JBC PeproTech; Our Business is Cytokines!

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow An addition or correction has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Weihua, X.
Right arrow Articles by Kalvakolanu, D. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Weihua, X.
Right arrow Articles by Kalvakolanu, D. V.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 15, Issue of April 11, 1997 pp. 9742-9748
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Modulation of Interferon Action by Retinoids
INDUCTION OF MURINE STAT1 GENE EXPRESSION BY RETINOIC ACID*

(Received for publication, August 13, 1996, and in revised form, January 10, 1997)

Xiao Weihua Dagger , Venkatadri Kolla Dagger § and Dhananjaya V. Kalvakolanu

From the University of Maryland Cancer Center, Department of Microbiology & Immunology, Program in Oncology, Molecular and Cellular Biology Program, University of Maryland School of Medicine, Baltimore, MD 21201

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

We have previously demonstrated that up-regulation of STAT1 protein by all-trans-retinoic acid (RA) in interferon (IFN)-unresponsive cells permits growth inhibition by IFNs. Here, we show that the promoter of STAT1 directly responds to retinoic acid treatment. Sequence and functional analysis of the murine STAT1 promoter have identified a direct repeat motif that serves as a retinoic acid response element. Mutagenesis of this element resulted in a loss of response to RA. This element is activated by RA receptors alpha , beta , and gamma . In vivo, RA receptor beta  and retinoid X receptor alpha preferentially interacted with this element. Thus, these data define a molecular basis for the synergy between IFNs and retinoids in tumor growth inhibition.


INTRODUCTION

Interferons (IFNs)1 regulate cellular antiviral, antitumoral, and immunological responses via specific gene induction (1). Ligand-bound IFN receptors induce the tyrosine phosphorylation of cytoplasmic STAT (signal transducers and activators of transcription) proteins employing Janus kinases (JAKs). Activated STATs then migrate to the nucleus and bind to specific response elements to induce the expression of IFN-stimulated genes (2). IFNs-alpha /beta induce cellular genes via an IFN-stimulated response element, which binds several transacting factors of which ISGF-3 is the primary regulator (2). This factor consists of a 48-kDa DNA binding protein (ISGF3gamma ) and three tyrosine phosphorylated proteins, STAT1alpha , STAT1beta , and STAT2 (2). Two Janus kinases, tyk2 and JAK1, are essential for the activation of STATs in response to IFN-alpha /beta . Ligand-stimulated IFN-gamma receptor, employing Janus kinases JAK1 and JAK2, induces phosphorylation of STAT1 but not STAT2. STAT1 then migrates to nucleus, binds to gamma -IFN-activated site, and induces gene expression (2). Cell mutants lacking STAT1 and JAK1 fail to respond to IFN-alpha /beta and IFN-gamma (3, 4). Thus, JAK1 and STAT1 are common signaling components for all IFNs.

All-trans-retinoic acid (RA), a potent biological response modifying metabolite of vitamin A, induces cellular gene expression utilizing nuclear receptors that also act as transcription factors (5). These receptors bind to retinoic acid response elements (RARE) to activate gene transcription. Retinoic acid receptors (RAR) and retinoid X receptors (RXR) are the two major mediators of retinoid actions (5). Three major forms of RARs and RXRs, alpha , beta , and gamma , and the corresponding subtypes are known. Their expression is variable depending on cell type, organ, and status of cell differentiation. The preferred ligands for RAR and RXRs are RA and 9-cis-RA respectively, although RA at high concentrations activates RXR (5). RXRs form heteromeric complexes with RARs, bind to RAREs, and stimulate specific gene transcription (5). Heteromeric complexes of RXRs formed with other nuclear receptors such as those of thyroid hormone (TR), vitamin D3, and peroxisome proliferator activator also induce ligand-specific gene expression (6-10). Thus, RXRs are important cofactors for nuclear receptor-mediated gene regulation.

Several studies have indicated that IFN and RA in combination produce additive or synergistic antitumoral effects in vivo and in vitro (11). It is not known how these two disparate ligands and their corresponding signal transduction systems cross-talk in the mediation of antitumoral activity. We have shown previously that these effects are in part mediated by an increase in the level of IFN-stimulated gene factors upon RA treatment, thus allowing their functional activation by IFN (12). In particular, STAT-1 protein is induced in IFN-resistant tumor cells treated with RA (13). In the present investigation, we have identified the mechanism by which RA up-regulates the expression of STAT1.


MATERIALS AND METHODS

Cell Culture and Reagents

All cell lines were cultured in media supplemented with charcoal-treated, dialyzed fetal bovine serum. Murine embryonic tumor cell lines F9 and P19 and monkey kidney cell line COS-7 were cultured in Dulbecco's modified Eagle's medium. Human RARalpha , -beta , and -gamma and mouse RXRalpha expression vectors were provided by Pierre Chambon, IGBMC, France. Mouse RXRbeta expression vector was described previously (8). Human thyroid hormone receptor beta (TRbeta ) regulated by RSV-LTR was provided by Edwards Park, University of Tennessee. Rabbit anti-STAT1 antibodies were provided by Chris Schindler, Columbia University. Mouse anti-JAK-1 antibody was from Transduction Laboratories. Purified baculovirus-expressed RARbeta and RXRbeta , mouse monoclonal antibody against RXRbeta (H2RIIBP), and rabbit anti-RARbeta antibody were gifts from Keiko Ozato, National Institutes of Health. Rabbit anti RARalpha , RARgamma , and RXRalpha antibodies were purchased from Santa Cruz Biotechnology. All these antibodies cross-reacted with cognate proteins from mouse and human sources. Mouse IFN-gamma was from Boehringer Mannheim. Purest preparations of all-trans-retinoic acid (99%), 9-cis-retinoic acid (high performance liquid chromatography pure) and 3,3',5 triiodo-L-thyronine (T3 or thyroid hormone) were purchased from Sigma and were reconstituted in ethanol. The oligonucleotides used in this study were shown in Table I. These were used for electrophoretic mobility shift assays (EMSA) and cloning into TK-luciferase. Probes for EMSA were prepared by filling in the ends with Klenow fragment in the presence of [alpha -32P]dCTP or by end labeling with [gamma -32P]ATP. For site-directed mutagenesis, 5'-GATAAATCAGGGTGATAA-3' (RM1) and 5'-TAGAGTTCAGTGTGATAA-3' (RM3) oligos were used.

