JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Han, Y.
Right arrow Articles by Brasier, A. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Han, Y.
Right arrow Articles by Brasier, A. R.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 15, Issue of April 11, 1997 pp. 9825-9832
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Mechanism for Biphasic Rel A· NF-kappa B1 Nuclear Translocation in Tumor Necrosis Factor alpha -stimulated Hepatocytes*

(Received for publication, December 5, 1996, and in revised form, January 31, 1997)

Youqi Han and Allan R. Brasier Dagger

From the Department of Internal Medicine and Sealy Center for Molecular Science, University of Texas Medical Branch, Galveston, Texas 77555-1060

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

The proinflammatory cytokine, tumor necrosis factor alpha  (TNFalpha ), is a potent activator of angiotensinogen gene transcription in hepatocytes by activation of latent nuclear factor-kappa B (NF-kappa B) DNA binding activity. In this study, we examine the kinetics of TNFalpha -activated translocation of the 65-kDa (Rel A) and 50-kDa (NF-kappa B1) NF-kappa B subunits mediated by inhibitor (Ikappa B) proteolysis in HepG2 hepatoblastoma cells. HepG2 cells express the Ikappa B members Ikappa Balpha , Ikappa Bbeta , and Ikappa Bgamma . In response to TNFalpha , Rel A·NF-kappa B1 translocation and DNA binding activity follows a biphasic profile, with an "early" induction (15-30 min), followed by a nadir to control levels at 60 min, and a "late" induction (>120 min). The early phase of Rel A·NF-kappa B1 translocation depends on simultaneous proteolysis of both Ikappa Balpha and Ikappa Bbeta isoforms; Ikappa Bgamma is inert to TNFalpha treatment. The 60-min nadir is due to a rapid Ikappa Balpha resynthesis that reassociates with Rel A and completely inhibits its DNA binding activity; the 60-min nadir is not observed when Ikappa Balpha resynthesis is prevented by cycloheximide treatment. By contrast, selective inhibition of Ikappa Bbeta proteolysis by pretreatment of HepG2 cells with the peptide aldehyde N-acetyl-Leu-Leu-norleucinal completely blocks the late phase of Rel A·NF-kappa B1 translocation. These studies indicate the presence of inducible and constitutive cytoplasmic NF-kappa B pools in hepatocytes. TNFalpha induces a coordinated proteolysis and resynthesis of Ikappa B isoforms to produce dynamic changes in NF-kappa B nuclear abundance.


INTRODUCTION

Multicellular organisms have evolved mechanisms for the coordinate expression of inducible genes through ligand-dependent receptors. Ligand binding to high affinity receptors located on the plasma membrane generate second messenger signals that can influence the activity or abundance of transcription factors through post-translational modifications including signal-induced phosphorylation and/or proteolysis. Hormone-activated gene transcription plays an important role in many homeostatic processes, including the cytokine cascade for lymphocyte expansion (1), and the change in expression of liver genes in response to systemic inflammation known as the hepatic acute-phase response (APR1; reviewed in Refs. 2-4).

The APR is the consequence of inducible transcriptional activation of hepatic genes required for blood pressure regulation, such as angiotensinogen (2, 5), and those involved in macrophage opsonization and wound repair (6) through the effects of macrophage-derived interleukins-1, interleukin-6, and tumor necrosis factor alpha  (TNFalpha ) (6). Hepatocyte-specific transactivators modified during the APR include AP-1 (7), signal transducers and activators (8), nuclear factor-interleukin 6 (9), and nuclear-factor-kappa B (NF-kappa B) (10). The angiotensinogen gene is transcriptionally activated during the APR by the effect of a single regulatory element, the acute-phase response element (APRE) (11, 12). The APRE is a target for intracellular signaling initiated by the liganded TNFalpha type I receptor that activates latent DNA binding activity of the potent NF-kappa B transcription factor family (3, 12, 13).

NF-kappa B is a family of homo- and heterodimeric proteins related by an NH2-terminal ~300 amino acid Rel homology domain including the proteolytic processed NF-kappa B1 and NF-kappa B2 subunits, as well as the Rel A (p65), c-Rel, and Rel B subunits (reviewed in Ref. 10). Dimerization of various NF-kappa B subunits produce complexes with various intrinsic DNA-binding specificities (14), transactivation potentials (10, 15-18), and subcellular localization (19). For example, NF-kappa B1 homodimers are constitutively nuclear and bind DNA avidly, but lack significant transcriptional activity; by contrast, Rel A·NF-kappa B1, Rel A·c-Rel, and Rel A·NF-kappa B2 heterodimers are cytoplasmic and exhibit various degrees of transcriptional activator properties (reviewed in Refs. 10, 20). UV cross-linking (11), gel mobility shift assays with subunit-specific NF-kappa B antibodies (12), and transient overexpression assays (12, 13) indicate that Rel A·NF-kappa B1 heterodimers are the major species of hormone-inducible NF-kappa B subunits that bind the APRE in hepatocytes.

The Rel A·NF-kappa B1 complex is sequestered in a latent cytoplasmic form by association with various inhibitor (Ikappa B) proteins, including Ikappa Balpha (pp40/MAD-3) (21-23), Ikappa Bbeta (24), Ikappa Bgamma (the COOH-terminal product encoded by translation of the alternative splicing of the p105 NF-kappa B1 mRNA precursor (25)), and p105 itself (26, 27) that associate with Rel A through a protein interactive domain homologous to erythrocyte ankyrin. Dissociation of Rel A from Ikappa B is prerequisite for Rel A nuclear translocation (23, 28-30); current evidence favors a two-step dissociation that first requires inducible NH2-terminal phosphorylation (Ikappa Balpha is phosphorylated at serine residues 32 and 36) followed by proteolysis through the 26 S proteasome (30-32).

