|
|
||||||||
(Received for publication, November 11, 1996, and in revised form, January 23, 1997)
From the Division of Endocrinology and Metabolism, University of
Michigan Medical Center, Ann Arbor, Michigan 48109-0678
Thyroid hormone receptors are ligand-inducible
transcription factors that can potentially interact with thyroid
hormone response elements as homodimers or heterodimers with the
retinoid X receptor. It has generally been felt, however, that the
heterodimer is responsible for induction of gene expression. We have
demonstrated previously that the optimal thyroid hormone receptor
binding sequence is not the consensus hexamer half-site AGGTCA but is
an octamer, AGGTCA. Based upon these findings, we
hypothesize that thyroid hormone response elements composed of optimal
half-sites (TAAGGTCA) will bind thyroid hormone receptors readily and
activate gene expression independently of the retinoid X receptor. In
contrast, response elements composed of suboptimal half-sites
(e.g. GCAGGTCA) will require the retinoid X receptor to
facilitate thyroid hormone receptor-mediated gene expression. To test
this hypothesis, we have reconstituted thyroid hormone
receptor-mediated gene expression in yeast. Our studies confirm the
hypothesis that the retinoid X receptor is required for gene expression
from response elements composed of suboptimal half-sites, whereas
thyroid hormone receptors are sufficient to activate gene expression
maximally from response elements containing optimal half-sites.
Furthermore, coexpression of steroid receptor coactivator-1 is required
for ligand-dependent gene activation from single response
elements. Surprisingly, however, coexpression of the retinoid X
receptor decreases the steroid receptor
coactivator-1-dependent thyroid hormone induction. Overall these data demonstrate that the architecture of the thyroid hormone response element dictates the nuclear receptor requirements for gene
activation. The studies suggest that different coactivators may be
required for gene activation depending upon the response element
architecture and the nature of the bound thyroid hormone receptor
complex (homo- versus heterodimer).
Thyroid hormone receptors (TRs)1 are
zinc finger transcription factors in the erbA superfamily that bind DNA
at specific response element sequences (thyroid hormone response
elements, TREs) and activate gene expression in response to thyroid
hormone (T3) (for reviews, see Refs. 1 and 2). TRs have been shown to
bind DNA as monomers, homodimers, or heterodimers with another erbA superfamily member, the retinoid X receptor (RXR) (3-5).
Heterodimerization of TR with RXR profoundly augments the association
of TR with certain TREs in vitro (3-5), yet over-expression
of RXR in mammalian cells only modestly (or sometimes not at all)
enhances the T3 responsiveness of downstream genes (6). This
discrepancy has confounded the assignment of a physiologic role for RXR
in vivo.
TREs generally are composed of hexameric half-sites oriented as direct
repeats spaced by four base pairs, palindromes separated by 0-1 base
pairs or inverted palindromes spaced by six base pairs (7-11).
TR-mediated gene activation varies with half-site orientation and
spacing and can be modulated by sequence variations within and
immediately flanking the half-sites (12, 13). Moreover, the
conformation of the TR·RXR heterodimer changes when the heterodimer binds different DNA elements (14). Such protein conformation differences have been correlated with the altered transcriptional activities of various TREs, further indicating the importance of
response element architecture in modulating hormonal
responsiveness.
Systematic mutational analysis of the rat growth hormone promoter TRE
led to the proposal of the hexamer AGGTCA as the consensus half-site
for high affinity TR binding (7). Using a non-biased polymerase chain
reaction selection strategy, we have previously shown that the TR
monomer optimally binds the octamer TAAGGTCA rather than the proposed
hexameric consensus sequence (15). Based on these findings, we
hypothesize that sequences flanking the hexameric half-sites which
compose the TRE will dictate the requirement for RXR in mediating
thyroid hormone responsiveness. Specifically, TREs composed of optimal
half-sites will not require RXR to activate gene expression, since TRs
should associate readily with these high affinity sites. TREs composed
of suboptimal half-sites (such as GCAGGTCA) will depend on RXR to
facilitate TR interactions with these half-sites and modulate
transcriptional responses to thyroid hormone.
The ubiquitous expression of RXR in mammalian cells complicates the
interpretation of studies designed to test the above hypothesis. To
circumvent the problem of endogenous RXR expression, we have reconstituted a model system in the lower eukaryote,
Saccharomyces cerevisiae, to mimic mammalian nuclear
receptor gene activation. S. cerevisiae has been used to
model gene activation by several nuclear hormone superfamily members,
including TRs, retinoic acid receptors, vitamin D receptors, estrogen
receptors, and glucocorticoid receptors (16-22). S. cerevisiae lacks known homologs of nuclear receptors but has
sufficient homology with higher eukaryotes in its basal transcription
machinery to support nuclear receptor-mediated transcriptional
activation. Given this null receptor background, one can express
different combinations of nuclear receptors in the context of defined
TREs and determine the receptor requirements dictated by the TRE for
TR-mediated gene expression in vivo.
Unlike glucocorticoid receptors that translocate to the nucleus only
after binding the appropriate hormone, TRs are constitutively found in
the nucleus, bound to TREs even in the absence of ligand (23). In
mammalian cells, TRs are able to activate or repress the transcription
of downstream genes in promoter-specific contexts (for review, see Ref.