Table I.

Oligonucleotide probes used in this study

RW, wild-type RARE of STAT1 promoter. Boldface nucleotides represent the RARE. RM1, RM2, RM3, and RM4 are mutant versions of RW and where the mutated nucleotides have been italicized; DR-5, consensus RARE (19); H2RII, RARE from mouse major histocompatibility class I gene (8).


RW 5' TCGAGATGGGTCAGGGTGATAAC 3'
3' CTACCCAGTCCCACTATTGAGCT 5'
RMI 5' TCGAGATAAATCAGGGTGATAAC 3'
3' CTATTTAGTCCCACTATTGAGCT 5'
RM2 5' TCGAGATGGGTCAAAATGATAAC 3'
3' CTACCCAGTTTTACTATTGAGCT 5'
RM3 5' TCGAGATGAGTCAGTGTGATAAC 3'
3' CTACTCAGTCACACTATTGAGCT 5'
RM4 5' GATACCGTCCACATGTAA 3'
3' CTATGGCAGGTGTACATT 5'
H2RII 5' GCCAGGCGGTGAGGTCAGGGGTGGGGAA 3'
3' TCCGCCACTCCAGTCCCCACCCCTTCGG 5'
DR-5 5' GATAGGTCACCAGGAGGTCATAA 3'
3' CTATCCAGTGGTCCTCCAGTATT 5'

Gene Expression Analyses

Northern blot, run off transcription, and Western blot analyses were performed as described elsewhere (12). Cells (2 × 105) were electroporated with 5 µg of luciferase reporter construct, 0.5 µg of expression vectors of retinoid receptors, and 2 µg of beta -actin-beta -galactosidase plasmid, and luciferase assays were performed (14). beta -Galactosidase assays were performed to normalize for variations in transfection efficiencies. Stable transfection of F9 cells with STAT1 cDNA, cloned in mammalian expression pCXN2, was performed as described previously (13). This plasmid also carried a G418 resistance marker for selection in mammalian cells. The resultant drug-resistant colonies (~150) were pooled and used in the experiments. COS-7 cell extracts, expressing individual retinoid receptors for EMSA, were prepared as described (15).

An adult BALB/c mouse liver genomic library (Clontech) in EMBL3 phage vector (5 × 106 plaque-forming units) was screened with a 32P-labeled human STAT1 cDNA (16), and 6 clones were identified. All these clones contained the same 18-kb insert as analyzed by restriction digestion and Southern blotting. A 4.5-kb XhoI fragment was detected when probed with a 270-bp fragment representing the 5' end of the cDNA. This fragment was cloned into pGL3-basic vector (Promega). pGL3-TK was constructed by excising the TK promoter (109 bp) from pTK-CAT vector and cloning into the pGL3-basic vector. Deletion and point mutations were constructed (17) using a polymerase chain reaction-based kit (Stratagene) and a reporter construct VKL-7 as template. All constructs were confirmed by sequencing.


RESULTS

Retinoic Acid Modulates the IFN Stimulation of Transcription Factors in Embryonic Tumor Cells

We have previously shown that treatment of F9 embryonal carcinoma cells with RA enhances the ISG transcription (12) due to an activation of ISGF-3 in dF9 (RA-differentiated) but not in F9 (undifferentiated) cells. To further understand the basis for the failure of IFN-induced transcription, we performed EMSAs to detect the activation of STAT1 by IFN-gamma in F9 and dF9 cells. As shown in Fig. 1, nuclear extracts from IFN-gamma -treated dF9 but not F9 cells (compare lane 1 with 2) were able to form a complex with a 32P-labeled palindromic IFN-gamma response element (pIRE) (18). Identity of this factor as STAT1 was established by a specific antibody that neutralized the formation of the complex (lane 5). Similar activation of STAT1 was also observed in RA-treated P19 (dP19) but not in undifferentiated P19 cells (Fig. 1, lanes 3 and 4). Mixing of F9 cell extracts with those of dF9 cells did not prevent the binding of STAT1 to pIRE (lane 6).


Fig. 1. RA enhancement of STAT1 activation by murine IFN-gamma in F9 and P19 cells. Cells were first treated with RA (1 µM for 3 days) followed by IFN-gamma (200 units/ml) for 30 min where indicated. Nuclear extracts (3 µg) were incubated with a 32P-labeled pIRE probe in EMSA. Lane 5 was similar to lane 2 except that the extracts were incubated with anti-STAT1 antibody for 40 min at room temperature prior to the addition of the probe. Lane 6 contained a 1:1 mixture of extracts used in lanes 1 and 2 incubated for 30 min prior to the addition of the probe. Position of the STAT1 complex is indicated. Treated and untreated lanes are indicated as + and - respectively.
[View Larger Version of this Image (65K GIF file)]


