JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamashita, T.
Right arrow Articles by Tohyama, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamashita, T.
Right arrow Articles by Tohyama, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 15, Issue of April 11, 1997 pp. 10205-10211
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Cloning and Functional Expression of a Brain Peptide/Histidine Transporter*

(Received for publication, October 31, 1996, and in revised form, January 15, 1997)

Toshihide Yamashita Dagger §par , Shoichi Shimada §, Wei Guo §, Kohji Sato §, Eiji Kohmura , Toru Hayakawa , Tsutomu Takagi Dagger and Masaya Tohyama §

From the Departments of Dagger  Molecular Neurobiology (TANABE), § Anatomy and Neuroscience, and  Neurosurgery, Osaka University School of Medicine, 2-2 Yamadaoka, Suita, Osaka 565, Japan

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

Here we report the cloning and functional characterization of a rat novel peptide/histidine transporter (PHT1), which was expressed in the brain and the retina. The cDNA encodes the predicted protein of 572 amino acid residues with 12 putative membrane-spanning domains. The amino acid sequence has moderate homology with a nonspecific peptide transporter found in the plant. When expressed in Xenopus laevis oocytes, PHT1 cRNA induced high affinity proton-dependent histidine transport activity. This transport process was inhibited by dipeptides and tripeptides but not by free amino acids such as glutamate, glycine, leucine, methionine, and aspartate. Dipeptide carnosine transport activity was also confirmed by direct uptake measurement. By in situ hybridization analysis, PHT1 mRNA was widely distributed throughout whole brain. Especially, intense hybridization signals were found in the hippocampus, choroid plexus, cerebellum, and pontine nucleus. Signals were located in both the neuronal and small nonneuronal cells in these areas. PHT1 protein could contribute to uptake of oligopeptides, which function as neuromodulators, and clearance of degraded neuropeptides and be a new member in the growing superfamily of proton-coupled peptide and nitrate transporters, although its structure, localization, and pharmacological characteristics are unique among these members.


INTRODUCTION

Peptide transport is a specific biochemical process in which small peptides are transported across a membrane by energy-dependent saturable carriers. The transport systems are reported in bacteria, fungi, plants, and mammalian tissues (1-4). A large number of genes that encode components of oligopeptide transport systems in bacteria have been cloned and sequenced, whereas only a few eukaryotic and no more than three mammalian peptide transport genes have been reported (5-10) to study mechanisms of the transport systems in mammalian kidney and intestine. Cloning of the cDNAs encoding the mammalian oligopeptide transporters (5-10) has offered insight into the molecular mechanism for uptake of oligopeptides. They have been identified as proton-dependent electrogenic transporters, and their physiological roles are to absorb small peptides arising from digestion of dietary protein in the small intestine (11), as well as to absorb filtrated peptides generated by luminal peptidases in the kidney (12, 13). Although these transporter genes are expressed also in the brain, no oligopeptide transporter mainly expressed in the nervous system has been reported previously.

In the mammalian nervous system, various amino acids and neuropeptides fulfill wide variety of functions such as neuronal transmission, cellular metabolism, and cell volume regulation. They should be removed from extracellular space after finishing their roles; for example, excess glutamate is removed from synapses by its transporters. Catabolism cascade and translocation of much of these compounds are unclear yet, although various aminopeptidases have been identified in the central nervous system that might play a role in the catabolism of neuropeptides (14). Peptide transporters in the brain could contribute to clearance of degraded neuropeptides and relate to cell metabolism. They might also contribute to uptake of bioactive peptides.

Here we report the cloning of a novel peptide/histidine transporter expressed in the rat brain. The transporter has been characterized by functional expression in Xenopus laevis oocytes. Tissue distribution and localization have also been studied by Northern blot analysis and in situ hybridization.


EXPERIMENTAL PROCEDURES

Screening of the cDNA Library

A rat brain cDNA library constructed in the cloning vector ZAP II (primed with oligo(dT); Stratagene) was screened by means of plaque hybridization. The probe was a 55-bp1 oligonucleotide (TCATCCATCCGATGGCTTTGATAGACACCAGTGCCAGCAGTCCAGAACCCACGAA) synthesized from the human gene in the data base for expressed sequence tags, which is homologous to rabbit intestinal peptide transporter (PepT1) cDNA (Homo sapiens cDNA clone 39680-5'). The probe was labeled with [gamma -32P]ATP using polynucleotide end kinase supplied by Pharmacia Biotech Inc.. Hybridization was carried out at 42 °C in a solution containing 40% formamide, 5 × saline/sodium phosphate/EDTA, 1 × Denhardt's solution, 0.1% SDS, and 100 µg/ml salmon sperm DNA. Washing was done under medium stringency conditions, once in 2 × SSC (1 × SSC is 0.15 M NaCl, 0.015 M sodium citrate, pH 7.0) at room temperature for 30 min and twice in 1 × SSC and 0.4% SDS at 50 °C for 30 min. Positive clones were identified and plaque purified by secondary screening, followed by DNA extraction using a standard method (15). Insert cDNAs in positive phages were recirculated to the subclone in the pBluescript SK(-) phagemid vector after superinfection with R408 helper phages as recommended by the manufacturer (Stratagene). For subsequent sequence analysis, a set of deletion clones was prepared from the insert cDNAs using a kilosequencing deletion kit (Takara).