24). Recent studies have identified several auxiliary proteins that
associate with nuclear receptors and function physiologically to affect
hormone responsiveness. In the absence of T3, nuclear corepressors
(such as the nuclear receptor corepressor (25) or the silencing
mediator for retinoid and thyroid hormone receptors (26)) associate
with TRs and repress gene expression. T3 binding produces a
conformational change in the TR (27) that dissociates the corepressor
and recruits coactivator proteins (such as the steroid receptor
coactivator-1, SRC-1 (28), or the CREB binding protein (29)) that
stimulate transcription presumably through interaction with the basal
transcription machinery. Little is known regarding the impact of
response element architecture on coactivator function. Expression of
coactivators in the reconstituted yeast nuclear hormone receptor model
can help clarify the role of TRE structural variations in the molecular
mechanisms of coactivation.
The studies reported demonstrate that, as hypothesized, TREs composed
of suboptimal TR half-sites require RXR for TR-mediated gene
expression, whereas TREs composed of optimal TR half-sites do not. In
addition, the presence of the coactivator protein SRC-1 is required to
confer ligand dependence to TR-mediated gene activation from single
copy response elements. Interestingly, the 5 An
integrating reporter plasmid 83:305 was generated by ligating the
SalI-ScaI fragment of pCM83 (30), containing the
CYC1 promoter fused to the
Synthesized oligonucleotide response elements
The top strands of the TRE oligonucleotides are shown without the
5
Volume 272, Number 15,
Issue of April 11, 1997
pp. 9907-9914
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
-Flanking Sequences in Thyroid Hormone Response Element
Half-sites Determine the Requirement of Retinoid X Receptor for
Receptor-mediated Gene Expression*

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
-dinucleotide flanking the
consensus hexamer half-site appears to be a determinant of coactivator
function as well.
Construction of Reporter and Expression Plasmids
-galactosidase gene, into pRS305 (31) at
the SalI, NgoMI (filled in) sites.
Oligonucleotide response elements with GATC overhangs were synthesized
(see Table I) and inserted into the BglII site upstream of
the CYC1 promoter. All response element reporter constructs were
sequenced prior to integration in the yeast genome. Rat TR
1 (32) and
mouse RXR
(5) were subcloned into the pRS-GalH expression
vector2 on opposite sides of the
bi-directional, galactose-inducible promoter to allow expression of
both receptors from a single plasmid. A SalI-SmaI
fragment encoding SRC-1 (28) was subcloned into the yeast expression
vector p413-TEF (33) using the SalI-XhoI (filled in) restriction sites.
-GATC overhangs. The 6 or 8 preceding the orientation designations
(DR, direct repeat; PAL, palindrome; IP, inverted palindrome) indicates
a suboptimal hexameric (AGGTCA) or optimal octameric (TAAGGTCA)
half-site, respectively. The consensus hexamer is in boldface, and the
5
-dinucleotide TA is underlined in each optimal half-site. The number
following the orientation designation (4, 0, 6, or
9) indicates the number of nucleotides separating the
consensus hexameric half-sites.
Response
elements
DNA sequence
6DR4 (suboptimal direct
repeat)
AGCAGGTCATAGCAGGTCAG
8DR4 (optimal direct
repeat)
CAGGTCATCAGGTCAG
6PAL0 (suboptimal palindrome)
CGCAGGTCATGACCTGCG
8PAL0 (optimal
palindrome)
CAGGTCATGACCTG
6IP6 (suboptimal inverted
palindrome)
GTGACCTGCGAGCAGGTCACG
8IP6
(optimal inverted
palindrome)
GTGACCTTCAGGTCACG
8DR9
AGGTCACGATTCGAGGTCAC
Transformation of S. cerevisiae strain SEY6210 (MAT
; ura3-52; leu2-3,-112;
his3-
200; trp1-
901; lys2-801; suc2-
9) with each of the
integrating reporter constructs shown in Table I was carried out using
a standard lithium acetate protocol (34). 25-50 µg of each 83:305
reporter plasmid was linearized within the LEU2 locus by digestion with
BstEII prior to transformation. Transformation of yeast with
episomal expression vectors was performed with 5 µg of nonlinearized
plasmid. Following transformation, cultures were plated on appropriate
synthetic selection media, and single colonies were isolated. Southern
analysis was performed to determine the number of reporter constructs
integrated by homologous recombination in the leu2 insertion site (data
not shown). Strains bearing single reporter construct insertions were
selected for further study.
Prior to exposure to
hormone, yeast strains were grown in appropriate selection medium
containing 3% glycerol and 3% ethanol, a non-repressing carbon source
that does not induce nuclear receptor expression from the galactose
promoter. Cultures were diluted to an absorbance of 0.2 at 650 nm
(A650) and grown overnight (12-16 h) at
30 °C, 300 rpm in the presence of 3% D-galactose (to
induce nuclear receptor expression) with or without 1 µM
triac (3,5,3
-triiodothyroacetic acid), a T3 analog.
-Galactosidase Activity
Following
overnight exposure to hormone, the A650 of each
culture was measured as an indicator of culture density. 1-ml aliquots of each culture were pelleted by microcentrifugation; the supernatants were removed and the pellets stored at
20 °C. Frozen cell pellets were thawed, resuspended in 700 µl of Z buffer (60 mM
Na2HPO4, 40 mM
NaH2PO4, 10 mM KCl, 1 mM MgSO4, 50 mM
-mercaptoethanol), and solubilized with 2 drops of both chloroform
and 0.1% SDS. Pellets were vortexed briefly and incubated at 30 °C
for 5 min. 200 µl of the substrate
o-nitrophenyl-
-D-galactopyranoside (4 mg/ml
0.1 M NaPO4, pH 7.0) was added, and the
reactions were incubated at 30 °C. Upon appearance of yellow color,
350 µl of 1 M Na2CO3 was added to
stop the reaction, and the time was noted. Samples were then
microcentrifuged to remove debris, and the absorbance of the
supernatant at 420 nm (A420) was determined.