Since STAT1 was activated by IFN-gamma after RA-treatment, we wanted to further distinguish whether such activation was due to an increase in the levels of signal transducing JAKs or transacting factors. To test these possibilities, F9 cells were stably transfected with pCXN2 expression vector or the same vector that expressed the STAT1 cDNA. The resultant cell transfectants were treated with IFN-gamma , and their nuclear extracts were assayed for pIRE binding of STAT1 using EMSA (Fig. 2A). Activation of STAT1 was not detected in untreated cells (lanes 1 and 3). In the F9 transfectants that carried the expression vector pCXN2 alone (lanes 1 and 2), IFN-gamma failed to induce STAT1 binding to pIRE (lane 2). However, IFN-gamma robustly activated STAT1 in cells transfected with the cDNA (Fig. 2A, lane 4). To further prove that the transfected STAT1 was functional, luciferase reporter assays were performed. As anticipated, no induction of luciferase activity was detected in the F9 cells that stably expressed the pCXN2 vector alone (Fig. 2B, bar 2). In STAT1 transfected cells (bars 3 and 4), IFN-gamma readily induced the expression of pIRE-luciferase reporter gene (Fig. 2B, bar 4). Thus, F9 cells possessed the necessary receptors and protein kinases for the activation of IFN-gamma -initiated JAK-STAT pathway, except STAT1. Over expression of STAT1 or treatment with RA restored IFN-gamma responses in these cells. Consistent with this, JAK1 levels were not affected by RA-treatment in an immunoprecipitation assay (Fig. 2C). Western blot analyses (Fig. 2D) revealed no detectable STAT1 protein in undifferentiated F9 cells. However, it was strongly induced by RA-treatment (lanes 2 and 3). Thus, STAT1 appeared to be a target of retinoid-mediated regulation.


Fig. 2. Modulation of IFN-gamma sensitivity of F9 cells by RA. A, stable transfection of STAT1 cDNA restored IFN-sensitivity in F9 cells. EMSA was performed as in Fig. 1. Lanes 1 and 2, cells transfected with pCXN2 expression vector alone; lanes 3 and 4, cells that expressed STAT1 protein. No treatment and IFN-gamma treatment (200 units/ml for 30 min) were indicated with - and + signs, respectively. Nuclear extracts (3 µg) were used in EMSA. Position of STAT1 complex is indicated. B, functional activity of the transfected STAT1 gene product. Cells used in bars 1-4 were similar to those in lanes 1-4 of panel A. pIRE-luciferease (10 µg) and beta -actin-beta -galactosidase (2 µg) plasmids were electroporated into cells and analyzed for gene expression (13). 30 h after transfection, IFN-gamma (200 units/ml) treatment was performed for 16 h, where indicated, and luciferase activity was measured. Mean ± S.E. of triplicate measurements was presented. Transfection efficiency was normalized with beta -galactosidase measurements. C, JAK1 levels in F9 cells. Cells were treated with the indicated concentration of RA for 3 days. Equal amounts of cell extracts (80 µg) were immunoprecipitated using an anti JAK-1 antibody. The proteins were separated on 10% SDS-polyacrylamide gels and Western blotted. The blots were probed with the same antibody using the ECL method (Amersham Corp.). D, STAT1 expression in F9 cells. Cell lysates (30 µg) were Western blotted and analyzed with a rabbit anti-STAT1 antibody.
[View Larger Version of this Image (44K GIF file)]


RA Induces the Expression of STAT1 Gene

Since STAT1 protein was induced by RA, we next determined whether such enhancement was due to an induction of STAT1 gene expression. Northern blot analysis (Fig. 3A) did not reveal detectable STAT1 mRNA (lanes 1 and 2) in untreated F9 cells or cells that received ethanol (the solvent in which RA was prepared). Treatment of cells with 1 and 10 µM RA strongly induced the mRNAs of STAT1alpha and -beta (lanes 3 and 4). The probe detected both the mRNAs because they were derived from the same gene (16). All the cells expressed similar levels of beta -actin mRNA irrespective of treatments. To examine whether the induction of STAT1 by RA was due to de novo transcription, nuclear run off transcription assays (Fig. 3B) were performed. No detectable transcription of STAT1 was observed in untreated cells. However, RA induced the transcription by 24 h, which increased with prolonged treatment (48 h). All these cells expressed normal levels of glyceraldehyde-3-phosphate dehydrogenase transcripts, indicating that lack of STAT1 gene expression in F9 cells was not due to a global transcriptional blockade. Further, RA did not induce the expression of STAT2 mRNA (Fig. 3C). Induction of STAT1 mRNA by RA was observed in an IFN-unresponsive MCF-7 breast carcinoma cell line and an acute promyelocytic leukemia cell line (data not shown). Thus, STAT1 mRNA is up-regulated by RA in multiple cell types.


Fig. 3. Effect of RA on STAT gene expression. A, F9 cells were treated with the indicated agents for 3 days, and total RNA was isolated. An equal amount of RNA (30 µg) was analyzed in Northern blots. The blots were probed with 32P-labeled human STAT1 or beta -actin cDNA probes. Positions of the STAT1alpha and STAT1beta mRNAs are indicated by the upper and lower arrows, respectively. B, nuclear run-off transcription. F9 cells were treated with 1 µM RA for the indicated times, and nuclear run-off transcription was performed as described earlier. Total labeled nuclear RNAs were hybridized for 3 days to Bluescript (negative control), STAT1 and glyceraldehyde-3-phosphate dehydrogenase cDNAs immobilized on nylon membranes. The blots were washed and autoradiographed. C, Northern blot analysis of STAT2 mRNA. Total RNA (30 µg) from untreated and RA (1 µM for 72 h) treated F9 cells were Northern blotted and probed with human STAT2 and beta -actin probes.
[View Larger Version of this Image (30K GIF file)]