DNA Sequencing and Analysis

Sequencing was carried out by the dideoxy chain termination method (16) using a Taq dye primer cycle sequencing kit (Applied Biosystems Inc., Tokyo, Japan). The nucleotide sequences were then analyzed with an Applied Biosystems 373A automated DNA sequencer. The final sequence was confirmed from both strands. Sequence homology searches and comparison were performed with the National Center for Biotechnology Information E-mail server FASTA, the BLAST (BLASTX) E-mail server on the Genome Net, and molecular analysis systems in the DNA Data Bank of Japan.

Functional Expression in X. laevis Oocytes

This was done as described previously (17) by microinjecting cRNA (25 ng) derived from the clone. The plasmid cDNA was linearized with ApaI and transcribed using T3 RNA polymerase for sense RNA and was also linearized with EcoRI and transcribed using T7 RNA polymerase for antisense RNA. Capping was done with the cap analog m7G(5')PPP(5')G (Ambion). Adult female X. laevis were anesthetized with ice and dissected, and their ovaries were removed and placed in Ca2+-free ND96 solution (96 mM NaCl, 2 mM KCl, 1 mM MgCl2, and 5 mM HEPES, pH 7.5) with 2 mg/ml collagenase at 20 °C for 2 h with gentle agitation. Stage 5-6 oocytes (1~1.2 mm in diameter; mean value, 1.1 mm) were selected (18) by hand, and oocytes were injected manually and immediately with 25 ng of a cRNA in diethylpyrocarbonate-treated H2O by using a positive displacement pipette (Drummond Scientific Corp., Broomall, PA). Transport measurements were made with individual oocytes 3 days after injection. The concentration of [14C]histidine (Amersham Corp.) was 1 µM with or without inhibitors, and the uptake medium was ND96 solution (5 mM HEPES, 96 mM NaCl, 2 mM KCl, 1 mM MgCl2, and 1.8 mM CaCl2), pH 5.5, 6.5, and 7.5. The concentration of [3H]carnosine (Moravek Biochemicals, Brea, CA) was 1.5 µM. The incubation time for transport measurements with oocytes was 1 h, at a temperature of 25 °C. After washing the oocytes three times with ND96 at 4 °C, they were homogenized, and the incorporated radioactivity was counted in a Beckman Instruments scintillation counter. Na+ dependence was tested in Na+-free ND96 in which NaCl was replaced by choline chloride. Nonspecific transport and binding were determined in parallel experiments with antisense cRNA- and water-injected and noninjected oocytes. Data represent PHT1 cRNA-induced transport, calculated by subtracting the transport in control oocytes from the sense cRNA-injected oocytes.

Northern Blot Analysis

Tissue distribution of mRNA transcripts coding for this transporter was determined by Northern blot. Total RNA was isolated by the acid guanidinium isothiocyanate-phenol-chloroform method as described previously (19). Aliquots (40 µg) of RNA were separated on 1% agarose-formaldehyde gels and was transferred onto nylon membranes (Hybond-N, Amersham). A 600-bp rat cDNA (bases 260-860) was labeled by random priming (Amersham) with [alpha -32P]dCTP (3000 Ci/mmol, Amersham). Hybridization was carried out at 42 °C overnight in 50% formamide, 5 × SSC, 0.1% SDS, 50 mM sodium phosphate, 5 × Denhardt's solution, and 100 µg/ml salmon sperm DNA. The blots were washed three times at 42 °C for 30 min in 1 × SSC and 0.1% SDS. With the aid of intensifying screens, the membranes were then placed in contact with x-ray film at -80 °C for 5 days. After quantification of the hybridized probe, it was removed from the membrane to be hybridized with the glyceraldehyde-3-phosphate dehydrogenase probe. The hybridized probe was removed with a boiling solution of 0.1% SDS poured on the membrane and allowed to cool to room temperature. After the removal of the probe, hybridization and washing for the glyceraldehyde-3-phosphate dehydrogenase probe was carried out in the same manner. Finally, x-ray film was placed on the membrane at -80 °C for 16 h.