-Galactosidase activity was calculated as follows in Equation 1:
|
(Eq. 1) |
-Galactosidase activity
was normalized to the level of activity measured in each reporter
strain transformed with an empty pRS-GalH expression vector.
Semi-quantitative Western Blot Analysis of Nuclear Receptors in
Yeast
Rat TR
1 and mouse RXR
were transcribed from the
vector pBluescript and then translated in vitro in the
presence of [3H]leucine using Promega
transcription/translation reagents. Tritiated cpm of trichloroacetic
acid-precipitable protein were determined, and radiolabel incorporation
into protein of appropriate size was confirmed by SDS-polyacrylamide
gel electrophoresis and autoradiography (data not shown). After
adjusting for the moles of leucines per mol of TR and RXR, these
materials were used in a series of increasing doses as standards in a
Western blot of yeast-expressed RXR and TR. Yeast strains bearing an
integrated 8DR4 reporter construct and pRS-GalH and p413-TEF expression
vectors were grown under inducing conditions (see above). Protein
extracts were prepared by glass bead disruption in 20 mM
Tris, pH 8.0, 10 mM MgCl2, 1 mM
EDTA, 10% (v/v) glycerol, 2 mM dithiothreitol, 0.4 M KCl, 0.3 M
(NH4)2SO4, 1 mM
phenylmethylsulfonyl fluoride, 2 µM pepstatin, and 2 µM leupeptin (35). Protein concentration was then
determined using the Bio-Rad Protein Assay. Following
SDS-polyacrylamide gel electrophoresis, 3H-proteins and
yeast extracts were transferred to nitrocellulose using 63 V for 20 min
in a Hoeffer TransPhor apparatus. Nitrocellulose-bound proteins were
probed with anti-TR
1 (TR
1-J52; Santa Cruz Biotech) or anti-RXR
(1RX-6G12) monoclonal antibodies, and antigen-antibody complexes were
then visualized using an enhanced chemiluminescence detection system
(Amersham Corp.).
Electrophoretic mobility shift assays were performed
essentially as described (12) using 30,000 cpm of
32P-labeled double-stranded oligonucleotide and 2 µl of
in vitro translated rat TR
1 ±1 µM T3 per
reaction. Following 40 min incubation at room temperature, the
reactions were subjected to electrophoresis in 6% polyacrylamide gels.
Gels were then fixed, dried, and exposed to film with an intensifying
screen at
70 °C for 3 to 16 h. The gels also were analyzed by
PhosphorImaging (Molecular Dynamics) to quantify the radioactivity
associated with each shifted band.
Western blot
analysis of yeast protein extracts was performed to demonstrate that
TR
1 and RXR
were expressed appropriately and at roughly
equivalent levels from the bi-directional expression vector pRS-GalH.
Increasing doses of in vitro translated
3H-TR
1 and 3H-RXR
were included in the
assay as standards for both size and mole equivalents of each receptor
(Fig. 1). Control yeast protein extracts from strains
expressing just TR
1 (lane 7) or just RXR
(lane
15) showed no cross-reactivity with the anti-RXR antibody or the
anti-TR
1 antibody, respectively. Comparison of lanes
17-18 with lanes 11-13 and lanes 8-9 with
lanes 2-5, as well as a repeat experiment not shown,
indicates that TR
1 and RXR
are expressed at equivalent levels
following an overnight galactose induction.
1 and RXR
expressed in yeast. Increasing amounts of in vitro
translated 3H-TR
1 (lanes 11-13) or
3H-RXR
(lanes 2-5) were used as controls for
size and mole equivalents of each receptor (see "Experimental
Procedures"). Two doses of protein extracts from a yeast strain
expressing both TR
1 and RXR
(lanes 8, 9, 17, and
18) were used to estimate mole equivalents of each receptor.
2 µg of protein extract from yeast strains expressing TR
1 alone
(lane 7) or RXR
alone (lane 15) were used as
controls for antibody cross-reactivity. M (lanes
1 and 10) represents 2 µl of mock-translated
reticulocyte lysate. Lanes 6, 14, and 16 are
empty.
Functional Reconstitution of TR-mediated Gene Expression in Yeast
To test the yeast model system for functional
reconstitution of thyroid hormone responsiveness,
-galactosidase
induction assays were performed with a yeast strain bearing a reporter
construct with three optimal direct repeat response elements oriented
head to tail upstream of the
-galactosidase reporter gene (3x8DR4). Expression of TR
1 alone in the context of this triple optimal element mediated a 2.0-fold induction of reporter expression in the
absence of ligand (Fig. 2). Addition of triac resulted
in a 7.3-fold induction, which is a 3.6-fold increase over the
induction achieved in the absence of ligand. Coexpression of RXR
with TR
1 slightly increased the ligand-independent induction to
3.0-fold. With the addition of ligand, reporter gene expression was
induced 5.0-fold over basal, yielding a modest 1.7-fold
ligand-dependent induction. Thus, the triple optimal TRE
(3x8DR4) was able to support both ligand-independent and
ligand-dependent gene activation in the presence of TR
1
alone and TR
1 with RXR
. Other groups have made similar
observations regarding TR-mediated ligand-independent (36) and
ligand-dependent (16, 17) gene activation in yeast model
systems, although RXR was shown to modestly augment T3 responsiveness in the context of two copies of a palindromic TRE positioned upstream of a basal promoter. The ability of RXR to augment T3 responsiveness from this palindromic element but slightly inhibit responsiveness from
the triple optimal direct repeat element could relate to the
differences in nucleotide sequence flanking the half-sites in each TRE
or the half-site orientations.