Identification of a RARE in STAT1 Promoter

To examine whether the STAT1 promoter was directly regulated by RA, a mouse genomic clone was isolated using human STAT1 cDNA (16) as a probe. A 1.85-kb HindIII fragment, containing 700 bp of upstream sequence, the first exon and intron (1.15 kb), was cloned into pGL-3 basic vector. The resultant reporter construct, VKL-2, responded to RA in COS-7 cells upon cotransfection with RARalpha (Fig. 4A). Since COS-7 cells lacked these nuclear receptors, the induction was due to the cotransfected receptor. Deletion of a 965-bp sequence consisting of first exon and a substantial portion of intron from VKL-2 (construct VKL-4) had no effect on RA inducibility (Fig. 4B). Following treatment with RA (1 µM), a strong up-regulation of luciferase activity was noted in cells that were cotransfected with RARalpha . Furthermore, two other nuclear receptors, RXRbeta and TRbeta , along with their ligands 9-cis-RA and T3 had no effect on gene expression (Fig. 4B). Two other constructs, VKL-6 and VKL-7, which contained up to -950- and -670-bp upstream elements of STAT1 promoter, respectively, were also strongly induced by RA in these cells (Fig. 4A). Thus, the cloned fragments contained necessary elements for a specific induction of STAT1 promoter by RA. Primer extension analyses identified the start site at 12 nucleotides upstream of ATG codon (data not presented). We then tested the effects of other members of the RAR family on STAT1 promoter. COS-7 cells were transfected with RARalpha , -beta , and -gamma expression vectors along with luciferase reporter VKL-4 (Fig. 4C). Although all the members of the RAR family induced the reporter gene expression, RARbeta was a slightly better activator than the others. Luciferase gene did not express upon transfection of VKL-7 in F9 cells. RA treatment for 24 h caused a 12-fold increase in luciferase activity (Fig. 4D). It was further enhanced with longer treatment (48 h).


Fig. 4. Analysis of murine STAT1 promoter. A, schematic representation of the STAT1 promoter fragments cloned upstream of luciferase gene in pGL-3 vector. Upstream sequences from the STAT1 gene are indicated with a thick black line. Sequences corresponding to exon and intron are shown with filled boxes. Selected restriction enzyme sites are indicated: H, HindIII; P, PstI. Fold induction of each reporter by RA treatment (1 µM for 16 h) in COS-7 cells are indicated on the right. B, induction of VKL-4 reporter gene by nuclear receptors transfected into COS-7 cells. pSG5 (29) was the control expression vector. RA and 9-cis-RA and T3 were used at 1 µM for 16 h, where indicated. Equal amounts of protein (50 µg) from each sample were assayed for luciferase activity. C, induction of VKL-4 reporter in COS-7 cells by the members of the RAR family. Transfection and RA treatment were similar to panel B. D, induction of VKL-7 reporter (15 µg) by RA in transfected F9 cells. RA (1 µM) was performed for the indicated time. Cell extracts (80 µg) were assayed for luciferase activity.
[View Larger Version of this Image (23K GIF file)]


Sequence analysis of the promoter (Fig. 5) revealed a direct repeat element, at -467 bp, that could potentially serve as RARE. More significantly, this sequence had closer resemblance to H2RII of the MHC class I gene (8), than to the other RAREs. Unlike the previously described retinoid response elements (5), the STAT1-RARE had a near perfect repeat sequence of GGGTCAGGGTGA with no spacer nucleotides (Fig. 5). Further, GGG residues were found in both the half-sites in place of AGG of most retinoid responsive half-sites. At -122 and -338 positions, TATA-like elements were present.


Fig. 5. Nucleotide sequence of murine STAT1 gene promoter. Retinoic acid response element is highlighted and underlined. TATA-like elements and ATG codon are shown in italics. Transcriptional start site is indicated with +1 sign.
[View Larger Version of this Image (48K GIF file)]


Mutational Analysis of the Retinoic Acid Response Element

Since RA stimulated STAT1 and sequence analysis identified a RARE in the promoter, we next examined whether this element alone was sufficient for RA inducibility. Using a PCR-based approach (17), we constructed a deletion mutant that lacked the direct repeat element in VKL-7 reporter. The wild-type construct (VKL-7) but not the mutant (Delta M) responded to RA in COS-7 cells when cotransfected with RARbeta (Fig. 6A, bars 2-5). Using the same PCR approach, we generated point mutants with RM1 and RM2 oligonucleotides in the native promoter (VKL-7). In RM1, GGG residues of the left half-site were replaced with AAA. RM3 bore mutations in the central G residue of the GGG bases of both the half-sites (see "Materials and Methods"). Transfection of these two point mutants into COS-7 cells along with RARbeta did not significantly induce the promoter (Fig. 6B, bars 3-6). Thus, mutations in the GGG residues of either half-site abolished RA inducibility.


Fig. 6. Mutational analysis of the STAT1 promoter. Conditions of transfection analysis were as described under Fig. 4. A, effect of deletion of a direct repeat element. Wt represents VKL-7, and Delta M represents the same construct with a deletion of the RARE (Fig. 5). B, induction of point mutants of RARE. Bars 1 and 2, wild-type promoter (VKL-7); bars 3 and 4, mutant bearing the element shown in RM1 oligo; and bars 5 and 6, mutant bearing the element in RM3 oligo. C, synthetic response elements from STAT1 (see Table I) confer RA inducibility to TK promoter-driven luciferase reporter. Bars 1 and 2, TK-luciferase plasmid; bars 3-6, wild-type element (RW) cloned upstream of TK promoter except that the construct used in bars 3 and 4 possessed two tandem copies (RW2X), and the one in bars 5 and 6 contained a single copy (RW1X), respectively; bars 7 and 8, RM1 element; bars 9 and 10, RM2 element; and bars 11 and 12, RM3 element. All these constructs contained a single copy of the mutant response element. COS-7 cells were transfected and treated as described in Fig. 4.
[View Larger Version of this Image (20K GIF file)]


We next determined whether fusion of the synthetic STAT1-RARE conferred RA inducibility to a neutral promoter driving the expression of luciferase gene. COS-7 cells were transfected with the reporter constructs bearing either a wild-type or a mutant response element upstream of herpes simplex viral TK gene promoter, along with RARs, and were treated with RA. Insertion of two copies of a wild-type element (RW2X) produced a slightly higher activity than the one with a single copy (RW1X) in COS-7 cells (Fig. 6C, compare bar 4 with 6). Mutants that lacked the GGG residues in either half-site were unresponsive to RA (bars 8, 10, and 12). This observation was consistent with the data obtained with the same point mutants in the context of native promoter (Fig. 6B). Furthermore, mutation of a central G residue of both the half-sites (RM3) caused a similar loss of response. Therefore, the direct repeat element of STAT1 promoter was sufficient for induction by RA.

