
cDNA fragment obtained from the yeast two hybrid screening was used
as a hybridization probe to isolate additional cDNAs from a human
breast cancer cell cDNA library. Nine positive clones were isolated
and analyzed by DNA sequencing. The PK428 insert contains a
2,818-base pair cDNA fragment (GenBankTM accession no.
U59305[GenBank]) with a large open reading frame found from nucleotide
1289-2776, encoding a 496-amino acid protein (Fig. 1).
The designated ATG is likely to be correct, since several stop codons
in all three reading frames are found 5
of this ATG codon. Analysis of
the amino acid sequence of PK428 demonstrates that it contains a
complete protein kinase catalytic domain which conserves all 11 kinase
subdomains (Figs. 1 and 2) (21). In addition to the high
homology kinase region between DM-PK and PK428, the amino-terminal
region of the deduced PK428 amino acid sequence is also related (to a
lesser extent) to the DM-PK, suggesting that the two proteins are
unique. Hydrophobicity analysis (22) shows that the PK428 amino acid
sequence contains a helical region following the kinase domain, as well
as a hydrophobic domain. Both of these regions, which are similar to
those found in DM-PK, suggest that PK428 is most likely a protein
kinase related to the DM-PK (Fig. 1).
Fig. 1.
Nucleotide and amino acid sequence of
PK428. A large open reading frame is identified from
nucleotide 1289-2776 encoding a 496-amino acid protein. The protein
kinase catalytic domain is shown by a single underline,
while a hydrophobic region is identified by double
underlining.
[View Larger Version of this Image (79K GIF file)]
Fig. 2.
Sequence comparison between PK428
and homologous proteins. Panel A, comparison of PK428 and
other proteins. The position of the putative protein kinase catalytic
domain is shown in black, and the percent amino acid
identity with PK428 is shown above each protein. The proteins compared
are DM-PK, D. melanogaster Warts protein (Wts);
Cot-1 from N. crassa, a putative serine/threonine protein
kinase from M. crystallinum (M.c.); yeast DBF20,
and the catalytic subunit of bovine cAMP-dependent protein
kinase (PKA). Panel B, sequence alignment of
PK428 and the DM-PK. The 11 protein kinase domains are designated by
roman numerals. Amino acid identity between PK428 and the
DM-PK is indicated by vertical lines.
[View Larger Version of this Image (41K GIF file)]
protein (8), 46% to the D. melanogaster tumor suppressor protein kinase warts
(11), 40% homologous to the Cot-1 protein kinase from Neurospora
crassa (24), 43% homologous to the serine/threonine protein
kinase from Mesembryanthenum
crystallinum,2 and 33% homologous to
the catalytic subunit of protein kinase A (25) (Fig. 2).
Fig. 3.
Northern blots of human tissues and cell
lines. Panel A, human tissue Northern blot. The molecular
sizes are shown in kilobase pairs. Panel B, Northern blot of
RNA from cell lines. 20 µg of total RNA were electrophoresed on an
agarose gel and transferred to a membrane (see "Materials and
Methods") and probed with the PK428 cDNA. The identical membrane
was stripped and probed with tubulin. The cell lines used in this study
are as follows: 1, U937 histiocytic lymphoma; 2,
K562 chronic myelogenous leukemia; 3, MDA-MB-231 breast
cancer; 4, A549 lung cancer; 5, G-401 Wilms' tumor; 6, Colo 320 colon cancer; 7, SK-OV-3
ovarian cancer; 8, MOLT-4 lymphoblastic leukemia;
9, HL-60 promyelocytic leukemia; 10, PLB 985 myelocytic leukemia; 11, HeLa epithelial cancer;
12, IE8 pre B-cell leukemia; and 13, OB5 pre-B
cell leukemia.
[View Larger Version of this Image (51K GIF file)]
-untranslated region. A 65-kDa protein was immunoprecipitated
from Cos 7 cells transfected with both of the PK428
cDNAs, suggesting that they both utilized an identical site for
initiation of translation (Fig. 4B). These analyses
demonstrated that the PK428 cDNA clones that were
isolated corresponded to the 65-kDa protein species identified by the
PK428 antibody in human cell lines.
Fig. 4.
Immunoprecipitation of PK428 from cell lines
and transfected Cos 7 cells. Panel A, immunoprecipitation
from cell lines. An antibody to a GST-PK428 fusion protein was raised
(2188 antibody), and used to immunoprecipitate the PK428 protein from
107 MDA-MB-231 cells (lanes 1 and 2)
or the same number of U937 cells (lanes 3 and 4).