-Galactosidase inductions from the triple
direct repeat TRE 3x8DR4. The 3x8DR4 strain was transformed with
the receptors indicated and induced in the absence (black
bar) or presence (hatched bar) of 1 µM
triac (final). Data are represented as fold inductions over the level
of reporter gene expression in the indicated yeast strain bearing an
empty nuclear receptor expression vector and are the means of two
independent experiments ± standard error.
Reporter Gene Expression from Direct Repeat, Palindromic, and Inverted Palindromic Response Elements
The juxtaposition of
multiple response elements within the triple element TRE may create
different TREs across the junctions of single elements and complicate
the interpretation of the
-galactosidase induction results. To avoid
this complication, reporter constructs with just single copy response
elements were used for subsequent experiments. To investigate the
importance of TRE half-site sequence and orientation in modulating gene
expression, we have constructed a series of different response elements
composed of suboptimal or optimal TR half-sites oriented as direct
repeats, palindromes, or inverted palindromes. The ability of each
response element to direct gene expression was measured in the absence
of nuclear receptors and in the presence of TR
1 alone, RXR
alone,
or TR
1 and RXR
together with and without ligand. All data are
expressed normalized to the levels of
-galactosidase activity found
in each strain carrying an empty nuclear receptor expression
vector.
Fig. 3A (left) shows that, in the
context of the simple suboptimal direct repeat (6DR4), expression of
TR
1 alone was not sufficient to activate reporter gene expression
with or without ligand. Coexpression of TR
1 with RXR
, however,
resulted in a 4-fold induction of reporter gene expression in the
absence of ligand. Addition of 1 µM triac slightly
reduced the level of activated gene expression to 3-fold over basal. In
contrast to the results with 6DR4, if the response element was composed
of optimal TR half-sites (8DR4), TR
1 alone was sufficient to induce
a 5-fold increase in reporter gene expression that was independent of
triac addition (Fig. 3A, right). Coexpression of RXR
with
TR
1 did not substantially augment this gene activation. As seen with
the suboptimal 6DR4, ligand slightly decreased the
receptor-dependent induction. As expected, expression of
RXR
alone did not induce reporter gene expression above basal levels
from either TRE. Thus, the optimal direct repeat TRE (8DR4) can be
activated by TR
1 alone, and coexpression of RXR
with TR
1 has
little effect on this level of activation. In contrast, the suboptimal
direct repeat (6DR4) requires RXR
with TR
1 to mediate reporter
gene expression. It is noteworthy that the level of reporter gene
induction is similar on 6DR4 and 8DR4; what differs is the necessity
(or lack thereof) of RXR to achieve this induction. These data support the hypothesis that the affinity of the TRE for TR dictates the requirement for RXR in modulating gene expression. In addition, the
ligand-dependent induction from the triple optimal direct repeat (3x8DR4) appears to be a consequence of response element multimerization, since induction from the single TREs is slightly inhibited by addition of triac.
-Galactosidase inductions from single
direct repeat, palindromic, or inverted palindromic TREs. A,
inductions of yeast strains harboring the single suboptimal
(6DR4) or optimal (8DR4) direct repeat reporter
construct. B, inductions from the suboptimal (6PAL0) or optimal (8PAL0) palindrome reporter
constructs. C, inductions from the suboptimal
(6IP6) or optimal (8IP6) inverted palindrome
reporter constructs. Data represent the means of four independent
experiments ± standard error (except 6IP6 + RXR
triac,
n = 3). Solid bars represent inductions in
the absence of triac; hatched bars represent inductions in
the presence of 1 µM triac (final). Data are represented
as fold inductions over the level of reporter gene expression found in
the indicated yeast strain bearing an empty nuclear receptor expression
vector.
Palindromic arrangements of suboptimal and optimal TR half-sites
responded qualitatively similarly to the direct repeats, although in
general the levels of induction are less. Thus, reporter gene
expression from the suboptimal palindrome (6PAL0) was dependent upon
coexpression of RXR
with TR
1, and the addition of triac had
little effect (Fig. 3B, left). In contrast, the optimal
palindrome (8PAL0) was activated in the presence of TR
1 alone, and
coexpression of RXR
with TR
1 had little effect on these levels
(Fig. 3B, right). Interestingly the suboptimal or optimal
inverted palindromes (6IP6 or 8IP6) were unable to direct reporter
expression above the basal level with any combination of nuclear
receptors (Fig. 3C).
We conclude from these studies that suboptimal direct repeat or
palindromic TREs require RXR
with TR
1 to induce gene expression. Optimal direct repeat or palindromic TREs, however, are able to activate gene expression in the context of TR
1 alone, suggesting the
importance of TR·TR homodimers in directing gene expression from this
subset of TREs. Moreover, as our hypothesis would predict, coexpression
of RXR
with TR
1 fails to activate gene expression from the
optimal TREs above the levels attained in the presence of TR
1 alone.
To assess whether the optimal TRE requires the formation of a TR·TR
homodimer or just the independent association of two TR
1 monomers to
activate gene expression, we constructed a yeast strain with a direct
repeat TRE containing two optimal half-sites spaced by nine nucleotides
(8DR9, see Table I). This arrangement moves the center
of the upstream half-site one-half helical turn away from the
downstream site and should preclude homodimer formation. This increased
separation of the optimal half-sites effectively reduced the level of
TR
1-mediated reporter gene expression from 5-fold (Fig.
3A) to 1.48 ± 0.06-fold (mean ± S.E.;
n = 4). Coexpression of RXR
with TR
1 had no
effect on this low level of induction (1.50 ± 0.05-fold;
n = 4). Therefore, the ligand-independent activation seen from optimal TREs appears to be dependent upon TR·TR homodimer formation.