Binding of Transcriptional Factors to the RA Response Element

To identify the transcription factors that mediate these effects, we performed EMSA. In these experiments, untreated and RA-treated F9 nuclear extracts were incubated with a 32P-labeled synthetic RW (STAT1-RARE) to detect specific DNA binding (6). A slow mobility complex, A, appeared in RA-treated F9 cells (Fig. 7A, lanes 2-5) whose binding was enhanced with prolonged RA treatment. Binding of this complex to RW was eliminated upon preincubation of these nuclear extracts with the wild type (RW) oligonucleotide (lanes 6-8) but not by a mutant (RM4) oligonucleotide (lanes 9-11). Mutant oligos RM1, RM2, and RM3 also failed to compete out the binding (data not presented). Formation of complex-A was inhibited by preincubation of extracts with polyclonal antibodies specific for RARbeta and RXRalpha (lanes 12 and 13) but not by those raised against RARalpha , RARgamma , and RXRbeta (lanes 14-16). Binding of this complex to RW was not eliminated by preincubation of cell extracts with DR-5 (19) and H2RII oligos at 5 or 25 × concentrations (Fig. 7B, lanes 2, 3, 6, and 7). However, at high concentrations (100 and 500 ×), DR-5 competed with the labeled RW (lanes 4 and 5), indicating a preferential formation of complex-A with the latter. H2RII failed to compete out the RW complex-A (lanes 6-9). RW also formed another complex, B, with untreated F9 cell extracts whose binding disappeared with RA treatment of cells (Fig. 7A, see lanes 1-3).


Fig. 7. Electrophoretic mobility shift assays. A, binding of transacting factors to wild-type RW (STAT1-RARE) in F9 cells. All treatments are indicated at the top of the figure. Cell extracts were prepared after RA treatment (1 µM) for the indicated times. Nuclear extracts (3 µg) from each treatment were incubated with 0.25 ng of a 32P-labeled RW (120,000 cpm) in EMSA. In lanes 6-8 and 9-11, unlabeled RW and RM4 were used as competitors, respectively, prior to the addition of the probe. In lanes 12-18, the extracts were incubated with 2.5 µl of specific high affinity antibodies against retinoid receptors for 40 min at room temperature prior to the addition of the probe. Positions of complexes-A and -B are indicated on the left. B, specificity of transacting factor binding to RW. EMSA was carried out as in panel A except that indicated amounts of different competitor oligos were preincubated with nuclear extracts of F9 cells treated with RA for 48 h. C, specific activation of binding factors to RW by RA (1 µM) in F9 cells. Nuclear extracts (3 µg) from panel A were incubated with different labeled probes indicated at the top of the figure. All probes were labeled to comparable specific activities and used in the experiment. The unbound DR-5 probe, being the smallest, ran out of the gel in lanes 6-9. D, reactivity of complex-B with antibodies specific to various retinoid receptors. Nuclear extracts of untreated F9 cells (3 µg) were incubated with the indicated antibodies as in panel A prior to the addition of the probe in an EMSA with RW probe. NIS, non-immune serum of rabbit.
[View Larger Version of this Image (65K GIF file)]


RW binding factors in F9 cells exhibited interesting properties compared with those that bound to consensus RARE and DR-5. RW binding of complex-A was RA inducible (Fig. 7C, lanes 2-5), while DR-5 binding factors were constitutive (Fig. 7C, lanes 6-9). Formation of complex-A was not detected with untreated F9 cell extracts (Fig. 7A, lane 1). The DR-5 binding factors from untreated F9 cell extracts (lane 6) were recognized by antibodies against RARalpha and RARgamma (data not presented). Under the same conditions, complexes were barely detectable with H2RII probe (lanes 10-13). Interestingly, complex-B was formed only with RW upon incubation with untreated F9 extracts but not with DR-5 or H2RII. Binding of this complex was eliminated upon preincubation of cell extracts with RW but not RM3, RM4, DR-5, or H2RII oligos (data not presented). Furthermore, complex-B was not recognized by antibodies specific for RARalpha , RARbeta , RARgamma , RXRalpha , or RXRbeta (Fig. 7D). Thus, it appeared to be a novel factor.

Cotransfection of RARbeta and RXRalpha Induces the RA-inducible Expression from STAT1 Promoter

Since the above studies indicated the binding of RARbeta and RXRalpha complexes to STAT1-RARE, we next determined whether this combination of receptors would augment RA-dependent gene expression from the STAT1 promoter. VKL-7 reporter vector was cotransfected with expression vectors for either RARbeta or RXRalpha or the combination into COS-7 cells. RARbeta , but not RXRalpha , alone induced gene expression (Fig. 8A, bars 2 and 3) upon RA (1 µM) treatment. However, the combination of these two receptors caused stronger expression (bar 4). To further test whether such induction was a result of binding of these receptors to RW, EMSA was performed with whole cell extracts of COS-7 cells transfected with the individual expression vectors. RARbeta bound to RW, which was further enhanced when combined with extracts from RXRalpha expressing cells. (See Fig. 8B, lanes 3 and 5). RXRalpha alone bound very weakly to this element (lane 4). Pre-incubation of these extracts with cognate antibodies eliminated the binding of these complexes (data not presented). Interestingly, purified RARbeta (expressed in a baculovirus vector) alone failed to form such a complex with RW, although it bound to DR-5 efficiently (data not shown). These data suggest that additional cellular factors may be necessary for the formation of RW binding complexes.