The immunoprecipitated proteins were transferred to a membrane and then
Western blotted with the 2188 antibody. Molecular mass markers
are shown on the left side of the figure, and the 200- and 65-kDa
immunoprecipitated proteins are indicated by the arrows. Panel
B, immunoprecipitation from transfected cells. 6 × 105 Cos 7 cells were transfected with either
pcDNAPK428/1.5 (lanes 1 and 4),
pcDNA3PK428/2.0 (lane 2), or pcDNA3 alone
(lane 4). The cells were lysed, the PK428 protein was
immunoprecipitated with either the 2188 antibody or preimmune serum,
the proteins were transferred to a membrane, and a Western blot was
performed with the 2188 antibody.
[View Larger Version of this Image (71K GIF file)]
-32P]ATP. In this autophosphorylation assay, a 65-kDa
band was seen within 1 min, and the appearance of this 65-kDa band
increased in intensity with continued, longer incubation times (Fig.
5B). Antiphophotyrosine Western blotting of PK428
immunoprecipitates demonstrated that this protein is not phosphorylated
on tyrosine residues.
Fig. 5.
Protein kinase activity of PK428. Panel
A, 32P-labeling of PK428. 6 × 105
Cos 7 cells were transfected with either the pcDNA3 vector as a
control (lane 1) or the pcDNA3PK428/1.5 expression
construct (lane 2 and 3). The cells were labeled
with [32P]orthophosphate, and PK428 was
immunoprecipitated with either the 2188 antiserum or preimmune serum.
The phosphorylated PK428 is indicated with an arrow. Panel
B, Autophosphorylation of PK428 in vitro. PK428 was
immunoprecipitated from transfected Cos 7 cells with the 2188 antiserum
(lanes 1-7) or a preimmune serum as a control (lanes
8 and 9). The immunoprecipitated proteins were
incubated in kinase buffer (see "Materials and Methods") with
[
-32P]ATP for the indicated time periods. This
reaction was then run on an SDS-PAGE and the phosphorylated proteins
identified by fluorography. Panel C, phosphorylation of
possible protein kinase substrates by PK428. Immunoprecipitation of
transfected Cos 7 cells was either carried out with the 2188 antiserum
(lanes 1-5 and 7) or a preimmune serum as a
control (lane 6). The immunoprecipitates were either added
to the cyclic AMP fusion protein expressed as a GST fusion protein
(GST-TK, lanes 1-4) or GST alone (lane
5), or histone H1 (lanes 5 and 6). The
incubation time is shown at the top. At the completion of the reaction,
the products were analyzed by SDS-PAGE, and the phosphorylated
substrates were identified by fluorography. The phosphorylated GST-TK
and histone H1 are indicated by arrows.
[View Larger Version of this Image (69K GIF file)]
-32P]ATP into
either histone H1 or a peptide substrate of cyclic AMP-dependent protein kinase encoded as part of a GST
fusion protein (GST-TK) (20). PK428 immunoprecipitates phosphorylated
the GST-TK fusion protein (Fig. 5C), but did not
phosphorylate GST alone (Fig. 5C, lane 5). When
the PK428 antiserum was replaced with normal rabbit serum, no
phosphorylation of the substrates was seen (data not shown). Likewise,
the PK428 immunoprecipitates phosphorylate histone H1 when it is used
as a substrate (Fig. 5C), while no phosphorylation of
histone H1 was seen if the preimmune serum was used as a control (Fig.
5C), or if histone H1 is not included in the reaction (data
not shown).
-untranslated region of the PK428 cDNA,
nucleotides 870-1185, a 315-bp specific band was amplified from normal
genomic DNA (data not shown). This confirmed the specificity and
continuity of the selected cDNA sequences in genomic DNA, allowing
the isolation of the PK428 gene by genomic PCR screening a
gridded human P1 phage genomic library (Genome Systems). The
corresponding human PK428 gene was isolated from this human
P1 phage library (clone identities 11499 and 11500), verified by direct
sequencing of the P1 DNA with the same primers, and then used to
determine the location of the human gene by FISH. Both PK428
P1 phage clones localized to the same location, human 1q41-42 (Fig.
6). Previously, others have shown that this terminal
region of the long arm of chromosome 1 is associated with certain forms
of mental retardation (16) and with the possible location of a second
human senescence loci (17). Of more interest, the gene(s) which is
associated with Rippling muscle disease has also been localized to this
same region of chromosome 1 (18).
Fig. 6.
Localization of the human PK428
gene, contained in the P1 phage clone 11499, to human chromosome
1q41-42 by FISH. The arrows indicate the signal due to
specific hybridization with clone 11499 (generated by the fluorescein
antibody; green dots), which contains the PK428
gene, while the arrowheads indicate the signal created by
hybridization with the PUC 1.77 control DNA (generated by the Texas Red
antibody; red dots), which is specific for human chromosome
1q heterochromatin. Also seen in the upper left hand corner
is an interphase nucleus hybridized with the same probes.