It might be
considered surprising that TR·TR homodimers could be active in yeast,
especially in the presence of ligand, since T3 has been shown in
vitro to destabilize TR·TR homodimers (but not the TR·RXR
heterodimers) bound to direct repeats and inverted palindromes of the
consensus hexamer (37, 38). To explore this issue, we have used
electrophoretic mobility shift assays to examine the effect of ligand
on TR·TR homodimers bound to our direct repeats (6DR4 and 8DR4) and
inverted palindromes (6IP6 and 8IP6). As expected, TR·TR homodimers
formed more readily on the optimal than on the suboptimal TREs (Fig.
4). PhosphorImager analysis indicated that in the
absence of ligand, TR·TR homodimer formation was 15 times greater on
8DR4 than on 6DR4. The addition of T3 disrupted ~90% of TR·TR
homodimer formation on the suboptimal element 6DR4 but just 40% of
TR·TR homodimer formation on the optimal direct repeat 8DR4. Thus,
even in the presence of ligand, TR·TR binding to the optimal direct
repeat 8DR4 remained substantial and was 70-fold greater than the
homodimer binding observed on the suboptimal direct repeat 6DR4. The
suboptimal and optimal inverted palindromes, 6IP6 and 8IP6, gave
similar results, although the effect of T3 on homodimer binding to 8IP6
was even more modest than that seen with 8DR4. These data, in
combination with the yeast induction assays using 8DR4 and 8DR9,
support the functional importance of TR·TR homodimers in
vivo.
1 in the presence or absence of 1 µM T3. Band
intensities were quantified by PhosphorImager analysis. 6DR4 was
exposed for 16 h. All others were exposed for 3 h.
Coexpression of the Coactivator SRC-1 in the Context of Direct Repeat TREs
A current model of ligand-inducible nuclear receptor
gene activation proposes that the binding of ligand by the thyroid
hormone receptor results in a conformational change leading to the
recruitment of coactivator proteins to the receptor dimer-DNA complex
with subsequent activation of the basal transcription machinery (25). SRC-1, steroid receptor coactivator-1, has been shown to enhance thyroid hormone responsiveness in a mammalian cell culture system (28).
We sought to investigate whether expression of SRC-1 in yeast could
restore thyroid hormone responsiveness from the single copy TREs. To
that end SRC-1 was expressed in each of the yeast strains described
above, nuclear receptor expression was induced, and
-galactosidase
activity was measured following incubation with or without triac.
SRC-1 expression had essentially no effect on reporter gene activation
from the suboptimal TRE 6DR4 (Fig. 5, left;
compare with Fig. 3A, left) Thus, SRC-1 did not alter the
ligand-independent response to TR with or without RXR and, contrary to
expectations, did not restore a ligand-dependent induction.
In contrast to the results with 6DR4, however, expression of SRC-1 with
the nuclear receptors in the context of the optimal direct repeat
(8DR4) had profound effects (Fig. 5, right; compare with
Fig. 3A, right). In the absence of ligand, SRC-1 slightly
increased the levels of reporter gene expression to 5.5-fold from
5.0-fold with TR
1 alone and to 7.0-fold from 6.1-fold with TR
1
and RXR
together. More importantly, upon the addition of triac,
TR
1 and SRC-1 together directed a 15.1-fold induction of reporter
gene expression, which represents approximately three times the level
of induction seen in the absence of ligand. Unexpectedly, coexpression
of RXR
with TR
1 and SRC-1 reduced the reporter gene induction in
the presence of ligand to 10.6-fold, which represents just a 1.5-fold
ligand-dependent effect. In summary, expression of SRC-1
restored ligand-dependent gene activation from the optimal
direct repeat TRE (8DR4) in the presence of TR alone and, to a lesser
extent, in the presence of TR plus RXR. The suboptimal direct repeat
TRE (6DR4), however, did not support ligand-dependent
activation of gene expression even in the presence of SRC-1.
-galactosidase inductions from direct repeat TREs. SRC-1 was
coexpressed with the indicated nuclear receptors in strains carrying
the suboptimal (6DR4, left) or optimal
(8DR4, right) direct repeat reporter constructs.
-Galactosidase inductions were carried out in the absence
(solid bars) or presence (hatched bars) of 1 µM triac (final). Data represent the means of four
independent experiments ± standard error. Data are represented as
fold inductions over the level of reporter gene expression in the
indicated yeast strain bearing an empty nuclear receptor expression
vector.
To assess the importance of TR·TR homodimer formation (as opposed to
TR monomers) in modulating the SRC-1-dependent ligand induction from 8DR4, we coexpressed TR
1 and SRC-1 in a yeast strain
bearing the 8DR9 response element, induced expression of the nuclear
receptors in the presence or absence of ligand, and assayed for
reporter gene expression. SRC-1 did not alter the low levels of
ligand-independent gene expression found in the 8DR9 strains expressing
TR
1 alone (1.43 ± 0.07 fold; n = 4). Addition
of ligand resulted in a minimal increase in reporter gene expression
with TR
1 and SRC-1, from 1.43-fold over basal to 2.04 ± 0.09-fold (n = 4). This was 7-fold less than the SRC-1 and ligand-dependent induction from 8DR4 (Fig. 5,
right). Coexpression of RXR
with TR and SRC-1 had little
effect on reporter gene expression in the absence (2.08 ± 0.27-fold; n = 4) or presence (2.04 ± 0.17-fold; n = 4) of ligand. The data show that separation of the
optimal TR half-sites by an additional 5 base pairs drastically
impaired the ability of SRC-1 to enhance gene expression in response to ligand. Therefore, in this system, SRC-1 appears to activate gene expression through liganded TR·TR homodimers and not TR monomers.
As in the case with the suboptimal direct repeat TRE
6DR4, coexpression of SRC-1 with TR
1 alone in strains bearing
suboptimal palindromic (6PAL0) or inverted palindromic (6IP6) TREs had
no effect on gene activation in the presence or absence of triac (Fig.
6, left panel; compare with Fig. 3, B
left and C left). In the absence of ligand,
coexpression of SRC-1 with TR and RXR also had no effect on reporter
gene expression from any suboptimal TRE. Interestingly, however, SRC-1
expression with TR and RXR did restore a modest level of
ligand-dependent gene activation in the context of 6PAL0,
but not 6IP6 or, as shown above, 6DR4 (Fig. 6, right panel).
Therefore, both the palindromic half-site orientation and the presence
of RXR with SRC-1 and TR were requirements for
ligand-dependent gene activation from suboptimal TREs.
-Galactosidase inductions in the absence (solid
bars) or presence (hatched bars) of 1 µM
triac from suboptimal direct repeat (6DR4), palindromic
(6PAL0), or inverted palindromic (6IP6) reporter
constructs after coexpression of SRC-1 with TR are shown to the
left. Induction results following coexpression of TR + RXR + SRC-1 are depicted on the right. Data represent the means of
four independent experiments ± standard error. The data from 6DR4
were presented in Fig. 5, left panel, and are shown here to
facilitate comparison with the other suboptimal elements. Data are
represented as fold inductions over the level of reporter gene
expression in the indicated yeast strain bearing an empty nuclear
receptor expression vector.
SRC-1 Demonstrates Activity in the Context of All Optimal TREs but Is Less Effective in the Presence of RXR
As seen with the optimal
direct repeat 8DR4, expression of SRC-1 in the context of the optimal
palindromic and inverted palindromic TREs had little effect on reporter
gene expression in the absence of ligand (Fig. 7;
compare with Fig. 3, B and C). Also as seen with
8DR4, ligand-dependent gene activation from 8PAL0 and 8IP6 was restored after coexpression of SRC-1 with TR
1 alone and with TR
1 and RXR
together (Fig. 7). Coexpressing SRC-1 with TR
1 in
the context of the optimal palindromic TRE (8PAL0) resulted in a
2.1-fold induction of reporter gene expression in the absence of
ligand, which increased to 6.6-fold with the addition of triac. This
ligand-dependent 3-fold increase in reporter gene
expression was equivalent to the increase seen with TR
1 and SRC-1
coexpression in the optimal direct repeat (8DR4) strain. SRC-1 and
TR
1 also were able to mediate a ligand-dependent 2-fold
increase in reporter expression from the optimal inverted palindrome
(8IP6). It should be noted, however, that the overall level of gene
induction was greatest for 8DR4 and least for 8IP6;
ligand-dependent fold inductions were approximately equal
due to differences in the levels of reporter gene inductions by
unliganded receptor.
-Galactosidase inductions in the absence (solid
bars) or presence (hatched bars) of 1 µM
triac from direct repeat (8DR4), palindromic
(8PAL0), or inverted palindromic (8IP6) reporter
constructs after coexpression of SRC-1 with TR are shown to the
left. Induction results following coexpression of TR + RXR + SRC-1 are depicted on the right. Data represent the means of
four independent experiments ± standard error. The data from 8DR4
were presented in Fig. 5, right panel, and are shown here to
facilitate comparison with the other optimal elements. Data are
represented as fold inductions over the level of reporter gene
expression in the indicated yeast strain bearing an empty nuclear
receptor expression vector.
The addition of RXR
to TR
1 and SRC-1 attenuated the magnitude of
the ligand-dependent induction in yeast strains carrying the optimal direct repeat or palindromic TREs (Fig. 7, right
versus left). Similar to its effects on
SRC-1-dependent ligand induction from 8DR4 (noted in Fig.
5), coexpression of RXR
with TR
1 and SRC-1 reduced the ligand-
and SRC-1-dependent induction from 3- to 1.8-fold from the
optimal palindromic TRE 8PAL0. Thus, whereas the coexpression of RXR
with TR and SRC-1 was required for ligand-dependent induction from the suboptimal palindromic TRE (6PAL0), RXR diminished the ability of SRC-1 to support triac-induced gene expression from the
optimal direct repeat (8DR4) and palindromic (8PAL0) TREs. This
RXR-mediated decrease in ligand induction appeared to reflect both a
modest increase in ligand-independent gene expression and a modest
decrease in the absolute level of gene induction in the presence of
triac.
The modest augmentation of T3-responsive gene induction by RXR over-expression in cultured mammalian cells is discordant with the ability of RXR to dramatically enhance the association of TRs with certain TREs in vitro. Recently, Hsu et al. (6) examined the importance of RXR in modulating T3-dependent gene expression from several naturally occurring TREs in different cell lines and found that RXR augmentation of T3 response was TRE- and cell line-specific. This effect was quite modest (2-fold or less) and was most pronounced with more complex TREs in cell lines expressing low levels of endogenous RXR. Such cell culture studies designed to address the physiological importance of RXR in modulating T3-dependent gene activation are complicated by the ubiquitous expression of RXR in mammalian cells. The ideal system for investigating the functional role of RXR in T3-mediated gene expression is an RXR-null eukaryotic background into which RXR can be expressed. Hsu et al. (6) identified an embryonic stem cell line that was thought to express no RXR protein. However, we have analyzed this cell line by Western blot and electrophoretic shift mobility assay and by both assays found it to contain RXR (data not shown). Thus, currently there is no RXR-negative mammalian cell line available for study. Therefore, to avoid the complications of endogenous RXR activity, we selected S. cerevisiae as the RXR-null eukaryotic background for our studies. S. cerevisiae maintains enough functional homology with mammalian transcription systems to allow modeling of mammalian nuclear hormone-mediated gene activation and has been a useful tool for understanding the molecular mechanisms by which several members of the nuclear hormone receptor superfamily mediate gene expression in response to hormone ligands (16-22). In the absence of an RXR-null mammalian cell line, S. cerevisiae provides an excellent system for studying mechanisms of T3-dependent gene expression.