The observations that distinct Ikappa B family members are expressed, and perhaps regulated, in a tissue-restricted fashion (24, 31) prompted us to investigate the kinetics of latent Rel A:NF-kappa B1 activation in hepatocytes. We report the unanticipated findings that TNFalpha produces a biphasic Rel A·NF-kappa B1 nuclear translocation, with an "early" peak at 15-30 min, return to control (1 h), and a later peak (>2 h induction). In hepatocytes, the Ikappa B family members alpha , beta , and gamma , but not the NF-kappa B1 p105 precursor are expressed. Early Rel A·NF-kappa B1 translocation is due to simultaneous proteolysis of both Ikappa Balpha and Ikappa Bbeta . By 1 h, Ikappa Balpha is rapidly synthesized and reassociates with Rel A; this reassociation (due to "overshoot" synthesis) results in complete inhibition of Rel A·NF-kappa B1 binding even in the continued absence of Ikappa Bbeta . As Ikappa Balpha levels fall after 1 h, Rel A·NF-kappa B1 binding is again detectable in the nucleus. Inhibition of Ikappa Bbeta proteolysis by the peptide aldehyde N-acetyl-Leu-Leu-norleucinal completely prevents the second phase of Rel A·NF-kappa B1 binding, demonstrating the requirement of Ikappa Bbeta for prolonged Rel A·NF-kappa B1 nuclear action.


EXPERIMENTAL PROCEDURES

Cell Culture and Treatment

The human hepatoblastoma cell-line HepG2 was obtained from ATCC (Rockville, MD) and grown in Dulbecco's modified Eagle's medium (Life Technologies, Inc., Grand Island, NY) supplemented with 10% (v/v) heat-inactivated fetal bovine serum, 2 mM L-glutamine, 0.1 mM nonessential amino acids, 1 mM sodium pyruvate, and antibiotics (penicillin/streptomycin/fungizone) in a humidified atmosphere of 5% CO2. Recombinant human TNFalpha (rTNFalpha , Genentech) was added to a final concentration of 30 ng/ml in culture medium and cells were incubated for the indicated time periods at 37 °C. For pretreatments, calpain inhibitor I (200 µM, CalBiochem, San Diego, CA) or cycloheximide (50 µg/ml, Sigma) were added in medium 1 h or 30 min prior to TNFalpha stimulation, respectively.

Preparation of Subcellular Extracts

Cytoplasmic Extracts

HepG2 cell pellets were washed two times with phosphate-buffered saline and then resuspended in Buffer A (50 mM HEPES (pH 7.4), 10 mM KCl, 1 mM EDTA, 1 mM EGTA, 1 mM dithiothreitol, 0.1 mg/ml phenylmethylsulfonyl fluoride, 1 µg/ml pepstatin A, 1 µg/ml leupeptin, 10 µg/ml soybean trypsin inhibitor, 10 µg/ml aprotinin, and 0.5% Nonidet P-40). After 10 min on ice, the lysates were centrifuged at 4,000 × g for 4 min at 4 °C, the supernatant constitutes the cytoplasmic extract.

Sucrose Density-purified Nuclear Extracts

For the purification of nuclei (33, 34), nuclear pellets were resuspended in Buffer B (1.7 M sucrose, 50 mM HEPES (pH 7.4), 10 mM KCl, 1 mM EDTA, 1 mM EGTA, 1 mM dithiothreitol, 0.1 mg/ml phenylmethylsulfonyl fluoride, 1 µg/ml pepstatin A, 1 µg/ml leupeptin, 10 µg/ml soybean trypsin inhibitor, and 10 µg/ml aprotinin), and centrifuged at 15,000 × g for 30 min at 4 °C. The resultant nuclear pellets were incubated in Buffer C (10% glycerol, 50 mM HEPES (pH 7.4), 400 mM KCl, 1 mM EDTA, 1 mM EGTA, 1 mM dithiothreitol, 0.1 mg/ml phenylmethylsulfonyl fluoride, 1 µg/ml pepstatin A, 1 µg/ml leupeptin, 10 µg/ml soybean trypsin inhibitor, and 10 µg/ml aprotinin) with frequent vortexing for 30 min at 4 °C. After centrifugation at 15,000 × g for 5 min at 4 °C, the supernatant is saved for nuclear extract. Both of cytoplasmic and nuclear extracts were normalized for protein amounts determined by the Bradford assay using bovine serum albumin as a standard (Bio-Rad).

Electrophoretic Mobility Shift Assays (EMSAs)

EMSAs were performed as described previously with minor modifications (12, 13). Nuclear extracts (10 µg) were incubated with 40,000 cpm of 32P-labeled APRE WT duplex oligonucleotide probe and 2 µg of poly(dA-dT) in a buffer containing 8% glycerol, 100 mM NaCl, 5 mM MgCl2, 5 mM dithiothreitol, and 0.1 mg/ml phenylmethylsulfonyl fluoride in a final volume of 20 µl, for 15 min at room temperature. The complexes were fractionated on 6% native polyacrylamide gels run in 1 × TBE buffer (25 mM Tris, 25 mM boric acid, and 0.5 mM EDTA), dried, and exposed to Kodak X-AR film at -70 °C. Competition was performed by the addition of 100-fold molar excess nonradioactive double-stranded oligonucleotide competitor at the time of addition of radioactive probe. The sequences of the APRE double-stranded oligonucleotides are as shown below.
<AR><R><C><UP>APRE WT:</UP></C></R><R><C></C></R><R><C><UP>APRE M6:</UP></C></R><R><C></C></R><R><C><UP>APRE M2:</UP></C></R><R><C></C></R></AR><AR><R><C><UP>  GATCCACCACAGTTGGGATTTCCCAACCTGACCA</UP></C></R><R><C><UP>  GTGGTGTCAACCCTAAAGGGTTGGACTGGTCTAG</UP></C></R><R><C><UP>  GATCCACCACAGTTGTGATTTCACAACCTGACCA</UP></C></R><R><C><UP>  GTGGTGTCAACACTAAAGTGTTGGACTGGTCTAG</UP></C></R><R><C><UP>  GATCCACCACATGTTGGATTTCCGATACTGACCA</UP></C></R><R><C><UP>  GTGGTGTACAACCTAAAGGCTATGACTGGTCTAG</UP></C></R></AR>
<UP><SC>Sequences</SC></UP><UP> 1–3</UP>

Antibody supershift assays were performed by adding to the binding reaction 1 µl of affinity-purified polyclonal antibodies and incubating for 1 h on ice. All of the antibodies used in these assays were obtained commercially (Santa Cruz Biotech, Santa Cruz, CA). For the NF-kappa B-DNA binding inhibition assays, the nuclear extracts were mixed with the indicated amounts of bacterially-expressed full-length Ikappa Balpha protein in binding reaction. Inactivated Ikappa Balpha was prepared by boiling the recombinant Ikappa Balpha protein for 30 min in phosphate-buffered saline.