Fig. 8. Induction of STAT-1 promoter by RARbeta ·RXRalpha combination. A, reporter gene expression. Cell transfection, RA-treatment, and luciferase assays were performed as described in Fig. 4. COS-7 cells were electroporated with VKL-7 reporter (5 µg) and the indicated effector plasmids (0.5 µg). The total amount of DNA transfected was normalized with pSG5. B, binding of RAR and RXR proteins expressed in COS-7 cells to STAT1-RARE. Cells were electroporated with 25 µg of the indicated reporter plasmid, and whole cell extracts were prepared after 48 h (15). Extracts (15 µg) were assayed for DNA binding in EMSA with RW probe. Lane 5, 7.5 µg of extract from each preparation was incubated with the probe. Position of the specific complex is indicated with an arrow.
[View Larger Version of this Image (36K GIF file)]



DISCUSSION

Dependence of IFN-gamma responses in F9 cells on RA-treatment suggests two possibilities. RA may enrich the levels or activities of IFN-receptor components and the associated Janus kinases or of IFN-regulated transcription factors. Since transfection of STAT1 alone restores the IFN-gamma -inducible gene expression, modulation of IFN responses by RA may not involve an enhancement of JAKs or other receptor components. Consistent with this, RA did not increase IFN receptors density or avidity in unresponsive cells (20). Furthermore, RA did not induce the tyrosine phosphorylation of JAK1 (data not shown). Thus, RA modulation of IFN responses occurs at the level of STAT1 gene expression in these cells.

Northern and nuclear run off transcription studies have shown that RA specifically induces transcription of STAT1 gene (Fig. 3, A-C). RA does not affect STAT2 expression. Further, STAT2 promoter does not possess a RARE (21). Analysis of the STAT1 promoter (Figs. 4, 5, 6) identified a RARE. This element has several unique properties: i) It is a direct repeat element with no spacing between the repeats. ii) It is not stimulated by RXRbeta in the presence of 9-cis-RA or high concentration of RA that activates RXRs. iii) It preferentially binds the RARbeta and RXRalpha heteromers, and such binding is increased with prolonged treatment of F9 cells with RA. Under the same conditions RA does not alter the binding of RAR·RXR complexes to DR-5. iv) In untreated F9 cells, a unique factor (complex-B) binds to STAT1-RARE (Fig. 7, A and C) but not to DR-5 (19) or H2RII (8). The STAT1-RARE requires GGG residues in both the half sites, since mutagenesis of these in any half site of the direct repeat element abrogates the RA responses. Its specificity for RARbeta and RXRalpha is quite intriguing because a similar oligonucleotide with 5-bp spacing between the direct repeat elements (RW-DR5) has not formed the same complex (data not presented). These data indicate the importance of close apposition of the repeat elements for specific binding. Although the direct repeat elements with two or five nucleotide spacing have been shown to respond to RA in several genes (5), the gene for human medium chain acyl coenzyme A dehydrogenase has a unique element with eight nucleotide spacing and another one with no spacing (22). The human oxytocin and mouse laminin B1 gene promoters also contain RA responsive elements with 13 and 47 nucleotide spacing (23-25). The STAT1-RARE appears to belong to this class of unique nuclear receptor response elements where spacing between the half-sites is not a primary determinant of retinoid responsiveness (26, 27).

Preferential binding of RARbeta and RXRalpha heteromers to STAT1-RARE may permit a selective regulation of STAT1 gene by RA. This notion is supported by the observation that despite the abundance of DR-5 binding factors in F9 cells, they did not bind to RW (Fig. 7C). The DR-5 binding factors were recognized by specific antibodies against RARalpha and RARgamma (data not presented). The observations that regulation of transcription by nuclear receptors is dependent on the promoter context, response element orientation, and DNA binding domain interface (19, 28-35) are also suggestive of such preferential interactions. The facts that RARbeta gene is inducible by RA (36, 37) and that the binding of RARbeta to RW is increased upon exposure of F9 cells to RA also support the notion of preferential binding of RARbeta ·RXRalpha to STAT1-RARE. Consistent with these observations, cotransfection and EMSA assays with individual receptors in COS-7 cells resulted in a stronger induction of gene expression (Fig. 8). Since whole cell extracts containing RARbeta , but not the purified RARbeta , form specific complexes with RW, it appears that additional cellular factors are necessary for the binding to occur. Given the unique organization of the repeat elements in STAT1-RARE, such factors may play a crucial role in the formation of high affinity complexes. Further investigation is necessary to address these issues. Lastly, the F9 cellular factor (complex-B in Fig. 7A) that binds to STAT1-RARE, may be a negative regulator since it disappears with RA-treatment and is absent during STAT1 transcription. An important outcome of our study is that it demonstrates for the first time a molecular basis for the modulation of IFN action by RA. This observation indirectly connects the retinoids to cell cycle regulation. For example, recent studies indicate that IFNs inhibit cell growth using STAT1 (38) and induce the expression of p21/WAF/Cip-1 gene, whose product inhibits the cyclin-dependent kinases (39). Elevation of STAT1 levels may thus permit a robust activation of STAT1 by IFNs, leading to growth arrest.


FOOTNOTES

*   This work was supported by a grant from the National Cancer Institute (to D. V. K.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) U80267[GenBank].


Dagger    Contributed equally to this work.
§   Present address: Kimmel Cancer Institute, Philadelphia, PA 19107.
   To whom correspondence should be addressed: E-mail: dkalvako{at}umabnet.ab.umd.edu.
1   The abbreviations used are: IFN, interferon; DR-5, direct repeat element with 5 nucleotide spacing; EMSA, electrophoretic mobility shift assay; JAK, Janus tyrosine kinase; RA, all-trans-retinoic acid; RARE, retinoic acid response element; RAR, retinoic acid receptor; RXR, retinoid X receptor, STAT, signal transducing activator of transcription; pIRE, palindromic IFN response element; TR, thyroid hormone receptor; TK, thymidine kinase; kb, kilobase(s); bp, base pair(s); ISG, IFN-stimulated gene; LTR, long terminal repeat; MHC, major histocompatibility complex.