Based upon our previous identification of the optimal TR-monomer half-site (15), we hypothesized that simple TREs composed of optimal binding half-sites would not require RXR for efficient gene activation, since TRs should bind tightly to these elements. In contrast, TREs composed of suboptimal TR binding half-sites would depend upon RXR to facilitate TR interaction with the suboptimal TRE and bring about gene activation. We find that this is true for direct repeat and palindromic TREs with regard to ligand-independent receptor-mediated activation (Fig. 3, A and B). RXR is required for gene expression from the suboptimal versions of these TREs. In contrast, TR alone activates gene expression from the optimal versions of these TREs, and this activation is not enhanced by coexpression of RXR. Furthermore, this TR-mediated activation appears to require the formation of TR·TR homodimers rather than the association of monomeric TRs with the TRE.
Even though the optimal half-site is not found in any of the currently
characterized naturally occurring TREs, it remains plausible that
TR·TR homodimers could activate a subset of optimal or near-optimal
TREs. As many as 8% of liver genes may be T3-responsive (39) but only
approximately a dozen natural TREs have been characterized. We
postulate that the promoters of thyroid hormone-regulated genes exhibit
a spectrum of RXR dependence in mediating responses to T3. At one end
of this spectrum would be TREs that could support T3-dependent gene activation independent of RXR; at the
other extreme would be TREs that demonstrate total dependence on RXR for mediating T3 responses. The optimal and suboptimal TREs in this
study were selected to represent the ends of such a spectrum, but most
natural TREs would likely fall somewhere in between. It is difficult to
predict, based simply on inspection, where the currently known TREs
would lie in this spectrum. These natural TREs vary not only in
half-site sequence but also in half-site orientation and number, and
each of these factors may influence hormone responsiveness. In addition
the impact on gene expression of having one strong and one weak
affinity half-site, versus two moderate affinity half-sites,
is not known. Even the prediction of the strength of a half-site based
upon its sequence is not simple, since some base changes within the
octamer are likely to be better tolerated than others. Nevertheless,
near-perfect octamer half-sites have been identified in natural TREs
(e.g. TGAGGTCA, the downstream half-site of the chick
lysozyme IP6 TRE (40)) as have weak half-sites (e.g.
GGAGGTGA, the upstream half-site of the rat
-myosin heavy chain DR4
TRE (41)). With the characterization of more natural TREs, it may
become possible to identify a subset that shows sufficient variation in
the half-site sequences, without variation in half-site orientation or
number, and thus allow a direct comparison of the RXR dependence of
gene expression.
In the current model of thyroid hormone-mediated gene activation, the major function of ligand is to induce conformational changes in nuclear receptor complexes that, in turn, regulate the interaction of associated factors carrying repression (corepressors) or activation (coactivators) activities (25). In the absence of ligand, corepressors associate with TR and repress transcription. Upon ligand binding, the corepressor dissociates and coactivators then bind the TR and activate transcription from the downstream promoter. The receptor-mediated ligand-independent gene expression from the single TREs used in this study is presumably due to the lack of nuclear receptor-specific corepressor proteins in yeast. In the absence of any corepressor, a constitutive activation function in TR is sufficient to activate reporter expression. In preliminary experiments we were unable to express functional nuclear receptor corepressor or silencing mediator for retinoid and thyroid hormone receptors in yeast and repress this constitutive activation. Since yeast also appear to lack nuclear receptor coactivators akin to SRC-1, liganded TR is functionally equivalent to unliganded TR and, therefore, unable to enhance promoter activity above the constitutive levels achieved in the absence of ligand. The small inhibitory effect of ligand seen in the absence of the coactivator SRC-1 likely reflects a conformational change in TR that alters the function of a constitutive TR activation domain. In addition, ligand binding may slightly lower the DNA binding affinity of the TR·TR homodimer and thereby decrease its ability to transactivate, although TR·RXR heterodimer binding to DNA is unaffected by the presence of ligand (37, 38).
In mammalian cells, unliganded TRs typically function as repressors of transcription from positive regulatory elements (23). It should be noted, however, that unliganded TRs also can activate transcription in mammalian cells, such as in the context of the thyrotropin releasing hormone and keratin promoters (42, 43). In fact, TR·TR homodimers may direct keratin gene expression, since TR·RXR heterodimers fail to bind the keratin TRE (43). Thus, the functioning of unliganded TRs as activators in S. cerevisiae has a precedent in mammalian cells and may not simply reflect an anomaly of mammalian nuclear receptor expression in yeast.
We were surprised to find that single response elements in our yeast reporter constructs responded qualitatively differently to ligand than reporter constructs bearing three response elements in tandem. We assumed that TREs which differed only in response element copy number would demonstrate proportional quantitative changes in reporter gene activation. This was not the case; ligand decreased the level of reporter gene expression from a single copy of 8DR4, whereas it stimulated reporter gene expression from the triple element (see Figs. 3A and 2). Ligand-dependent gene expression from the single element required coexpression of SRC-1 (discussed below), whereas ligand-dependent expression from the triple element did not. Thus, the ligand-dependent induction of gene expression from the triple response element may represent a qualitatively different mechanism by which nuclear receptors can activate gene expression than that engaged from the single TREs. Interactions among multiple TREs also may occur in certain mammalian genes, as the promoters for rat uncoupling protein (44) and human type I deiodinase (45) both contain multiple TREs. The association of nuclear hormone receptors on multiple response elements may permit protein interactions between receptor dimers that can be modulated by ligand-dependent conformational changes to promote gene activation. Our selection of single response elements for subsequent studies excluded the complications posed by multimerized response elements and allowed us to focus on the molecular aspects of transcriptional activation from single nuclear receptor dimer-DNA complexes.