Expression of Polyhistidine-tagged Ikappa Balpha

The full-length cDNA encoding human Ikappa Balpha was subcloned as an EcoRI fragment into the pRSETB expression plasmid under the control of the T7 promoter (InVitrogen, San Diego, CA). The plasmid was transformed into Escherichia coli BL21(DE3)pLysS and the 47-kDa protein was induced with the addition of 1 mM isopropyl-1-thio-beta -D-galactopyranoside (final concentration) during logarithmic growth and purified under native conditions on a nickel-agarose column (35). The protein was >90% pure as judged by SDS-PAGE and Coomassie Blue staining.

Western Blotting and Coimmunoprecipitation

For Western immunoblot, a constant amount of cytoplasmic or nuclear extracts (200-300 µg as indicated) from the above preparation were boiled in Laemmli buffer, separated on 10% SDS-PAGE, and transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA). Membranes were blocked in 8% milk and immunoblotted with the affinity-purified rabbit polyclonal antibodies (Santa Cruz Biotech) for Ikappa Balpha (reactive with amino acids 297-317), Ikappa Bbeta (reactive with amino acids 339-358), Ikappa Bgamma (reactive with amino acids 471-490), Rel A (reactive with amino acids 3-19), or NF-kappa B1 (reactive with amino acids 350-363). Immune complexes were detected by binding donkey anti-rabbit IgG conjugated to horseradish peroxidase (Pierce) followed by reaction in the enhanced chemiluminescence assay (ECL, Amersham) according to the manufacturer's recommendations. For the coimmunoprecipitation assays, cytoplasmic extracts (1 mg) from either untreated or TNFalpha -stimulated HepG2 cells were incubated with Rel A antiserum in a total volume of 1 ml of TST buffer (50 mM Tris-Cl, 5 mM EDTA, 150 mM NaCl, and 0.05% Triton X-100) for 2 h at 4 °C and collected on Protein A-agarose beads (Life Technologies, Inc.). After washing 5 times with TST buffer, the precipitates were boiled in Laemmli buffer and subjected to immunoblotting with anti-Ikappa Balpha antibody following the above procedure. For the neutralization experiments, anti-Rel A and anti-Ikappa Balpha antibodies were neutralized with a 20-fold excess of the relevant polypeptide overnight at 4 °C.


RESULTS

Biphasic Induction of Rel A·NF-kappa B1 DNA-binding in Hepatocyte Nuclei

Exposure of cultured HepG2 human hepatocytes to 20 ng/ml rTNFalpha for 6 h results in an induction of NF-kappa B DNA binding activity and transcriptional activity (12, 13). To resolve the induction kinetics of various NF-kappa B family members in the rTNFalpha response, we examined a 6-h time course of APRE DNA binding activity using extracts of sucrose cushion-purified nuclei using EMSAs. In EMSAs performed under conditions that resolve the individual heterodimeric NF-kappa B species binding to the radiolabeled APRE, four nucleoprotein complexes could be resolved (C1-C4, Fig. 1A). The C1 complex was weakly and variable inducible at 15 min. By contrast, the C2 complex was strongly inducible in a biphasic manner with the first peak occurring at 15 min (a 16-fold induction relative to control), declining by 30 min, and was undetectable at 60 min (the early binding phase). At 120, the C2 complex reappeared (4.1-fold relative to control) and persisted as long as 360 min (the "late" binding phase). Binding specificity of the complexes was demonstrated using site-specific competitors of the APRE in the EMSA (Fig. 1B). Complexes C1 and C2 both competed with homologous APRE WT but not APRE M2 or APRE M6 oligonucleotides, indicating sequence-specific recognition of the NF-kappa B contact points on the APRE (5).


Fig. 1.

A, rTNFalpha induces a biphasic pattern of Rel A·NF-kappa B1 binding in HepG2 nuclei. Autoradiogram of EMSA using 10 µg of nuclear protein prepared from cultured HepG2 hepatoblastoma cells stimulated for the indicated times (in min) with 30 ng/ml rTNFalpha binding to radiolabeled APRE WT DNA. Migration of various complexes (C1-C4) is shown at the left. Complexes C3 and C4 are constitutive. Complex C2 exhibits a biphasic induction pattern with a return to control values at 60 min. C1 is weakly and variably inducible. After quantitation, the C1 complex increases (values given in fold increase relative to controls): 5.7 (15 min), 1.8 (30 min), 1.1 (60 min), 1.6 (120 min), and 1.1 (360 min); for the C2 complex: 16.5 (15 min), 6.1 (30 min), 0.3 (60 min), 4.1 (120 min), and 4.9 (360 min). B, C1 and C2 bind with NF-kappa B binding specificity. Autoradiogram of competition EMSA using 10 µg of 15-min stimulated HepG2 nuclear extract binding to radiolabeled APRE WT in the absence (-) or presence of 100-fold molar excess of APRE site mutations ("Experimental Procedures"). Location of complexes is located at left. Complexes C1 and C2 compete with wild type APRE, but not mutants APRE M2 or APRE M6 (indicating NF-kappa B binding specificity). Complex C3 competes with APRE WT and APRE M6 indicating NF-interleukin 6/C/EBP binding specificity (5). Complex C4 competes in a nonspecific binding pattern. Complex C2 contains both Rel A·NF-kappa B1 subunits. Gel mobility supershift assay after addition of subunit-specific NF-kappa B antibodies (indicated at top). Location of complexes is indicated at the left. Top panel, light exposure. Bottom panel, longer exposure of supershifted bands. Addition of anti-Rel A antibody reduces intensity of C1 and C2 complexes, producing a supershifted band (small asterisk). NF-kappa B1 antibody reduces C2 complex producing supershifted band (large asterisk). Anti-c-Rel antibody reduces C1 complex producing supershifted band (small arrow, bottom panel).