[View Larger Version of this Image (108K GIF file)]
subunit. Regions outside of the protein kinase domain demonstrate little amino
acid homology with the DM-PK, although a short hydrophobic stretch of
amino acids in the carboxyl-terminal portion of the protein is also
conserved. In addition to these sequence differences between the DM-PK
and PK428 protein kinases, additional data demonstrate that the PK428
protein is unique. The PK428 protein kinase described here has a
molecular mass of 65 kDa and undergoes autophosphorylation as well as
phosphorylating histone H1 and a cyclic AMP-dependent protein kinase substrate.
subunit as a bait, suggests that this protein kinase may be
relevant to GM-CSF
subunit signaling. The observation that deletion
of the proline-rich segment or mutation of specific prolines to
glycines blocks this interaction (data not shown) suggests that PK428
binds to a portion of this receptor, which is critical for
hematopoietic signaling.
subunit to hematopoietic cell types induces
marked changes in cell shape and changes in locomotion, cell division,
and differentiation. However, although this PK428 protein kinase was
isolated due to its ability to bind to the intracytoplasmic tail of the
GM-CSF
subunit in yeast, demonstration of a strong interaction
(i.e. coimmunoprecipitation) between the two proteins in
hematopoietic cells has proven to be difficult. The exact role of
PK428, if any, in hematopoietic signaling must await further
analysis.
*
This work was supported in part by United States Public
Health Service Grants DK44741 (to A. S. K.) and GM 44088 (to
V. J. K.), National Institutes of Health Cancer Center Support Core
Grant CA 21765 to St. Jude Children's Research Hospital, and by
support from the American Lebanese Syrian Associated Charities (ALSAC) (to V. J. K.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Current address: Dept. of Biochemistry, University of Kentucky,
Lexington, KY 40506.
Current address: INSERM 449, Hospital Pontchaillou, 35033 Rennes Cedex, France.

To whom correspondence and reprint requests should be
addressed. Tel.: 303-315-8802; Fax: 303-315-5502.
1
The abbreviations used are: DM, myotonic
dystrophy; PK, protein kinase; GM, granulocyte-macrophage; CSF,
colony-stimulating factor; PCR, polymerase chain reaction; FISH,
fluorescence in situ hybridization; GST, glutathione
S-transferase; PAGE, polyacrylamide gel electrophoresis;
DAPI, 4
,6-diamidine-2
-phenylindole dihydrochloride.
2
B. Baur, K. Winter, K. Fischer, and K. Dietz,
unpublished GenBankTM accession numbers Z30329[GenBank] and
Z30330[GenBank].
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
N. Sasagawa, Y. Kino, Y. Takeshita, Y. Oma, and S. Ishiura Overexpression of Human Myotonic Dystrophy Protein Kinase in Schizosaccharomyces pombe Induces an Abnormal Polarized and Swollen Cell Morphology J. Biochem., October 1, 2003; 134(4): 537 - 542. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Furling, L. T. Lam, O. Agbulut, G. S. Butler-Browne, and G. E. Morris Changes in Myotonic Dystrophy Protein Kinase Levels and Muscle Development in Congenital Myotonic Dystrophy Am. J. Pathol., March 1, 2003; 162(3): 1001 - 1009. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. MISTRY, J. R. MOORMAN, S. REDDY, and J. P. MOUNSEY Skeletal muscle Na currents in mice heterozygous for Six5 deficiency Physiol Genomics, August 28, 2001; 6(3): 153 - 158. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.T. Lam, Y.C.N. Pham, N. t. Man, and G.E. Morris Characterization of a monoclonal antibody panel shows that the myotonic dystrophy protein kinase, DMPK, is expressed almost exclusively in muscle and heart Hum. Mol. Genet., September 1, 2000; 9(14): 2167 - 2173. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Di Cunto, E. Calautti, J. Hsiao, L. Ong, G. Topley, E. Turco, and G. P. Dotto Citron Rho-interacting Kinase, a Novel Tissue-specific Ser/Thr Kinase Encompassing the Rho-Rac-binding Protein Citron J. Biol. Chem., November 6, 1998; 273(45): 29706 - 29711. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Mounsey, J. E. John III, S. M. Helmke, E. W. Bush, J. Gilbert, A. D. Roses, M. B. Perryman, L. R. Jones, and J. R. Moorman Phospholemman Is a Substrate for Myotonic Dystrophy Protein Kinase J. Biol. Chem., July 21, 2000; 275(30): 23362 - 23367. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |