JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Houssa, B.
Right arrow Articles by van Blitterswijk, W. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Houssa, B.
Right arrow Articles by van Blitterswijk, W. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 16, Issue of April 18, 1997 pp. 10422-10428
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Cloning of a Novel Human Diacylglycerol Kinase (DGKtheta ) Containing Three Cysteine-rich Domains, a Proline-rich Region, and a Pleckstrin Homology Domain with an Overlapping Ras-associating Domain*

(Received for publication, December 20, 1996)

Brahim Houssa Dagger §, Dick Schaap Dagger §, José van der Wal Dagger , Kaoru Goto par , Hisatake Kondo par , Akio Yamakawa **, Masao Shibata **, Tadaomi Takenawa ** and Wim J. van Blitterswijk Dagger Dagger Dagger

From the Dagger  Division of Cellular Biochemistry, Netherlands Cancer Institute, Plesmanlaan 121, 1066 CX Amsterdam, The Netherlands, the par  Department of Anatomy, Tohoku University School of Medicine, Sendai 980, Japan, and the ** Department of Biochemistry, Institute of Medical Science, University of Tokyo, Tokyo 108, Japan

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES


ABSTRACT

Diacylglycerol kinase (DGK) attenuates levels of second messenger diacylglycerol in cells and produces another (putative) messenger, phosphatidic acid. We have previously purified a 110-kDa DGK from rat brain (Kato, M., and Takenawa, T. (1990) J. Biol. Chem. 265, 794-800). Here we report the cDNA cloning from human brain and retina cDNA libraries. The cDNA encodes a novel DGK isotype, termed DGKtheta , of 941 amino acids with an apparent molecular mass of 110 kDa. DGKtheta contains a C-terminal putative catalytic domain, which is present in all eukaryotic DGKs. In contrast to other DGK isotypes, DGKtheta contains three cysteine-rich domains instead of two. The third cysteine-rich domain is most homologous to the second one in other DGK isotypes. This particular sequence homology extends C-terminally beyond the typical cysteine/histidine core structure and is DGK-specific. DGKtheta furthermore contains various domains for protein-protein interaction, such as a proline- and glycine-rich domain with a putative SH3 domain-binding site and a pleckstrin homology domain with an overlapping Ras-associating domain. DGKtheta is expressed in the brain and, to a lesser extent, in the small intestine, duodenum, and liver. In situ hybridization of DGKtheta mRNA in adult rat brain reveals high expression in the cerebellar cortex and hippocampus. DGKtheta activity in COS cell lysates is optimal toward diacylglycerols containing an unsaturated fatty acid at the sn-2 position.


INTRODUCTION

Diacylglycerol kinase (DGK1; EC 2.7.1.107) plays an important role in signal transduction (1-3). It phosphorylates the second messenger diacylglycerol (DG) to phosphatidic acid (PA) and is therefore thought to attenuate the activation of protein kinase C (PKC), for which DG is a physiological activator (4). In addition, the product of DGK (PA) may play a second messenger role as well (3, 5, 6). PA has been shown to activate a number of enzymes involved in signal transduction, including PKC-zeta (7), unidentified protein kinases (8, 9), phospholipase C-gamma 1 (10), and polyphosphoinositide kinases (11, 12), in vitro. Furthermore, PA binds to and may regulate the translocation and subsequent activation of the protein kinase Raf-1 (13) and the protein-tyrosine phosphatase PTP1C (14).

Various isotypes of mammalian DGK have been identified and show their own remarkably cell-specific expression patterns among a wide variety of cell types. The first group of highly homologous isozymes that has been cloned, DGKalpha (15-17), DGKbeta (18), and DGKgamma (19, 20) (also named DGK-I, -II, and -III, respectively), has an apparent molecular mass in the 80-90-kDa range. These DGKs are characterized by a conserved N-terminal domain of unknown function and EF-hands that bind Ca2+ (2). A C-terminal (putative) catalytic domain and two cysteine-rich (or zinc-finger) domains (CRDs) are common to all DGKs cloned thus far. A recently characterized 64-kDa isotype, DGKepsilon , lacks EF-hands, but is otherwise structurally similar to the first group of DGKs and is highly selective for arachidonate-containing substrates (21). Two other recently cloned isozymes, DGKdelta and DGKeta (130-140 kDa), contain a pleckstrin homology domain (PH domain) near the N terminus (22, 23). Finally, DGKzeta (also named DGK-IV; 104 kDa) is characterized by four tandem ankyrin-like repeats near the C terminus (24, 25), a nuclear targeting motif (25), and a region that is homologous to the phosphorylation site of the MARCKS (yristoylated lanine-ich inase ubstrate) protein (24). The sequence of DGKzeta closely resembles that of the eye-specific DGK2 from Drosophila encoded by the RgdA gene (26). A RgdA mutation inactivates DGK2 and causes retinal degeneration, illustrating the essential role of DGK in neurologic functions.