[View Larger Version of this Image (23K GIF file)]


Gel mobility supershift assays using subunit-specific NF-kappa B antibodies was used to demonstrate the composition of the strongly inducible APRE-binding C2 complex (Fig. 1C). Addition of Rel A, but not preimmune antibody resulted in the selective diminution of the C2 complex with the simultaneous appearance of a supershifted band. Similarly, addition of NF-kappa B1 antibody also diminished the intensity of the C2 nucleoprotein complex. Taken together, these data indicate that the DNA binding activity of the C2 is biphasic upon rTNFalpha treatment, C2 binds to the APRE with NF-kappa B binding specificity and is composed of the Rel A·NF-kappa B1 heterodimer.

Nuclear Translocation of Rel A and NF-kappa B1 Parallel the Biphasic Changes in DNA Binding of the C2 Complex

HepG2 cells fractionated into cytoplasmic and highly purified nuclear extracts (by sucrose cushion centrifugation) were assayed in Western immunoblots for changes in relative abundance of Rel A and NF-kappa B1. The Rel A antibody recognized a single ~65-kDa antigen (Fig. 2, arrow) that could be specifically blocked by preadsorbtion using recombinant Rel A protein (not shown). In unstimulated cells, the majority of Rel A was located in the cytoplasmic fraction. By 15 min of rTNFalpha treatment, a slight depletion in the cytoplasmic fraction was noted with a concomitant 3.7-fold increase in nuclear Rel A. At 60 min, nuclear Rel A has diminished to levels approximating control followed by a second increase in Rel A abundance at 120 and 360 min. Changes in nuclear NF-kappa B1 abundance, detected by a specific polyclonal antibody as a 50-kDa band, paralleled those observed for nuclear Rel A (Fig. 2), and for DNA binding of the C2 complex (Fig. 1). These data indicate that rTNFalpha controls cytoplasmic:nuclear positioning of Rel A and NF-kappa B1 in hepatocytes in a biphasic pattern.


Fig. 2. Nuclear translocation of Rel A and NF-kappa B1 (components of C2 complex) in response to rTNFalpha . Autoradiogram of Western immunoblot from 200 µg of cytoplasmic (Cyto) and 300 µg of nuclear (Nuc) extracts from HepG2 cells treated with rTNFalpha for indicated times (in min, top) using Rel A antibody (left panels) or NF-kappa B1 antibody (right panels) as primary antibody in the Western immunoblot. Rel A staining produces a single ~65-kDa band, whereas NF-kappa B1 is a single 50-kDa band. Nuclear abundance of both Rel A and NF-kappa B1 increase at 15 and 30 min and decrease at 60 min exactly paralleling their changes in DNA binding activity (Fig. 1A). After quantitation, nuclear Rel A increases (values given in fold increase relative to controls): 3.7 (15 min), 4.6 (30 min), 1.6 (60 min), 3.7 (120 min), and 5.7 (360 min); for nuclear NF-kappa B1: 7.4 (15 min), 2.8 (30 min), 0.3 (60 min), 3.7 (120 min), and 4.7 (360 min). The cytoplasmic pools are correspondingly decreased at the early 15- and 30-min time points.
[View Larger Version of this Image (18K GIF file)]


Dynamic Expression and Differential Regulation of Ikappa B Isoforms in Response to rTNFalpha Treatment

Cytoplasmic extracts of control and rTNFalpha -treated HepG2 cells were assayed for the expression and relative changes in Ikappa B abundance using antibodies that recognized specific epitopes of Ikappa Balpha , Ikappa Bbeta , and Ikappa Bgamma as determined by the appropriate molecular weight and ability of peptide preadsorption to compete for the immunostaining (Fig. 3A). In control cells, 37-kDa Ikappa Balpha was abundantly detected, as was 46-kDa Ikappa Bbeta and 70-kDa Ikappa Bgamma (Fig. 3B). With rTNFalpha treatment, both Ikappa Balpha and Ikappa Bbeta , but not Ikappa Bgamma , disappeared within 15 min of treatment. Abundance of Ikappa Balpha returned to a 2-fold greater than control levels at 60 min producing an "overshoot" in its synthesis; by 120 min, Ikappa Balpha returned to control levels. In contrast, although 46-kDa Ikappa Bbeta disappeared simultaneously with Ikappa Balpha after TNFalpha treatment, no resynthesis of Ikappa Bbeta was observed. These data indicate the abundance of Ikappa Balpha and beta  is regulated by rTNFalpha treatment, whereas the abundance of Ikappa Bgamma is not. Moreover the robust Ikappa Balpha resynthesis at 1 h corresponds to the "nadir" of Rel A·NF-kappa B1 DNA binding activity and nuclear abundance (cf. Figs. 1A and 2).


Fig. 3. A, expression of Ikappa Balpha , Ikappa Bbeta , and Ikappa Bgamma isoforms in HepG2 cells. Autoradiograms of Western immunoblots using HepG2 cytoplasmic extracts from unstimulated cells probed with preimmune rabbit serum, anti-Ikappa Balpha , Ikappa Bbeta , and Ikappa Bgamma primary antibodies, or the same antibodies preadsorbed with respective peptides (PreAd-Ikappa Balpha , PreAd-Ikappa Bbeta , and PreAd-Ikappa Bgamma ). The molecular weight (in kDa) of the protein standards is indicated at the left. Ikappa Balpha staining produces a single specific 37-kDa band; Ikappa Bbeta appears as a 46-kDa band (small arrow); Ikappa Bgamma is identified as a 70-kDa band (arrow). No NF-kappa B1 precursor is recognized by Ikappa Bgamma antibody (this antibody detects epitope shared by both isoforms). B, changes in steady-state Ikappa B levels in response to rTNFalpha treatment. Western immunoblots from HepG2 cytoplasmic extracts taken from cells treated for indicated times with rTNFalpha (top) and probed with anti-Ikappa Balpha , Ikappa Bbeta , and Ikappa Bgamma primary antibodies (left). The abundance of Ikappa Balpha is rapidly diminished at 15 and 30 min, followed by enhanced levels (2.1-fold relative to control values) at 60 min, and return to control levels after 120 min. Ikappa Bbeta staining is detectable in unstimulated cytoplasm and vanishes after 15 min of rTNFalpha treatment. Ikappa Bgamma abundance is not affected by rTNFalpha .
[View Larger Version of this Image (24K GIF file)]


Ikappa Balpha Rapidly Reassociates with Rel A: The Role of Ikappa Balpha Overshoot in Inhibiting Nuclear Rel A Abundance

We noted that the disappearance of nuclear Rel A occurred simultaneously with enhanced Ikappa Balpha abundance, indicating that enhanced Ikappa Balpha synthesis (overshoot) and reassociation with Rel A may underlie the phenomenon of the 60-min nadir. To directly measure association of Rel A with Ikappa Balpha , we performed a two-step immunoprecipitation/Western immunoblot using cytoplasmic extracts from HepG2 hepatocytes. In this assay, Rel A complexes are captured and washed under nondenaturing conditions on protein A-agarose beads. After the immune complexes are eluted in denaturing SDS-PAGE loading buffer, Ikappa Balpha association is measured by Western immunoblot with Ikappa Balpha antibodies (Fig. 4A; Rel A antibody is used as a control for recovery from the immunoprecipitate). Controls demonstrating specificity of the Rel A·Ikappa Balpha association include: 1) use of preadsorbed Rel A antibody as the primary antibody. As shown in Fig. 4A (lane 2), preadsorbed Rel A antibody does not bring down Rel A nor Ikappa Balpha ; and 2) use of preadsorbed Ikappa Balpha antibody in the Western immunoblot to confirm that the 37-kDa antigen is Ikappa Balpha (Fig. 4A, lane 1).


Fig. 4. A, rapid reassociation of Ikappa Balpha with Rel A during rTNFalpha treatment. Western immunoblot of immunoprecipitates from control and rTNFalpha -treated HepG2 cytoplasmic lysates. Antibody used in immunoprecipitation (IP), indicated in top panel, includes Rel A COOH-terminal antibody (raised to amino acids 434-551), or the same antibody preadsorbed with recombinant Rel A (Pre Ad-Rel A). Antibodies used in Western immunoblot (IB) includes Rel A and either Ikappa Balpha or Ikappa Balpha preadsorbed with recombinant Ikappa Balpha (PreAd-Ikappa Balpha ). The locations of Rel A, IgG, and Ikappa Balpha are indicated on left. Ikappa Balpha staining is dependent on the use of both anti-Rel A in the immunoprecipitation and anti-Ikappa Balpha in the immunoblot. Ikappa Balpha association with Rel A is lost at 15 min and rapidly returns at 30 and 60 min. Note the maximal amount of Ikappa Balpha associated with Rel A occurs at 60 min, the nadir of both Rel A·NF-kappa B1 DNA-binding (Fig. 1A) and nuclear abundance (Fig. 2). B, association of Ikappa Balpha inhibits Rel A·NF-kappa B1 binding taken from early and late phases of induction. Autoradiogram of EMSA using nuclear extracts from rTNFalpha -treated HepG2 for 15 min (Early Induction) and 120 min (Late Induction) binding radiolabeled APRE WT. Homogenous recombinant polyhistidine-tagged human Ikappa Balpha was added to extracts in the indicated amount for 15 min prior to fractionation. Rel A·NF-kappa B1 (C2) binding is completely inhibited with 200 ng of rhIkappa Balpha . C1 binding (Rel A·c-Rel) is weakly affected. Heat inactivated rhIkappa Balpha (Inact) has no effect.
[View Larger Version of this Image (26K GIF file)]


In control cytoplasmic extracts, Rel A is associated with Ikappa Balpha (Fig. 4A, lane 3), but this association is lost upon 15 min of rTNFalpha treatment (a time coincident with its proteolysis, Fig. 3B). At 30 min (and later times), Ikappa Balpha is reassociated with Rel A; we note at 60 min that more Ikappa Balpha is associated with Rel A than at other time points, indicating that there is strong association of Rel A with Ikappa Balpha (during the nadir in Rel A·NF-kappa B1 binding).

The late phase of Rel A induction occurs in the continued presence of Ikappa Balpha . To exclude the possibility that Rel A is modified in a way that prevents inhibition of its DNA binding activity upon Ikappa Balpha binding, purified recombinant human Ikappa Balpha (rhIkappa Balpha ) was added to nuclear extracts prepared from either the early or the late phases of NF-kappa B activation (Fig. 4B). Heat-inactivated Ikappa Balpha was used as a control for nonspecific salt or detergent effects in the EMSA. Addition of 200 ng of rhIkappa Balpha completely inhibited DNA binding activity of the C1 and C2 complexes, the latter representing the Rel A:NF-kappa B1 heterodimer, whereas the nonspecific C4 complex was unaffected. These data demonstrate that Rel A·NF-kappa B1 complex associated with Ikappa Balpha is unable to bind DNA at any phase of its induction.

Our data indicated that enhanced Ikappa Balpha synthesis results in inhibition of Rel A·NF-kappa B1 binding at 60 min of rTNFalpha stimulation. To confirm this model, EMSA was used to determine the pattern of Rel A·NF-kappa B1 binding after Ikappa Balpha resynthesis was inhibited using the protein synthesis inhibitor cycloheximide. In the presence of 50 µg/ml cycloheximide, the biphasic Rel A·NF-kappa B1 binding pattern was abolished and converted into a single monotonic profile as shown in EMSA (Fig. 5). In this same experiment, cytoplasmic Ikappa Balpha disappeared at 15 min and was undetectable at 1 h of rTNFalpha treatment assayed by Western immunoblot (data not shown), indicating requirement of new protein synthesis for the nadir in Rel A·NF-kappa B1 binding. These data indicate: 1) Ikappa Balpha reassociated with the Rel A·NF-kappa B1 complex at 60 min; 2) Ikappa Balpha is capable of inhibiting DNA-binding of Rel A·NF-kappa B1; and 3) Ikappa Balpha appearance at 60 min requires new protein synthesis. We conclude that the enhanced Ikappa Balpha resynthesis at 60 min (Ikappa Balpha overshoot) underlies the biphasic pattern of Rel A·NF-kappa B1 translocation, by producing the nadir in C2 binding.


Fig. 5. Biphasic Rel A·NF-kappa B1 binding is dependent on new protein synthesis. Autoradiogram of EMSA using 10 µg of HepG2 nuclear extract treated for the indicated times (min at top) with rTNFalpha in the presence of cycloheximide (50 µg/ml). The location of complexes (C1, C2, and C4) are indicated at the left. The DNA binding activity of C2 is rapidly induced and persists in a monophasic pattern in the absence of new protein synthesis (cf. Fig. 1A).
[View Larger Version of this Image (74K GIF file)]


Ikappa Bbeta Proteolysis Is Required for the Late Phase of Rel A·NF-kappa B1 Translocation

Previous work has indicated that chymotrypsin-like enzyme(s) mediate Ikappa B proteolysis (36), prompting us to examine whether inhibitors could selectively interfere with Ikappa Bbeta proteolysis so that we could determine its role in biphasic NF-kappa B activation in hepatocytes. The effect of pretreatment with the peptide aldehyde N-acetyl-Leu-Leu-norleucinal (calpain inhibitor I) was determined using Western immunoblot assays of cytoplasmic extracts (Fig. 6). In response to rTNFalpha , Ikappa Balpha proteolysis was clearly evident at 15 and 30 min. By contrast, Ikappa Bbeta abundance was similar, or exceeded, control values from 15 to 360 min (compare with Fig. 3B). Ikappa Bgamma was unaffected throughout the time course of the experiment. We conclude that calpain inhibitor I preferentially blocks Ikappa Bbeta , but not Ikappa Balpha proteolysis in hepatocellular cells.


Fig. 6. Differential effects of calpain inhibitor I on Ikappa B proteolysis. Western immunoblots of cytoplasmic protein harvested from calpain inhibitor I-pretreated HepG2 cells probed with the indicated primary antibodies. Ikappa Balpha proteolysis occurs at 15 min and returns to control by 120 min. Ikappa Bbeta proteolysis, by contrast, is completely blocked.
[View Larger Version of this Image (23K GIF file)]


Under conditions where Ikappa Bbeta proteolysis was preferentially inhibited, we next determined the kinetics of Rel A·NF-kappa B1 translocation. The effect of calpain inhibitor I pretreatment was to block completely the second late phase of Rel A·NF-kappa B1 induction (Fig. 7A). The early appearance of C2 at 15 and 30 min was attenuated, but not abolished, indicating the contribution of Ikappa Bbeta proteolysis to the early phase of translocation. Western immunoblots for nuclear Rel A and NF-kappa B1 abundance confirmed that Rel A and NF-kappa B1 were induced corresponding to the early but not the late phase of nuclear translocation (compare Fig. 7B (360 min) with Fig. 2 (360 min)). These data indicate calpain inhibitor I markedly affects the biphasic pattern of Rel A·NF-kappa B1 induction, converting is induction to a monophasic pattern. These data provide direct evidence for the dynamic effect of Ikappa Balpha and Ikappa Bbeta proteolysis and resynthesis during the biphasic Rel A·NF-kappa B1 induction.


Fig. 7. A, calpain inhibitor I blocks the second phase of Rel A·NF-kappa B1 binding. Autoradiogram of EMSA using nuclear extracts from HepG2 cells pretreated with 200 µM N-acetyl-Leu-Leu-norleucinal for 1 h prior to stimulation with rTNFalpha for the indicated times. The location of complexes (C1-C4) is indicated at the left. The induction of Rel A·NF-kappa B1 (C2) is seen at early (15-30 min) but not the late phase (360 min). B, monotonic profile of Rel A and NF-kappa B1 translocation in the presence of calpain inhibitor type I. Western immunoblots of nuclear protein isolated from cells pretreated with 200 µM calpain inhibitor I and subsequently stimulated with rTNFalpha . 65-kDa Rel A and 50-kDa NF-kappa B1 show a monotonic profile of early phase translocation that persists longer than in rTNFalpha -stimulated control cells (Fig. 2).
[View Larger Version of this Image (35K GIF file)]



DISCUSSION

An important mechanism in the transcriptional activation of the angiotensinogen gene during the APR is the TNFalpha -mediated activation of latent NF-kappa B subunits that bind to the APRE (3, 12, 13). In this study, we have identified mechanistically distinct phases of Rel A·NF-kappa B1 nuclear translocation that depend on dynamic changes in individual Ikappa B subunit abundance. In this report, we describe the unanticipated and novel observation that rTNFalpha produces a biphasic pattern of Rel A·NF-kappa B1 binding. Previous studies have only identified a monophasic induction pattern using 70Z/3 pre-B lymphocytes (24), Jurkat T-cells (38), and U937 macrophages (36) of varying duration. In hepatocytes, the biphasic pattern consists of an early peak (15-30 min), return to control levels (60 min nadir), and a late peak (>120 min). The early peak is the consequence of simultaneous proteolysis of both the Ikappa Balpha and Ikappa Bbeta subunits (without alterations in Ikappa Bgamma abundance). Although Ikappa Bbeta resynthesis is not detectable during the 360-min study, Ikappa Balpha resynthesis, by contrast, is rapid. As a result of the overshoot of Ikappa Balpha synthesis, Ikappa Balpha appears at greater than control levels at 60 min and is apparently responsible for the nadir in Rel A·NF-kappa B1 binding. The use of calpain inhibitor I, a protease inhibitor that selectively blocks Ikappa Bbeta proteolysis, allows us to demonstrate that the second phase of RelA·NF-kappa B1 translocation is solely dependent on signal-induced hydrolysis of Ikappa Bbeta .