The restoration of ligand-dependent gene activation from single response elements by SRC-1 (compare Figs. 3 and 5-7) demonstrates the importance of the coactivator protein in converting ligand binding by TRs into transcriptional activation of downstream promoters. Ligand-induced conformational changes in TRs bound to single response elements do not bring about gene activation through the receptor itself but rather through functional interactions with coactivators such as SRC-1. Importantly, SRC-1 did not alter the RXR requirements dictated by the composition of the TRE. Thus, SRC-1-mediated ligand-dependent gene activation from the suboptimal palindromic TRE (6PAL0) required the presence of RXR with TR, whereas SRC-1 activity from optimal TREs was maximal in the presence of TR alone.
Surprisingly, SRC-1 was able to support triac induction of gene expression only under certain circumstances. In general, SRC-1 was more potent in the presence of TR·TR homodimers than TR·RXR heterodimers and also was more potent on (optimal) octamer half-sites than (suboptimal) hexamers. Thus, SRC-1 allowed for a large triac induction from 8DR4 in the presence of TR·TR homodimers, a moderate induction from 8DR4 in the presence of TR·RXR heterodimers, a minimal induction from 6PAL0 in the presence of TR·RXR heterodimers, and no induction from 6DR4 or 6IP6. These data suggest that other coactivators may be required for thyroid hormone inductions involving heterodimers and/or suboptimal hexameric half-sites. Other coactivators that might be necessary for these T3 responses could include SRC-1 homologs (21, 46) or CREB binding protein (29). These data would imply that alterations in the availability of a coactivator could affect the T3 induction from only a subset of responsive genes within a cell.
How is it that the TRE sequence can influence the functional effects of SRC-1? Ikeda et al. (14) have demonstrated that the conformation of the TR·RXR heterodimer and its transcriptional activity can be modulated by the TRE to which it is bound. Therefore, the TR·RXR heterodimer may be functionally different in regard to its productive interaction with the coactivator SRC-1 when it binds different configurations and sequences of half-sites. Such TRE modulation of coactivator interaction and/or function suggests another level of regulation of TR-mediated gene expression.
This differential potency of SRC-1 on optimal versus
suboptimal TREs is reminiscent of the promoter-specific coactivator
function demonstrated in B-cells by the transcriptional coactivator
Bob1 in conjunction with octamer transcription factors (47). Even though Oct-1·Bob1 complexes bind the octamer elements of the Ig-
and histone H2B promoters equally well, the H2B promoter exhibits reduced coactivation. Thus transcriptional coactivation appears to
require more than just simple tethering of a coactivation domain to
transcription factors. Other determinants of coactivator function, which may include protein conformation, appear to be encoded within the
response element.
The nature of the attenuation of SRC-1 activity by RXR in the context of optimal TREs is unclear. SRC-1 was isolated in a two-hybrid screen using the progesterone receptor as the bait for interacting proteins (28). Since progesterone receptors interact with their palindromic response elements as homodimers, it is interesting to speculate that SRC-1 interacts with homodimeric receptor complexes differently than it does with TR·RXR heterodimers. This difference may be stoichiometric, or SRC-1 may have a higher affinity or more optimal conformation on homodimers, resulting in a greater degree of gene expression. In any case, the net effect may be to give the cell another means of regulating gene expression by thyroid hormone.
In conclusion we have demonstrated that TREs composed of suboptimal TR half-sites require RXR for TR-mediated ligand-independent and ligand-dependent gene expression. TREs composed of optimal TR half-sites are not dependent on RXR for TR-mediated ligand-independent or ligand-dependent gene expression. In addition, it is the presence of the coactivator SRC-1 that confers ligand dependence to TR-mediated gene activation from single response elements. SRC-1 activity varies with the composition of nuclear receptor dimers and the response elements to which the dimers are bound, showing the strongest effect with TR·TR homodimers bound to optimal direct repeat or palindromic TREs. Finally, both the composition and configuration of nuclear receptors that are competent to activate transcription in response to ligand are at least in part dictated by the response element architecture. Given the availability of RXR and SRC-1 in the mammalian nucleus, a continuum of response elements with variations in half-site sequence and orientation may provide the basis for a range of effects on different genes in response to the same thyroid hormone signal.
To whom correspondence should be addressed: University of Michigan
Medical Center, 5560 MSRB II, 1150 W. Medical Center Dr., Ann Arbor, MI
48109-0678. Tel.: 313-763-3056; Fax: 313-936-6684.
-triiodothyroacetic acid.
We thank Dennis Thiele and Keith Koch for
providing yeast plasmids, reagents, and superior technical advice. We
thank Pierre Chambon for the RXR
cDNA and monoclonal antibodies
to RXR and S. Oñate, M.-J. Tsai, and B. O'Malley for the SRC-1
cDNA. We also thank B. Sun for excellent technical support.
This article has been cited by other articles:
![]() |
B. Xu and R. J. Koenig An RNA-binding Domain in the Thyroid Hormone Receptor Enhances Transcriptional Activation J. Biol. Chem., August 6, 2004; 279(32): 33051 - 33056. [Abstract] [Full Text] [PDF] |