Here we report the molecular cloning of a new isozyme, named DGKtheta , with several unique and interesting structural features. It contains three instead of two CRDs and a PH domain at a different location than in DGKdelta and DGKeta . The first half of this PH domain overlaps a recently identified putative Ras-binding site, the so-called Ras-associating domain (RA domain) (27). DGKtheta furthermore contains a proline- and glycine-rich domain at the N terminus, but lacks EF-hands. Each of these conserved domains is typically contained in signaling molecules and is thought to mediate lipid-protein or protein-protein interaction in signal-transducing complexes. The structural properties of this novel DGKtheta and its tissue distribution are presented here in the context of what is known about other DGK isotypes.


EXPERIMENTAL PROCEDURES

Materials

Radiolabeled nucleotides, Hybond-N nylon membranes, and enhanced chemiluminescence (ECL) reagents were from Amersham Corp. Acrylamide was from Serva. ATP, restriction enzymes, T4 DNA ligase, and Klenow enzyme were from Boehringer Mannheim. Taq polymerase was from Life Technologies, Inc. Lipids were from Sigma. T7 DNA polymerase and oligonucleotide primers were from Pharmacia Biotech Inc.

cDNA Cloning and Sequencing

The peptides ATPVQVDGEPWIQAPGH and EIRLQVEQQEVELPSIEGL were obtained from purified 110-kDa DGKtheta protein (see "Results") through digestion with lysyl endopeptidase and fractionation by C18 reverse-phase high pressure liquid chromatography with a 0-60% gradient of acetonitrile in 0.1% trifluoroacetic acid. From these peptides, we derived the respective synthetic oligonucleotides GCCACCCCTGTGCAGGTGGATGG(A/G)GAGCCCTGGATCCAGGCCCCTGGCCAC and GAGATCAGATTACAGGTGGAACAGCAGGAGGTGGAGTTACCCTCGATAGAGGGCTTA as probes to screen a lambda gt10 random-primed cDNA library from rat brain according to standard protocols (28). From the resulting 2-kb positive clone, a 400-bp PstI fragment was used for further screening of human cDNA libraries (see "Results"). For sequencing, increasing nested deletions were made using the double-stranded nested deletion kit (Pharmacia). Nucleotide sequencing was done by the dideoxy chain termination method (29) as well as automatically on a Model 373 DNA Sequencer (ABI Advanced Biotechnologies, Inc.). Sequence data were analyzed using Genetics Computer Group software (30).

Reverse Transcriptase Polymerase Chain Reaction (PCR)

Total RNA was isolated from rat tissues using the LiCl method (28). RNA (10 µg) was incubated with random hexamers (50 µM final concentration) and annealed for 5 min at 65 °C, followed by 10 min at room temperature. cDNA synthesis was performed for 1 h at 37 °C in a 20-µl reaction mixture containing 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl2, 0.01% gelatin, 1 mM dNTPs, 2 units/ml RNase inhibitor, and 10 units of reverse transcriptase (SuperScript, Life Technologies, Inc.). After inactivation (5 min at 90 °C), the reaction mixture was diluted 5-fold, and 5 µl of this diluted mixture was used for PCR amplification. PCR was done in the presence of two rat DGKtheta -specific primers or two glyceraldehyde-phosphate dehydrogenase-specific primers as a control. PCR was carried out for 25 cycles as follows: 94 °C for 1 min, 55 °C for 1 min, and 72 °C for 1 min, followed by a final elongation step for 10 min at 72 °C. One-tenth of the PCR product was subsequently separated on an agarose gel, transferred to Hybond-N nylon membrane, and hybridized with a rat cDNA probe.

Antibody

A mouse anti-DGKtheta monoclonal antibody was made against an Escherichia coli cell-expressed, affinity-purified glutathione S-transferase fusion protein of a C-terminal portion (part of the catalytic domain) of rat DGKtheta . To this end, a 1.7-kb PstI-EcoRI fragment of the rat cDNA clone was subcloned into pGEX3X vector.