ACKNOWLEDGEMENTS

The authors thank all the colleagues who have generously provided several valuable reagents used in this study, Sara B. Mannino for technical assistance at the early stages of this work, Rama Kudaravalli for help in transfection experiments, and Daniel Lindner and Ernest Borden for a critical reading of this manuscript.


REFERENCES

  1. Kalvakolanu, D. V., and Borden, E. C. (1996) Cancer Invest. 14, 25-53 [Medline] [Order article via Infotrieve]
  2. Schindler, C., and Darnell, J. E., Jr. (1995) Annu. Rev. Biochem. 64, 621-651 [Medline] [Order article via Infotrieve]
  3. Muller, M., Briscoe, J., Laxton, C., Guschin, D., Ziemiecki, A., Silvennoinen, O., Harpur, A. G., Barbieri, G., Witthuhn, B. A., Schindler, C., Pellegrini, S., Wilks, A. F., Ihle, J. N., Stark, G. R., and Kerr, I. M. (1993) Nature 366, 129-135 [CrossRef][Medline] [Order article via Infotrieve]
  4. Muller, M., Laxton, C., Briscoe, J., Schindler, C., Improta, T., Darnell, J. E., Jr., Stark, G. R., and Kerr, I. M. (1993) EMBO J. 12, 4221-4228 [Medline] [Order article via Infotrieve]
  5. Mangelsdorf, D. J., and Evans, R. M. (1995) Cell 83, 841-850 [CrossRef][Medline] [Order article via Infotrieve]
  6. Kliewer, S. A., Umesono, K., Mangelsdorf, D. J., and Evans, R. M. (1992) Nature 355, 446-449 [CrossRef][Medline] [Order article via Infotrieve]
  7. Kliewer, S. A., Umesono, K., Noonan, D. J., Heyman, R. A., and Evans, R. M. (1992) Nature 358, 771-774 [CrossRef][Medline] [Order article via Infotrieve]
  8. Marks, M. S., Hallenbeck, P. L., Nagata, T., Segars, J. H., Appella, E., Nikodem, V. M., and Ozato, K. (1992) EMBO J. 11, 1419-1435 [Medline] [Order article via Infotrieve]
  9. Yu, V. C., Delsert, C., Andersen, B., Holloway, J. M., Devary, O. V., Naar, A. M., Kim, S. Y., Boutin, J.-M., Glass, C. K., and Rosenfeld, M. G. (1991) Cell 67, 1251-1266 [CrossRef][Medline] [Order article via Infotrieve]
  10. Leid, M., Kastner, P., Lyons, R., Nakshatri, H., Saunders, M., Zacharewski, T., Chen, J.-Y., Staub, A., Garnier, J.-M., Mader, S., and Chambon, P. (1992) Cell 68, 377-395 [CrossRef][Medline] [Order article via Infotrieve]
  11. Moore, D. M., Kalvakolanu, D. V., Lippman, S. M., Kavanagh, J. J., Hong, W. K., Borden, E. C., Paredes-Espinoza, M., and Krakoff, I. H. (1994) Semin. Hematol. 31, Suppl. 5, 31-37
  12. Kalvakolanu, D. V., and Sen, G. C. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 3167-3171 [Abstract/Free Full Text]
  13. Kolla, V., Lindner, D. J., Weihua, X., Borden, E. C., and Kalvakolanu, D. V. (1996) J. Biol. Chem. 271, 10508-10514 [Abstract/Free Full Text]
  14. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (1994) Current Protocols in Molecular Biology, Wiley Interscience, New York
  15. Kumar, V., and Chambon, P. (1988) Cell 55, 145-156 [CrossRef][Medline] [Order article via Infotrieve]
  16. Schindler, C., Fu, X. Y., Improta, T., Aebersold, R., and Darnell, J. E., Jr. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 7836-7839 [Abstract/Free Full Text]
  17. Weiner, M. P., Costa, G. L., Schoettlin, W., Cline, J., Mathur, E., and Bauer, J. C. (1994) Gene 151, 119-123 [CrossRef][Medline] [Order article via Infotrieve]
  18. Kanno, Y., Kozak, C. A., Schindler, C., Driggers, P. H., Ennist, D. L., Gleason, S. L., Darnell, J. E., Jr., and Ozato, K. (1993) Mol. Cell. Biol. 13, 3951-3963 [Abstract/Free Full Text]
  19. Umesono, K., Murakami, K. K., Thompson, C. C., and Evans, R. M. (1991) Cell 65, 1255-1266 [CrossRef][Medline] [Order article via Infotrieve]
  20. Aguet, M., Gresser, I., Hovanessian, A. G., Bandu, M. T., Blanchard, B., and Blangy, D. (1981) Virology 114, 585-588 [CrossRef][Medline] [Order article via Infotrieve]
  21. Yan, R., Qureshi, S., Zhong, Z., Wen, Z., and Darnell, J. E., Jr. (1995) Nucleic Acids Res. 23, 459-463 [Abstract/Free Full Text]
  22. Carter, M. E., Gulick, T., Moore, D. D., and Kelly, D. P. (1994) Mol. Cell. Biol. 14, 4360-4372 [Abstract/Free Full Text]
  23. Richard, S., and Zingg, H. H. (1991) J. Biol. Chem. 266, 21428-21433 [Abstract/Free Full Text]
  24. Vasios, G., Mader, S., Gold, J. D., Leid, M., Lutz, Y., Gaub, M. P., Chambon, P., and Gudas, L. (1991) EMBO J. 10, 1149-1158 [Medline] [Order article via Infotrieve]
  25. Lipkin, S. M., Nelson, C. A., Glass, C. K., and Rosenfeld, M. G. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 1209-1213 [Abstract/Free Full Text]
  26. Kato, S., Sasaki, H., Suzawa, M., Masushige, S., Tora, L., Chambon, P., and Gronemeyer, H. (1995) Mol. Cell. Biol. 15, 5858-5867 [Abstract]
  27. Palmer, C. N. A., Hsu, M.-H., Griffin, K. J., and Johnson, E. F. (1995) J. Biol. Chem. 270, 16114-16121 [Abstract/Free Full Text]