In Situ Hybridization

Localization of the transporter mRNA in the brain was determined by in situ hybridization. The antisense and sense probes were synthesized from a 600-bp rat PHT1 cDNA (bases 260-860) insert cloned in the Novagen T vector. To synthesize hybridization riboprobes by in vitro transcription, this sequence was first linearized by digestion with appropriate restriction endonucleases. The linearized cDNA was then incubated at 37 °C for 60 min with a mixture of reagents. This mixture consisted of 2 µl of transcription buffer (5×), 0.5 µl of 100 mM dithiothreitol, 0.5 µl of RNase inhibitor, 0.5 µl of 10 mM ATP, CTP, and GTP, 5 µl of 35S-UTP (NEG-039H, DuPont NEN), and 0.5 µl of DNA template (1 µg/ml) with 1 µl of appropriate RNA polymerase (T7 RNA polymerase for the antisense probe and SP6 RNA polymerase for the sense probe). DNA digestion was attained with the addition of 2 µl of DNase and incubation at 37 °C for 10 min. Efficacy of labeling was estimated by counting radioactivity of the synthesized probes.

In situ hybridization techniques for PHT1 mRNA (RNA probe) were based on those of Wilkinson et al. (20) with some modification. The sections were fixed in 4% paraformaldehyde in 0.1 M phosphate buffer for 20 min. After washing with phosphate buffer, the sections were treated with 10 µg/ml of proteinase K in 50 mM Tris-HCl and 5 mM EDTA, pH 8.0, for 5 min at room temperature. They were then fixed again in the same fixative, acetylated with acetic anhydride in 0.1 M triethanolamine, rinsed with phosphate buffer, dehydrated, and air dried. The 35S-labeled RNA probes (sense or antisense) were diluted in hybridization buffer, placed over the sections, and covered with siliconized coverslips. Hybridization was performed overnight in a humid chamber at 55 °C. The hybridization buffer consisted of 50% deionized formamide, 0.3 M NaCl, 20 mM Tris-HCl, 5 mM EDTA, 10 mM phosphate buffer, 10% dextran sulfate, 1 × Denhardt's solution, 0.2% sarcosyl, 500 µg/ml yeast tRNA, and 200 µg/ml herring sperm DNA (pH 8.0). The probe concentration was 5 × 105 cpm/150 µl/slide. After hybridization, the slides were immersed in 5 × SSC at 55 °C, and the coverslips were allowed to fall off. The sections were then incubated at 65 °C in 50% deionized formamide with 2 × SSC for 30 min. After rinsing with RNase buffer (0.5 M NaCl, 10 mM Tris-HCl, and 5 mM EDTA, pH 8.0) four times for 10 min each at 37 °C, the sections were treated with 1 µg/ml of RNase A in RNase buffer for 30 min at 37 °C. After an additional washing in RNase buffer, the slides were incubated in 50% formamide with 2 × SSC for 30 min at 65 °C, rinsed with 2 and 0.1 × SSC for 10 min each at room temperature, dehydrated in an ascending alcohol series, and air dried.

X-ray film was placed on the uncoated sections for 3 days. Next, the slides were coated with Ilford K-5 emulsion diluted in distilled water containing 2% glycerine (1:1). The slides were exposed for 3 weeks in a tightly sealed dark box at 4 °C, developed in Kodak D-19 emulsion, fixed with photographic fixer, stained with thionine, and coverslipped. After the x-ray macroautoradiogram had been studied, the tissue sections were examined under a regular light microscope.


RESULTS

Isolation of the Full-length PHT1 cDNA

We isolated 11 positive clones from a rat brain cDNA library using the 55-mer oligonucleotide probe synthesized from an expression sequence tag clone that showed homology with the rabbit oligopeptide transporter (PepT1) cDNA. Restriction enzyme analysis revealed the same digestion pattern, suggesting that all these clones were originating from a single gene. It was confirmed by DNA sequence. The longest cDNA construct was subcloned into pBluescript SK(-).

The cDNA is 2751 bp long with an open reading frame of 1719 bp (including the termination codon) encoding a protein of 572 amino acids (Fig. 1A), of which the gene was designated PHT1. The open reading frame is flanked by a 24-bp long sequence at the 5'-end and by a 1008-bp sequence at the 3'-end. The proposed initiating ATG conforms to a Kozak consensus sequence (21). A polyadenylation signal, ATAAA, was found in the 3'-noncoding region. The encoded protein is predicted to have a core molecular mass of 64.9 kDa. There is no N-terminal signal sequence. Hydropathy analysis (22-25) of the primary amino acid sequence of the predicted protein shows the presence of 12 putative transmembrane domains. Four potential N-linked glycosylation sites of PHT1 protein are located at positions 134, 141, 220, and 435 in the hydrophilic regions that according to a model based on the hydropathy analysis face the extracellular matrix. There are 11 potential sites for protein kinase C-dependent phosphorylation but no site for protein kinase A-dependent phosphorylation. The amino acid sequence of this clone shows significant similarity to the peptide transporter (histidine transport protein) NTR1 from the plant Arabidopsis thaliana (29% identity and 50% similarity) (Fig. 1B). The consensus sequence with PHT1 and NTR1 proteins was most conserved in the regions corresponding to putative fifth and sixth membrane spanning portions (45% identity and 67% similarity). Members of the mammalian peptide transporters reveal only weak similarity with PHT1 protein such as PepT1 (17% identity and 32% similarity) and PepT2 proteins (12% identity and 27% similarity). However, there is no significant similarity between PHT1 protein and the hpt-1 protein, which encodes a protein associated with intestinal peptide transport (10).