In Situ Hybridization Histochemistry

Fresh frozen blocks of brain from adult male rats were sectioned at 30-µm thickness on a cryostat. The sections were mounted on silane-coated glass slides and immersed in 4% paraformaldehyde and 0.1 M phosphate buffer (pH 7.2) for 20 min, followed by acetylation in 0.25% acetic anhydride in 0.1 M triethanolamine. The slides were prehybridized in a fluid containing 50% formamide, 4 × SSC, 1 × Denhardt's solution, 1% sarcosyl, 0.1 M sodium phosphate buffer (pH 7.2), 100 mM dithiothreitol, and 200 µg/ml heat-denatured salmon sperm DNA for 2 h at room temperature. Hybridization was in the same solution containing 10% dextran sulfate and 1 × 106 cpm/slide of 35S-dATP-labeled cDNA probe at 42 °C for 16 h in a moist chamber. The probe corresponded to the 3'-noncoding region of the rat DGKtheta sequence (HindIII-EcoRI fragment, 800 bp). After hybridization, the slides were sequentially rinsed in 2 × SSC and 0.1% sarcosyl at 45 °C for 30 min and three times in 0.1 × SSC and 0.1% sarcosyl at 45 °C for 40 min each and dehydrated in 70 and 100% ethanol. After exposure to Hyperfilm-beta max (Amersham Corp.) for 3 weeks, the sections were dipped in NTB2 emulsion (Eastman Kodak Co.) and exposed for 2 months.

DGK Assay

Cell lysates were made by brief sonication in a medium containing 0.25 M sucrose, 50 mM Hepes (pH 7.4), and protease inhibitors, followed by centrifugation (10 min at 15,000 × g). Lysate samples of 30 µl were incubated in an assay mixture (total of 120 µl) containing 50 mM Tris-HCl (pH 7.5), 10 mM NaF, 10 mM MgCl2, 1 mM dithiothreitol, 1 mM phosphatidylserine, 1 mM deoxycholate, and 1 mM DG or ceramide as substrate. The reaction (10 min at 30 °C) was started by the addition of [gamma -32P]ATP (2 mM, 3 µCi) and terminated by thoroughly mixing 100 µl of assay mixture with 3.7 ml of methanol, chloroform, and 2 M NaCl (2:1:0.7, v/v/v). After the addition of 1 ml of chloroform and 1 ml of 2 M NaCl and phase separation, radiolabeled reaction product (PA or ceramide 1-phosphate) in the chloroform phase was separated by TLC (Silica Gel 60 plates, Merck) with ethyl acetate/isooctane/acetic acid/H2O (13:2:3:10, v/v/v/v) as developing solvent (two runs), scraped off, and quantitated by liquid scintillation counting.

Other Methods

COS-7 cells were transfected using the calcium phosphate precipitation method (31). SDS-polyacrylamide gel electrophoresis was performed with 8% acrylamide gels (32). Protein concentration was determined by the Bradford assay (33).


RESULTS

Isolation of cDNA Clones

We have previously purified a 110-kDa DGK protein from rat brain cytosol (34). To clone the corresponding cDNA, 100 µg of this protein was applied to a preparative SDS-polyacrylamide gel and transferred to nitrocellulose membrane. The 110-kDa region was cut out and digested with lysyl endopeptidase, and some of the generated peptides were sequenced (see "Experimental Procedures"). Based on the amino acid sequences, oligonucleotide probes were designed to screen a lambda gt10 rat brain cDNA library. A 2-kb positive clone was isolated. Sequence analysis showed a single open reading frame of 965 bp containing a stop codon, but no start codon. Three of the sequenced peptides were localized, and comparison with other DGKs revealed that this clone encoded part of the putative catalytic domain. We used a 400-bp 5'-PstI fragment of this 2-kb rat cDNA to screen a human fetal brain cDNA library. Four positive clones of 1.2, 3, 5, and 6 kb were isolated (Fig. 1). From restriction enzyme analysis, it appeared that they represented four overlapping cDNAs. Sequencing of these human clones revealed an open reading frame of 2646 bp encoding 882 amino acids with a sequence 90% identical to that of the rat homologue (data not shown). Since the start codon was lacking, we continued by screening a human retina cDNA library using a 1.7-kb EcoRI-KpnI fragment from the partial human DGK cDNA as a probe (Fig. 1). An additional 1.4-kb cDNA clone was isolated that overlapped the already obtained sequence, extending to the 5'-end and containing a putative ATG start codon. The composite full-length cDNA and its deduced amino acid sequence are shown in Fig. 2.