Ikappa B Forms Expressed in Hepatocytes Include Regulated Ikappa Bs alpha  and beta  as well as Constitutive Ikappa Bgamma

In non-B lymphocytes, NF-kappa B proteins are sequestered in an inactivated form in the cytoplasm by binding various members of the inhibitory Ikappa B protein family. Ikappa Balpha , -beta , -gamma and NF-kappa B1 p105 are all candidate regulators of Rel A translocation because other studies have shown direct association with Rel A·NF-kappa B1 in cellulo and their ability to inhibit RelA·NF-kappa B1 DNA binding activity in vitro (23-25). The pattern of Ikappa B expression and modification by signal transduction systems has not been systematically studied in liver cells. Relative levels of mRNA encoding the Ikappa B isoforms have been shown to be expressed in a tissue-restricted fashion. For example, Ikappa Bbeta mRNA is expressed highly in testes (where no Ikappa Balpha mRNA is detectable) and Ikappa Balpha is expressed more abundantly in spleen and lung than Ikappa Bbeta (24). Although we have not measured transcript levels, we observe that Ikappa Balpha protein appears to be more abundant than Ikappa Bbeta in hepatocytes. Ikappa Bgamma is a 70-kDa translation product of a unique mRNA that represents either an alternative splice product or a cryptic promoter from the nf-kb1 gene (25), and is reported to have the most highly restricted pattern of expression previously detected only in mouse lymphoid cell lines (25). Although we have not assayed for expression of the unique Ikappa Bgamma transcript, we can identify Ikappa Bgamma expression on the basis of antibody specificity and its appropriate 70,000 molecular weight in hepatocellular cells. In marked contrast to the behavior of Ikappa Balpha and Ikappa Bbeta , the steady state abundance of Ikappa Bgamma appears not to be regulated by rTNFalpha treatment. The presence of constitutive Ikappa Bgamma may account for the presence of residual Rel A in the cytoplasm of rTNFalpha -treated cells at times (15 min) when nearly complete Ikappa Balpha and Ikappa Bbeta proteolysis have occurred, and underscores the concept that there may be pools of Rel A in complex with Ikappa B proteins whose abundance are themselves differentially responsive to distinct second messenger pathways. Finally, it is important to emphasize that our observations are made on a cell population and hence represent a statistical average of individual cellular responses to rTNFalpha . Based on this experimental design, we therefore cannot differentiate between the following interpretations: 1) two subsets of cells are present in the HepG2 culture, one group expresses Ikappa B's alpha  and beta  and a second group expresses Ikappa Bgamma only, with only the former population being rTNFalpha -responsive; versus 2) a homogenous cell population is present in the HepG2 culture that expresses all three Ikappa B isoforms. Although this cell population is rTNFalpha -responsive, the abundance of individual Ikappa B isoforms are controlled by different intracellular signaling pathways. Additional studies, at individual cell resolution, will be required to differentiate between these possibilities.

Mechanisms of TNFalpha -induced Changes in Ikappa B Abundance

TNFalpha activates Rel A translocation by signal-induced modifications of the Ikappa B inhibitor. TNFalpha -activated intracellular signals induces phosphorylation of Ikappa Balpha at NH2-terminal serine residues (amino acids 32 and 36 (28, 30)), by a ubiquitination-dependent kinase, a process that subsequently targets Ikappa Balpha for proteolysis (31, 32). Phospho-Ikappa Balpha migrates at a distinct position on SDS-PAGE gels (~3 kDa larger), allowing for its identification (23, 28, 30, 32). Although we have not directly demonstrated inducible phosphorylation of Ikappa B in HepG2 cells, indirect evidence for Ikappa Balpha phosphorylation is seen in Western immunoblots of cytoplasmic extracts from rTNFalpha -treated cells where the slower phospho-Ikappa Balpha migrating species is seen with longer exposures (data not shown). Other studies have shown that phospho-Ikappa Balpha is itself rapidly polyubiquitinated (Ubn) at lysine residues 21 and 22 (31) and subsequently proteolyzed through the 26 S proteasome pathway (29, 32). The 26 S proteasome, a 700-kDa protease complex, is known to degrade Ubn-conjugated proteins in an ATP-dependent fashion, but the protease(s) involved and their specificity are incompletely characterized (37).

In epithelial cells and lymphocytes, serine protease inhibitors (L-1-tosylamido-2-phenylethyl chloromethyl ketone) and the peptide aldehyde (calpain inhibitor I) are effective in blocking Ikappa Balpha proteolysis at concentrations that interfere with proteasome activity (31, 37). Based on this inhibitor sensitivity profile, the enzyme(s) in the 26 S proteasome complex mediating Ikappa Balpha hydrolysis has been characterized as chymotrypsin-like. In this regard, we are surprised to find in hepatocytes, that calpain inhibitor I blocks Ikappa Bbeta proteolysis relatively selectively. These data indicate a potential involvement of cell-type specific factors in the inducible proteolysis of Ikappa Balpha .

Overshoot of Ikappa Balpha Synthesis: Evidence for Exaggerated Rel A·Ikappa Balpha Autoregulatory Pathway in Hepatocytes

Upon Rel A translocation into the nucleus, the synthesis of Ikappa Balpha is activated (38, 39). Newly resynthesized Ikappa Balpha reassociates with Rel A, inactivating its nuclear location and transcriptional effect resulting in an autoregulatory feedback pathway. The important role of Ikappa Balpha in terminating Rel A·NF-kappa B1 activation is illustrated in the persistent NF-kappa B activation upon rTNFalpha stimulation in fibroblasts cultured from mice with homozygous deletion of ikappa balpha (40). The surprising observation in our studies is that, although Ikappa Balpha is involved in terminating NF-kappa B action, it does so only transiently by overshoot resynthesis. That Ikappa Balpha resynthesis results in a transient inhibition of Rel A·NF-kappa B1 DNA binding activity is supported by the following observations: 1) increased Ikappa Balpha abundance by Western immunoblot (Fig. 3) is coincident with inhibition of Rel A·NF-kappa B1 binding at 60 min (Fig. 1A). 2) Increased Ikappa Balpha is associated with Rel A by coimmunoprecipitation assays (Fig. 4A). 3) Rel A·NF-kappa B1 DNA binding activity from both early and late phases of induction is completely inhibited by rhIkappa Balpha (Fig. 4B). 4) Rel A·NF-kappa B1 inhibition at 60 min is dependent on new protein synthesis (Fig. 5). At present, we are unable to explain why the increased Ikappa Balpha levels at 60 min return to control levels at 120 min; this phenomenon is probably the result of accelerated turnover of Ikappa Balpha in the presence of TNFalpha (as for LPS activation in 70/Z3 cells (23)).