Fig. 1. A, DNA sequence and predicted primary amino acid sequence of PHT1. The predicted 12 transmembrane domains are underlined. Four potential N-linked glycosylation sites (bullet ) of PHT1 are located at positions 134, 141, 220, and 435. B, alignment of amino acid sequences encoding rat PHT1, NTR1 from A. thaliana, and PepT1 and rPepT2 from rabbit.
[View Larger Versions of these Images (90 + 48K GIF file)]


Functional Expression of PHT1

To assess the transport activity of PHT1 protein, uptake of [14C]histidine was monitored by a Xenopus oocyte uptake assay.

The oocytes injected with the sense cRNA (derived from the cDNA insert cloned into pBluescript SK(-)) consistently showed more than 5-fold histidine transport activity than did antisense cRNA- or water-injected or noninjected oocytes. There was no difference among antisense cRNA- or water-injected or noninjected oocytes.

The histidine uptake into oocytes expressing PHT1 protein during 1 h was linear (Fig. 2A), and an incubation period of 1 h was used in subsequent experiments to approximate the initial transport rate. Transport of histidine into oocytes expressing PHT1 protein was saturable, and the Km value (pH 5.5) for histidine was 17 µM, showing that PHT1 cDNA encodes a high affinity histidine transporter (Fig. 2, B and C).


Fig. 2. Kinetics of histidine transport in X. laevis oocytes injected with PHT1 cRNA. Oocytes were microinjected with 25 ng of PHT1 cRNA, and transport of [14C]histidine (1 µM) was measured with individual oocytes on day 3 after injection over a concentration range of 1-1000 µM. Data represent PHT1 cRNA-induced transport, calculated by subtracting the transport in control oocytes from the sense cRNA injected oocytes. Values represent means ± S.E. (bars) of four determinations. A, transport of histidine (1 µM) was measured for different periods at pH 5.5. B, saturation analysis of histidine transport. C, Eadie-Hofstee plot of data in A. The Km was 17 µM. D, the cation specificity of the induced transport activity in cRNA-injected oocytes was determined by replacing NaCl with choline chloride. Replacement of Na+ did not reduce histidine influx. Transport activity at 4 °C was almost abolished. E, the expressed transporter was proton-dependent, because the histidine transport measured at pH 5.5 was 3-fold higher than that at pH 7.5.
[View Larger Version of this Image (18K GIF file)]


The cation specificity of the induced transport activity was determined by replacing NaCl in the ND96 solution with choline chloride. The replacement did not affect histidine influx, indicating that Na+ would not serve as the cotransported ion (Fig. 2D). Transport activity at 4 °C was almost eliminated, suggesting that this transporter is temperature-dependent (Fig. 2D). The expressed transporter was proton-dependent, because the histidine transport when measured at pH 5.5 was 3-fold more voluminous than at pH 7.5 (Fig. 2E).

Since other mammalian peptide transporters have a broad substrate specificity, we examined the selectivity of PHT1 protein by inhibition studies, in which the ability of unlabeled amino acids, dipeptides, and tripeptides to compete with [14C]histidine (1 µM) was tested. Amino acids such as glutamate, glycine, leucine, methionine, aspartate, cyclo-(Leu-Gly), and leucine-enkepharine had no effect on the histidine transport at an inhibitor concentration of 500 µM (Fig. 3; data not shown as aspartate). On the other hand, the efficient competitive ability of Gly-Gly, Gly-Leu, Met-Met, carnosine, His-Leu, and Gly-Gly-Gly was observed even at a concentration of 50 µM (Fig. 3). Various dipeptides and tripeptides thus were potent inhibitors of histidine transport.


Fig. 3. Substrate specificity of PHT1. Selectivity of interaction of peptides by inhibition studies is shown. In these experiments, the ability of unlabeled amino acids, dipeptides, and tripeptides to compete with [14C]histidine (1 µM) for the transport process induced by PHT1 was studied. Data show percentages of labeled histidine uptake. At an inhibitor concentration of 500 µM, glutamate, glycine, leucine, methionine, cyclo-(Leu-Gly) and leucine-enkepharine had no effect on the transport. The efficient competitive ability of Gly-Gly, Gly-Leu, Met-Met, carnosine, His-Leu, and Gly-Gly-Gly at a concentration of 50 µM was seen. Various dipeptides and tripeptides seem to be potent inhibitors of the histidine transport.
[View Larger Version of this Image (37K GIF file)]


To confirm that PHT1 is an oligopeptide transporter, the transport of the dipeptide carnosine by the oocytes was measured (Fig. 4). The oocytes injected with the sense cRNA showed more than 10-fold carnosine transport activity than did water-injected oocytes. In addition, 50 µM unlabeled carnosine efficiently competed with labeled carnosine (1.5 µM) for the transport process.


Fig. 4. Transport of carnosine in X. laevis oocytes injected with PHT1 cRNA or with water. Oocytes were microinjected with 25 ng of PHT1 cRNA, and transport of [3H]carnosine (1.5 µM) was measured with individual oocytes on day 3 after injection. Water-injected oocytes served as controls. Transport in cRNA-injected oocytes (A) and in water-injected oocytes (B) was measured at pH 5.5. Transport of radiolabeled carnosine (1.5 µM) in cRNA-injected oocytes in the presence of 50 µM unlabeled carnosine (C) was efficiently inhibited.
[View Larger Version of this Image (11K GIF file)]


Since PHT1 is considered to be an electrogenic transporter, and membrane potential may affect the measured kinetics, determined constants are fundamentally relevant to the experimental conditions, which were not made under voltage-clamped conditions.

Tissue Distribution and Localization of PHT1 mRNA

Tissue-specific expression of the mRNA corresponding to PHT1 was examined by high-stringency Northern analysis (Fig. 5). PHT1 mRNA (2.9 kilobases) in rat tissues was abundantly expressed in the brain and eye, whereas faint signals were observed in the lung and spleen, and no transcripts were detected in the pancreas, kidney, intestine, liver, heart, and skeletal muscle. This distribution was significantly different from those of the other mammalian oligopeptide transporters, PepT1 and PepT2 (5-7), which were found to express abundantly in the small intestine, kidney, and liver. PHT1 is the first peptide/histidine transporter predominantly expressed in the nervous system.


Fig. 5. Northern blot analysis. Tissue-specific expression of the mRNA corresponding to PHT1 was examined by high stringency Northern analysis. PHT1 mRNA (2.9 kilobases) in rat tissues was abundantly expressed in the brain and eye, whereas very faint signals were observed in the lung and spleen, and no transcripts were detected in the pancreas, kidney, intestine, liver, heart, and spleen. Each lane contained 40 µg of total RNA, and lanes 1-10 represent the pancreas, kidney, intestine, liver, spleen, heart, lung, skeletal muscle, brain, and eye, respectively.
[View Larger Version of this Image (96K GIF file)]


To determine the detailed localization of PHT1 gene expression in the brain, we performed in situ hybridization using a 35S-labeled cRNA probe. Specificity of hybridization signals for PHT1 mRNA was confirmed by control study using the sense cRNA probe. In adult rats, strong expression of PHT1 mRNA was detected in the hippocampus, cerebellum, and pontine nucleus, and weak to moderate expression was detected in other regions of the brain, including the cerebral cortex, brain stem, thalamus, and hypothalamus (Fig. 6, A and B). The PHT1 mRNA signals were detected in both the neuronal cells and small nonneuronal cells in the brain.


Fig. 6. Macroautoradiogram of in situ hybridization. Saggital sections of the adult rat brain (A) and coronal sections of the cerebrum (B) show the hybridization of the antisense cRNA probe. Strong expression of PHT1 mRNA was detected in the hippocampus, cerebellum, and pontine nucleus, and weak to moderate expression was detected in other regions in the brain, including the cerebral cortex, brain stem, thalamus, and hypothalamus. In the hippocampus, robust signals were seen in Fields CA1-3 of Ammon's horn and the dentate gyrus.
[View Larger Version of this Image (164K GIF file)]



DISCUSSION

The amino acid sequence of PHT1, a novel peptide/histidine transporter abundantly expressed in the nervous system, was most similar to that of the peptide transporter (histidine transport protein) NTR1 from the plant A. thaliana (26-28), although weak or no similarity was found between PHT1 and other mammalian peptide transporters.

When expressed in X. laevis oocytes, the PHT1 gene product induced high affinity proton-dependent histidine transport activity. The uptake mediated by the transporter was dependent on proton and temperature and completely independent of extracellular Na+. As PHT1 protein seems to be a member of the peptide and nitrate transporter superfamily, we next determined the substrate specificity of PHT1 protein by competition experiments and direct uptake measurement of dipeptide in the oocytes. Various dipeptides and tripeptides are potent substrates for PHT1. The substrate specificity of transport activities resembles that of the NTR1 protein, which is a high affinity oligopeptide transporter. Among dipeptides and tripeptides used in this study, Met-Met, carnosine, and His-Leu had more potent inhibitory effects, although glycyl peptides (Gly-Gly, Gly-Leu, and Gly-Gly-Gly) were less effective inhibitors of histidine transport. This finding is also similar to the feature of NTR1 protein.

The findings that both neuronal and nonneuronal cells in the brain widely express the mRNA for this transporter suggest that the removal of degraded neuropeptides and oligopeptides as well as the uptake of peptide-derived drugs circulating in the blood might be attained in these cells. In particular, signals in the tuberomamillary nucleus of the posterior hypothalamus suggest that PHT1 protein could uptake histidine as a substrate for histamine synthesis.