Fig. 1. Cloning strategy of human DGKtheta . Thick lines denote the cDNA clones isolated (i.e. 2 kb from rat brain; 1.2, 3, 5, and 6 kb from human fetal brain; and 1.4 kb from human retina). Arrows indicate the extent and direction of sequencing of the different clones. To obtain the full-length human DGKtheta cDNA, a human fetal brain cDNA library was first screened using the indicated PstI-PstI probe. Subsequently, a human retina cDNA library was screened using the indicated human EcoRI-KpnI probe. A schematic representation of the full-length DGKtheta primary structure is given, showing its prominent domains. PR, proline- and glycine-rich domain; Cat, catalytic domain.
[View Larger Version of this Image (12K GIF file)]



Fig. 2. Nucleotide and deduced amino acid sequences of human DGKtheta cDNA. Amino acids are numbered starting from the first methionine residue. The proline- and glycine-rich domain is indicated in boldface italics. The three CRDs, including a 12-amino acid conserved C-terminal extension of CRD3 (see Fig. 3 (A and C)), are shaded. The PH domain is underlined. The most conserved residues of the RA domain are indicated in boldface and are shaded. The putative catalytic domain is double-underlined. The stop codon is indicated by an asterisk.
[View Larger Version of this Image (115K GIF file)]


Sequence Analysis

The nucleotide sequence contains an ATG/methionine start codon (CGGGAG) that conforms reasonably to the Kozak consensus sequence (CCA/GCCG) for efficient initiation of translation (35). Downstream of this initiation codon is a single open reading frame of 2823 bp. The encoded protein, named DGKtheta , is a new member of the DGK family. It has a calculated molecular mass of 101.3 kDa, close to the apparent size of 110 kDa found for the purified protein (34).

Fig. 3A schematically shows the types and positions of conserved domains in DGKtheta compared with a few other representative DGKs. DGKtheta has a putative catalytic domain similar to all other known DGK isotypes, but does not have the N-terminal conserved domain and EF-hand (Ca2+-binding) motifs that are present in the classical isozymes DGKalpha , -beta , and -gamma . DGKtheta has a proline- and glycine-rich region at the N terminus. It also contains a recently identified putative Ras-binding site, the so-called RA domain (Val397-Val488) (27),2 which partially overlaps a PH domain (Lys399-Arg564). Fig. 3B shows the amino acid sequence of the PH domain of DGKtheta aligned with those of a few other proteins including DGKdelta (22) as well as with the published PH consensus sequence based on 71 different PH domains (36). Seven of the eight most conserved, almost completely identical (hydrophobic) residues (marked by asterisks in Fig. 3B) are indeed present in the DGKtheta PH domain. The eighth one, a tryptophan in block 6B, is replaced in DGKtheta by a similar residue, tyrosine (Fig. 3B). The overall identity/similarity of residues in the six blocks of the PH domain of DGKtheta to those in the consensus sequence amounts to 23/46%, respectively.


Fig. 3. Sequence comparison of DGKtheta domains with a few other DGK isotypes and other PH domain-containing proteins. A, schematic representation of the conserved domains in DGKtheta compared with two other human isotypes, DGKalpha and DGKdelta . The sizes of the proteins are also indicated by the number of amino acids (a.a). PR, proline- and glycine-rich domain; Cat, catalytic domain. B, amino acid sequence of the PH domain of DGKtheta aligned with that of dynamin (37), Tiam-1 (38), and DGKdelta (22). Identical and similar residues are in black boxes and gray boxes, respectively. Groups of similar amino acids are defined elsewhere (22, 36). The consensus lists the most frequent residues in the alignment of 71 different PH domain sequences (36). The most conserved (almost exclusive) residues are marked by asterisks. Conserved blocks are underlined and numbered from 1 to 6. Large nonconserved insertions have been removed, and the number of missing residues is given (n). C, amino acid sequence alignment of the three CRDs of DGKtheta with the two CRDs of human DGKalpha and DGKdelta (16, 22). The conserved Cys/His core residues are in black boxes, whereas other conserved residues are in gray boxes. CRD3 of DGKtheta and CRD2 of other DGK isotypes (of which only DGKalpha and DGKdelta are shown) (15-23) contain conserved amino acids (marked by asterisks) that are specific for (this domain of) DGK. Note that this unique conserved region extends 12 amino acids beyond the C-terminal Cys of the CRD core structure. The numbers of the first and last amino acids of the respective domains are indicated. Dashes are amino acid gaps inserted to maximize alignment.
[View Larger Version of this Image (57K GIF file)]