Late Phase Translocation of Rel A·NF-kappa B1 Is Dependent on Ikappa Bbeta Proteolysis

In Jurkat T-lymphocytes (24) and in mouse embryo fibroblasts (4), rTNFalpha produces only Ikappa Balpha , but not Ikappa Bbeta proteolysis, associated with a transient monotonic induction of Rel A·NF-kappa B1 binding. In hepatocytes, by contrast, rTNFalpha produces a biphasic, prolonged induction of Rel A·NF-kappa B1. A requirement for Ikappa Bbeta proteolysis in producing the late phase of Rel A·NF-kappa B1 translocation is seen under conditions where Ikappa Bbeta proteolysis is abolished. Earlier reports in other cell lines have shown that ikappa bbeta is not subject to the Rel A-induced autoregulatory pathway, and once proteolyzed, is not resynthesized during the time course of these experiments (24); our data are consistent with this phenomenon. Ikappa Bbeta proteolysis apparently allows for a prolonged nuclear response to the actions of TNFalpha in a cell restricted pattern. Based on their similar domain organizations and similar rapid proteolytic response to TNFalpha , it might be expected that Ikappa Balpha and Ikappa Bbeta would be proteolyzed through similar pathways. However, several features in HepG2 cells indicate that the mechanism for signal-induced proteolysis of Ikappa Bbeta is distinct from that used for Ikappa Balpha . Phosphorylated Ikappa Balpha isoforms migrate more slowly that nonphosphorylated forms (28, 30), allowing their identification by Western immunoblot. In calpain inhibitor I-treated cells, rTNFalpha -inducible slower migrating species of Ikappa Balpha corresponding to phosphorylated forms can be detected upon longer exposure. No such forms are seen with Ikappa Bbeta (Fig. 6, middle panel), even under conditions when complete inhibition of proteolysis is observed. Second, and more importantly, proteolysis of Ikappa Balpha is insensitive to 200 µM calpain inhibitor I whereas proteolysis of Ikappa Bbeta is completely blocked by this concentration. These data probably indicate that rTNFalpha activates Ikappa B proteolysis through two distinct pathways.

In summary, our studies have focused on the mechanisms for the novel observation of a biphasic induction of Rel A·NF-kappa B1 binding in hepatocytes. Rel A·NF-kappa B1 is associated with three Ikappa B isoforms that are differentially regulated by rTNFalpha , producing pools of constitutive and inducible NF-kappa B complexes. We provide evidence for how dynamic changes in Ikappa Balpha abundance influences the two distinct phases of Rel A·NF-kappa B1 translocation. Moreover, we report that separate proteolytic pathways are involved in Ikappa Balpha and Ikappa Bbeta degradation in hepatocytes producing unanticipated complexity in signal-induced regulation of Ikappa B abundance.


FOOTNOTES

*   This work was supported in part by Council for Tobacco Research Grant 4017 (to A. R. B) and National Heart, Lung, and Blood Institute Grant 1R01 55630-01A1 (to A. R. B.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Dagger    Established Investigator of the American Heart Association. To whom correspondence should be addressed: Div. of Endocrinology, MRB 3.142, University of Texas Medical Branch, 301 University Blvd., Galveston, TX 77555-1060. Tel.: 409-772-2824; Fax: 409-772-8709; E-mail: ABrasier{at}Impo1.utmb.edu.
1   The abbreviations used are: APRE, acute-phase response element; EMSA, electrophoretic mobility shift assay; Ikappa B, inhibitor of NF-kappa B; NF-kappa B1, nuclear factor-kappa B 50-kDa subunit; Rel A, NF-kappa B 65-kDa subunit; rTNFalpha , recombinant tumor necrosis factor alpha ; PAGE, polyacrylamide gel electrophoresis.

ACKNOWLEDGEMENTS

We thank John Morris for the gift of the MAD 3 cDNA, Rebecca Soliz for secretarial assistance, Weili Duan for technical assistance, and Junyi Li for polyhistidine Ikappa Balpha expression.


REFERENCES

  1. Lenardo, M. J., and Baltimore, D. (1989) Cell 58, 227-229 [CrossRef][Medline] [Order article via Infotrieve]
  2. Ron, D., Brasier, A. R., and Habener, J. F. (1990) Mol. Cell Endocrinol. 74, C97-104 [CrossRef][Medline] [Order article via Infotrieve]
  3. Brasier, A. R., and Li, J. (1996) J. Hypertens. 27, 465-475
  4. Kushner, I. (1982) Ann. N. Y. Acad. Sci. 389, 39-48 [Medline] [Order article via Infotrieve]
  5. Brasier, A. R., Ron, D., Tate, J. E., and Habener, J. F. (1990) EMBO J. 9, 3933-3944 [Medline] [Order article via Infotrieve]
  6. Birch, H. E., and Schreiber, G. (1986) J. Biol. Chem. 261, 8077-8080 [Abstract/Free Full Text]
  7. Karin, M. (1995) J. Biol. Chem. 270, 16483-16486 [Free Full Text]
  8. Schindler, C., and Darnell, J. E. J. (1995) Annu. Rev. Biochem. 64, 621-651 [Medline] [Order article via Infotrieve]
  9. Akira, S., Isshiki, H., Sugita, T., Tanabe, O., Kinoshita, S., Nishio, Y., Nakajima, T., Hirano, T., and Kishimoto, T. (1990) EMBO J. 9, 1897-1906