  28. Naar, A. M., Boutin, J. M., Lipkin, S. M., Yu, V. C., Holloway, J. M., Glass, C. K., and Rosenfeld, M. G. (1991) Cell 65, 1267-1279 [CrossRef][Medline] [Order article via Infotrieve]
  29. Nagpal, S., Saunders, M., Kastner, P., Durand, B., Nakshatri, H., and Chambon, P. (1992) Cell 70, 1007-1019 [CrossRef][Medline] [Order article via Infotrieve]
  30. Williams, G. R., Harney, J. W., Moore, D. D., Larsen, P. R., and Brent, G. A. (1992) Mol. Endocrinol. 6, 1527-1537 [Abstract]
  31. Mader, S., Leroy, P., Chen, J.-Y., and Chambon, P. (1993) J. Biol. Chem. 268, 591-600 [Abstract/Free Full Text]
  32. Kurokawa, R., Yu, V. C., Naar, A., Kyakumoto, S., Han, Z., Silverman, S., Rosenfeld, M. G., and Glass, C. K. (1993) Genes & Dev. 7, 1423-1435 [Abstract/Free Full Text]
  33. Mader, S., Chen, J. Y., Chen, Z., White, J., Chambon, P., and Gronemeyer, H. (1993) EMBO J. 12, 5029-5041 [Medline] [Order article via Infotrieve]
  34. Perlmann, T., Rangarajan, P. N., Umesono, K., and Evans, R. M. (1993) Genes & Dev. 7, 1411-1422 [Abstract/Free Full Text]
  35. Zechel, C., Shen, X. Q., Chambon, P., and Gronemeyer, H. (1994) EMBO J. 13, 1414-1424 [Medline] [Order article via Infotrieve]
  36. de The, H., Vivanco-Ruiz, M. M., Tiollais, P., Stunnenberg, H., and Dejean, A. (1990) Nature 343, 177-180 [CrossRef][Medline] [Order article via Infotrieve]
  37. Mendelsohn, C., Larkin, S., Mark, M., LeMeur, M., Clifford, J., Zelent, A., and Chambon, P. (1994) Mech. Dev. 45, 227-241 [CrossRef][Medline] [Order article via Infotrieve]
  38. Bromberg, J. F., Horvath, C. M., Wen, Z., Schreiber, R. D., and Darnell, J. E. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 7673-7678 [Abstract/Free Full Text]
  39. Chin, Y. E., Kitagawa, M., Su, W.-C. S., You, Z.-H., Iwamoto, Y., and Fu, X.-Y. (1996) Science 272, 719-722 [Abstract]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Xiao, D. Li, H.-Q. Zhu, M.-G. Song, X.-R. Pan, P.-M. Jia, L.-L. Peng, A.-X. Dou, G.-Q. Chen, S.-J. Chen, et al.
RIG-G as a key mediator of the antiproliferative activity of interferon-related pathways through enhancing p21 and p27 proteins
PNAS, October 31, 2006; 103(44): 16448 - 16453.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Lal, Y. Li, J. Smith, A. Sassano, S. Uddin, S. Parmar, M. S. Tallman, S. Minucci, N. Hay, and L. C. Platanias
Activation of the p70 S6 kinase by all-trans-retinoic acid in acute promyelocytic leukemia cells
Blood, February 15, 2005; 105(4): 1669 - 1677.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S.-i. Yokota, T. Okabayashi, N. Yokosawa, and N. Fujii
Growth Arrest of Epithelial Cells during Measles Virus Infection Is Caused by Upregulation of Interferon Regulatory Factor 1
J. Virol., May 1, 2004; 78(9): 4591 - 4598.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Kambhampati, Y. Li, A. Verma, A. Sassano, B. Majchrzak, D. K. Deb, S. Parmar, N. Giafis, D. V. Kalvakolanu, A. Rahman, et al.
Activation of Protein Kinase C{delta} by All-trans-retinoic Acid
J. Biol. Chem., August 29, 2003; 278(35): 32544 - 32551.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Witcher, D. T. Ross, C. Rousseau, L. Deluca, and W. H. Miller Jr
Synergy between all-trans retinoic acid and tumor necrosis factor pathways in acute leukemia cells
Blood, July 1, 2003; 102(1): 237 - 245.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Dimberg, I. Karlberg, K. Nilsson, and F. Oberg
Ser727/Tyr701-phosphorylated Stat1 is required for the regulation of c-Myc, cyclins, and p27Kip1 associated with ATRA-induced G0/G1 arrest of U-937 cells
Blood, July 1, 2003; 102(1): 254 - 261.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
F. Ravandi, M. Talpaz, and Z. Estrov
Modulation of Cellular Signaling Pathways: Prospects for Targeted Therapy in Hematological Malignancies
Clin. Cancer Res., February 1, 2003; 9(2): 535 - 550.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
D. J. Lindner, X. Ma, J. Hu, S. Karra, and D. V. Kalvakolanu
Thioredoxin Reductase Plays a Critical Role in IFN Retinoid-mediated Tumor-Growth Control in Vivo
Clin. Cancer Res., October 1, 2002; 8(10): 3210 - 3218.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
I. Arany, W. E. Whitehead, K. J. Grattendick, I. A. Ember, and S. K. Tyring
Suppression of Growth by All-trans Retinoic Acid Requires Prolonged Induction of Interferon Regulatory Factor 1 in Cervical Squamous Carcinoma (SiHa) Cells
Clin. Vaccine Immunol., September 1, 2002; 9(5): 1102 - 1106.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
F. TOSETTI, N. FERRARI, S. DE FLORA, and A. ALBINI
Angioprevention': angiogenesis is a common and key target for cancer chemopreventive agents
FASEB J, January 1, 2002; 16(1): 2 - 14.
[Abstract] [Full Text] [PDF]