There are several oligopeptides that are considered neuromodulators, and some have been found to be eliminated by uptake after being released into the synaptic cleft (29). PHT1 might function as a terminator of these neuromodulators. On the other hand, various neuropeptides, for example, Met-enkephalin, are metabolized to become metabolic fragments, rate of accumulation of which was specific to brain regions due to the difference of peptidases. However, how these degraded oligopeptides are removed from the synapse has not been confirmed (30). PHT1 might be related to the catabolic pathway of neuropeptides. Recent data show that the levels of oligopeptides in serum are manyfold higher than once thought (31). The uptake of small peptides after intravenous administration was observed in the central nervous system as well as in the kidney (32). These oligopeptides might be transported into the cells and be used as nutrients and for the regulation of cellular metabolism in the central nervous system.

To summarize, this report concerns the primary structure and functional characterization of PHT1 protein, a novel proton-coupled histidine and oligopeptide transporter in the nervous system. PHT1 protein could be involved in the clearance of neuromodulators and in the catabolic process of degraded neuropeptides in the brain. Precise mechanisms need elucidation in future studies. This transporter represents a new member in the growing superfamily of proton-coupled peptide and nitrate transporters and shows distinct structural differences and specific localization.


FOOTNOTES

*   The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AB000280[GenBank].


par    To whom correspondence should be addressed: Dept. of Anatomy and Neuroscience, Osaka University School of Medicine, 2-2 Yamadaoka, Suita, Osaka 565, Japan. Tel.: 81-6-879-3221; Fax: 81-6-879-3229.
1   The abbreviations used are: bp, base pair; PepT, peptide transporter; PHT, peptide/histidine transporter.

ACKNOWLEDGEMENTS

We thank K. Nakano for nucleotide sequencing. We are grateful to Dr. Motohiko Takemura for helpful discussion.


REFERENCES

  1. Becker, J. M., and Naider, F. (1980) in Microorganisms and Nitrogen Sources (Payne, J. W., ed), pp. 257-279, John Wiley & Sons, Inc., New York
  2. Higgins, C. F., and Payne, J. W. (1980) in Microorganisms and Nitrogen Sources (Payne, J. W., ed), pp. 609-639, John Wiley & Sons, Inc., New York
  3. Payne, J. W. (1980) in Microorganisms and Nitrogen Sources (Payne, J. W., ed), pp. 211-256, John Wiley & Sons, Inc., New York
  4. Naider, F., and Becker, J. M. (1987) in Current Topics in Medical Mycology (McGinnis, M. M., ed), Vol. II, pp. 170-198, Springer-Verlag, New York
  5. Fei, J. Y., Kanai, Y., Nussberger, S., Ganapathy, V., Leibach, H. F., Romero, F. M., Singh, K. S., Boron, F. W., and Hediger, A. M. (1994) Nature 368, 563-566 [CrossRef][Medline] [Order article via Infotrieve]
  6. Liang, R., Fei, Y.-J., Prasad, P. D., Ramamoorthy, S., Han, H., Yang-Feng, T. L., Hediger, M. A., Ganapathy, V., and Leibach, F. H. (1995) J. Biol. Chem. 270, 6456-6463 [Abstract/Free Full Text]
  7. Liu, W., Liang, R., Ramamoorthy, S., Fei, J. Y., Ganapathy, E. M., Hediger, A. M., Ganapathy, V., and Leibach, H. F. (1995) Biochim. Biophys. Acta 1235, 461-466 [Medline] [Order article via Infotrieve]
  8. Perry, J. R., Basrai, M. A., Steiner, H. Y., Naider, F., and Becker, J. M. (1994) Mol. Cell. Biol. 14, 104-115 [Abstract/Free Full Text]
  9. Boll, M., Herget, M., Wagener, M., Weber, M. W., Markovich, D., Biber, J., Clauss, W., Murer, H., and Daniel, H. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 284-289 [Abstract/Free Full Text]
  10. Dantzig, A. H., Hoskins, J., Tabas, L. B., Bright, S., Shepard, R. L., Jenkins, I. L., Duckworth, D. C., Sportsman, J. R., Mackensen, D., Rosteck, P. R., Jr., and Skatrud, P. L. (1994) Science 264, 430-433 [Abstract/Free Full Text]
  11. Ganapathy, V., Brandsch, M., and Leibach, F. H. (1994) in Physiology of the Gastrointestinal Tract (Johnson, L. R., ed), 3rd Ed., pp. 1773-1794, Raven Press, New York
  12. Truppathi, C., Ganapathy, V., and Leibach, F. H. (1990) J. Biol. Chem. 265, 14870-14874 [Abstract/Free Full Text]
  13. Daniel, H., and Adibi, S. A. (1993) J. Clin. Invest. 92, 2215-2223
  14. Mantle, D. (1992) Clin. Chim. Acta. 207, 107-118 [CrossRef][Medline] [Order article via Infotrieve]
  15. Sambrook, J., Fritsch, E., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  16. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 5463-5467 [Abstract/Free Full Text]
  17. Shimada, S., Kitayama, S., Lin, C.-L., Patel, A., Nanthakumar, E., Gregor, P., Kuhar, M., and Uhl, G. (1991) Science 254, 576-578 [Abstract/Free Full Text]
  18. Dumont, J. M. (1972) J. Morphol. 136, 153-180 [CrossRef][Medline] [Order article via Infotrieve]
  19. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156-159 [Medline] [Order article via Infotrieve]
  20. Wilkinson, D. G., Peters, G., and Dickson, C. (1988) EMBO J. 7, 691-695 [Medline] [Order article via Infotrieve]
  21. Kosak, M. (1986) Cell 44, 283-292 [CrossRef][Medline] [Order article via Infotrieve]
  22. Bertran, J., Werner, A., Stange, J., Biber, J., and Murer, H. (1993) Biochem. J. 281, 717-723
  23. Markovich, D., Forgo, J., Stange, G., Biber, J., and Murer, H. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 8073-8077 [Abstract/Free Full Text]
  24. Eisenberg, D., Weiss, R. M., and Terwilliger, T. C. (1984) Proc. Natl. Acad. Sci. U. S. A. 81, 140-144 [Abstract/Free Full Text]
  25. Kyte, J., and Doolittle, R. F. (1982) J. Mol. Biol. 157, 105-132 [CrossRef][Medline] [Order article via Infotrieve]
  26. Steiner, Y. H., Song, W., Zhang, L., Naider, F., Becker, M. J., and Stacey, G. (1994) Plant Cell 6, 1289-1299 [Abstract]
  27. Frommer, B. W., Hummel, S., and Rentsch, D. (1994) FEBS Lett. 347, 185-189 [CrossRef][Medline] [Order article via Infotrieve]
  28. Rentsch, D., Laloi, M., Rouhara, I., Schmelzer, E., Delrot, S., and Frommer, B. W. (1994) FEBS Lett. 370, 264-268
  29. Williamson, C. L., and Neale, H. J. (1992) J. Neurochem. 58, 2191-2199 [CrossRef][Medline] [Order article via Infotrieve]
  30. Konkoy, S. C., and Davis, P. T. (1995) J. Neurochem. 65, 2773-2782 [Medline] [Order article via Infotrieve]
  31. Seal, C. J., and Parker, D. S. (1991) Comp. Biochem. Physiol. B 99, 679-685 [CrossRef][Medline] [Order article via Infotrieve]
  32. Stehle, P., Ratz, I., and Furst, P. (1991) Ann. Nutr. Metab. 35, 213-220 [Medline] [Order article via Infotrieve]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Physiol. GenomicsHome page
I. M. Frey, I. Rubio-Aliaga, A. Siewert, D. Sailer, A. Drobyshev, J. Beckers, M. H. de Angelis, J. Aubert, A. B. Hen, O. Fiehn, et al.
Profiling at mRNA, protein, and metabolite levels reveals alterations in renal amino acid handling and glutathione metabolism in kidney tissue of Pept2-/- mice
Physiol Genomics, February 12, 2007; 28(3): 301 - 310.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
H. Daniel, B. Spanier, G. Kottra, and D. Weitz
From Bacteria to Man: Archaic Proton-Dependent Peptide Transporters at Work
Physiology, April 1, 2006; 21(2): 93 - 102.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
X. Cen, A. Nitta, S. Ohya, Y. Zhao, N. Ozawa, A. Mouri, D. Ibi, L. Wang, M. Suzuki, K. Saito, et al.
An analog of a dipeptide-like structure of FK506 increases glial cell line-derived neurotrophic factor expression through cAMP response element-binding protein activated by heat shock protein 90/Akt signaling pathway.
J. Neurosci., March 22, 2006; 26(12): 3335 - 3344.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
H. Shen, R. F. Keep, Y. Hu, and D. E. Smith
PEPT2 (Slc15a2)-Mediated Unidirectional Transport of Cefadroxil from Cerebrospinal Fluid into Choroid Plexus
J. Pharmacol. Exp. Ther., December 1, 2005; 315(3): 1101 - 1108.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
S. M. Ocheltree, H. Shen, Y. Hu, R. F. Keep, and D. E. Smith
Role and Relevance of Peptide Transporter 2 (PEPT2) in the Kidney and Choroid Plexus: In Vivo Studies with Glycylsarcosine in Wild-Type and PEPT2 Knockout Mice
J. Pharmacol. Exp. Ther., October 1, 2005; 315(1): 240 - 247.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
B. S. Anand, S. Katragadda, and A. K. Mitra
Pharmacokinetics of Novel Dipeptide Ester Prodrugs of Acyclovir after Oral Administration: Intestinal Absorption and Liver Metabolism
J. Pharmacol. Exp. Ther., November 1, 2004; 311(2): 659 - 667.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C.-S. Chiang, G. Stacey, and Y.-F. Tsay
Mechanisms and Functional Properties of Two Peptide Transporters, AtPTR2 and fPTR2
J. Biol. Chem., July 16, 2004; 279(29): 30150 - 30157.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
S. M. Ocheltree, H. Shen, Y. Hu, J. Xiang, R. F. Keep, and D. E. Smith
Mechanisms of Cefadroxil Uptake in the Choroid Plexus: Studies in Wild-Type and PEPT2 Knockout Mice
J. Pharmacol. Exp. Ther., February 1, 2004; 308(2): 462 - 467.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
I. Rubio-Aliaga, I. Frey, M. Boll, D. A. Groneberg, H. M. Eichinger, R. Balling, and H. Daniel
Targeted Disruption of the Peptide Transporter Pept2 Gene in Mice Defines Its Physiological Role in the Kidney
Mol. Cell. Biol., May 1, 2003; 23(9): 3247 - 3252.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
H. Daniel and I. Rubio-Aliaga
An update on renal peptide transporters
Am J Physiol Renal Physiol, May 1, 2003; 284(5): F885 - F892.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
H. Toyobuku, Y. Sai, T. Kagami, I. Tamai, and A. Tsuji
Delivery of Peptide Drugs to the Brain by Adenovirus-Mediated Heterologous Expression of Human Oligopeptide Transporter at the Blood-Brain Barrier
J. Pharmacol. Exp. Ther., April 1, 2003; 305(1): 40 - 47.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
H. Shen, D. E. Smith, R. F. Keep, J. Xiang, and F. C. Brosius III
Targeted Disruption of the PEPT2 Gene Markedly Reduces Dipeptide Uptake in Choroid Plexus
J. Biol. Chem., February 7, 2003; 278(7): 4786 - 4791.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
C. Shu, H. Shen, N. S. Teuscher, P. J. Lorenzi, R. F. Keep, and D. E. Smith
Role of PEPT2 in Peptide/Mimetic Trafficking at the Blood-Cerebrospinal Fluid Barrier: Studies in Rat Choroid Plexus Epithelial Cells in Primary Culture
J. Pharmacol. Exp. Ther., June 1, 2002; 301(3): 820 - 829.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
S. Ugawa, Y. Sunouchi, T. Ueda, E. Takahashi, Y. Saishin, and S. Shimada
Characterization of a mouse colonic system B0+ amino acid transporter related to amino acid absorption in colon
Am J Physiol Gastrointest Liver Physiol, August 1, 2001; 281(2): G365 - G370.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
Y.-H. Han, D. H. Sweet, D.-N. Hu, and J. B. Pritchard
Characterization of a Novel Cationic Drug Transporter in Human Retinal Pigment Epithelial Cells
J. Pharmacol. Exp. Ther., April 13, 2001; 296(2): 450 - 457.
[Abstract] [Full Text]


Home page
J. Pharmacol. Exp. Ther.Home page
N. S. Teuscher, A. Novotny, R. F. Keep, and D. E. Smith
Functional Evidence for Presence of PEPT2 in Rat Choroid Plexus: Studies with Glycylsarcosine
J. Pharmacol. Exp. Ther., August 1, 2000; 294(2): 494 - 499.
[Abstract] [Full Text]


Home page
IOVSHome page
Y. Saishin, R. Ishikawa, S. Ugawa, W. Guo, T. Ueda, H. Morimura, K. Kohama, H. Shimizu, Y. Tano, and S. Shimada
Retinal Fascin: Functional Nature, Subcellular Distribution, and Chromosomal Localization
Invest. Ophthalmol. Vis. Sci., July 1, 2000; 41(8): 2087 - 2095.
[Abstract] [Full Text]


Home page
Plant Physiol.Home page
C.-M. Lin, S. Koh, G. Stacey, S.-M. Yu, T.-Y. Lin, and Y.-F. Tsay
Cloning and Functional Characterization of a Constitutively Expressed Nitrate Transporter Gene, OsNRT1, from Rice
Plant Physiology, February 1, 2000; 122(2): 379 - 388.
[Abstract] [Full Text]


Home page
Plant CellHome page
N.-C. Huang, K.-H. Liu, H.-J. Lo, and Y.-F. Tsay
Cloning and Functional Characterization of an Arabidopsis Nitrate Transporter Gene That Encodes a Constitutive Component of Low-Affinity Uptake
PLANT CELL, August 1, 1999; 11(8): 1381 - 1392.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Cell Physiol.Home page
H. Wang, Y.-J. Fei, V. Ganapathy, and F. H. Leibach
Electrophysiological characteristics of the proton-coupled peptide transporter PEPT2 cloned from rat brain
Am J Physiol Cell Physiol, October 1, 1998; 275(4): C967 - C975.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J.-J. Zhou, F. L. Theodoulou, I. Muldin, B. Ingemarsson, and A. J. Miller
Cloning and Functional Characterization of a Brassica napus Transporter That Is Able to Transport Nitrate and Histidine
J. Biol. Chem., May 15, 1998; 273(20): 12017 - 12023.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamashita, T.
Right arrow Articles by Tohyama, M.