A unique structural feature of DGKtheta is the presence of three CRDs (zinc fingers), starting at amino acids 60, 121, and 183, respectively (Figs. 2 and 3C). All other known DGK isotypes contain only two CRDs. Close inspection of the individual CRDs reveals that the third CRD (CRD3) of DGKtheta is most homologous to the second one (CRD2) of DGKalpha and DGKdelta (Fig. 3C) and other known DGK isotypes. The amino acid sequence of this domain, apart from its typical core structure (HXWX10CX2CX14CX2CX4HX2CX7C), contains an additional 13 conserved amino acids, 11 of which (marked by asterisks in Fig. 3C) are specifically present in the CRD2 domains of all known DGK isotypes (15-26). Interestingly, six of these conserved residues extend the core structure in the C-terminal direction (Fig. 3, A and C). Klauck et al. (23) already described that the end of CRD2 in previously cloned DGKs is defined by GX7PP, but we note that there is actually much more homology and DGK specificity in CRD2 (or DGKtheta CRD3) (Fig. 3C). CRD1 and CRD2 of DGKtheta , on the other hand, do not at all show such DGK specificity. Although they have additional conserved amino acids next to the cysteine/histidine core structure, they share most of these conserved residues with other CRD-containing molecules, such as PKC (39) and Raf-1 (40). The homology between DGKtheta CRD2 and CRD3, apart from the typical cysteine/histidine core structure, is relatively low. CRD2 shows higher homology to CRD1.

Another conspicuous and novel feature of DGKtheta is the proline- and glycine-rich region near the N terminus (Figs. 2 and 3A). It contains 11 glycines (34%) and 9 prolines (28%) over a stretch of 32 amino acids. The first part of this region contains a pXPXXP motif (amino acids 18-23), typical for SH3 domain-binding sites (41), and is followed by a proline-glycine tandem repeat (amino acids 37-45), the function of which is undefined.

Tissue Distribution of DGKtheta mRNA

The expression of DGKtheta in rat tissues was determined at the mRNA level by reverse transcriptase PCR. Fig. 4 shows that DGKtheta is expressed in the brain and, to a lesser extent, in the small intestine, duodenum, and liver.


Fig. 4. Tissue distribution of DGKtheta mRNA. Total RNA from different rat tissues was reverse-transcribed to cDNA. One-twentieth of this cDNA product was used in 25 cycles of PCR amplification with two rat DGKtheta -specific primers and two glyceraldehyde-phosphate dehydrogenase (GAPDH)-specific primers as controls. The expected lengths of the DGKtheta and glyceraldehyde-phosphate dehydrogenase products are 850 and 400 bp, respectively. One-tenth of the PCR product was separated on an agarose gel and blotted onto nylon membrane. Amplification products were detected using 32P-labeled cDNA probes from rat DGKtheta and glyceraldehyde-phosphate dehydrogenase, respectively.
[View Larger Version of this Image (36K GIF file)]


In situ hybridization histochemical analysis in adult rat brain reveals that mRNA for DGKtheta is expressed more or less in all the gray matter regions, but not in white matter (Fig. 5A). Expression is most intense in the cerebellar cortex and hippocampus, while moderate expression is seen in the olfactory bulb neuronal layers and brain stem nuclei. In the cerebellar cortex, the hybridization signals are deposited equally in both the Purkinje cell somata and the granule cells at the same intensity (Fig. 5, B and C). In control experiments in which brain sections were hybridized with the plasmid vector of an appropriate length, no significant hybridization signals were detected in any brain sections (data not shown).


Fig. 5. In situ hybridization of DGKtheta mRNA in rat brain. A, dark-field micrograph of sagittal-sectioned brain of adult rat (magnification × 6). Note the intense expression in the cerebellar cortex and hippocampus and the more or less moderate expression throughout the gray matter. C, cerebellum; Cx, cerebral cortex; H, hippocampus; O, olfactory bulb; S, striatum; T, thalamus. B and C, bright-field and dark-field micrographs of the cerebellum, respectively (magnification × 130). Positive hybridization signals are present in the Purkinje cells (arrowheads) as well as in the granule cells (g). m, molecular layer.
[View Larger Version of this Image (159K GIF file)]


Expression of DGKtheta in COS Cells and Its Enzymatic Activity

To test whether the cloned DGKtheta cDNA indeed encodes a DGK, the protein was transiently expressed in COS cells by cDNA transfection. Proper expression was confirmed by Western blotting using a DGKtheta -directed monoclonal antibody (Fig. 6). The antibody detected a protein of the correct size (110 kDa), indicating that the putative ATG start codon present in the DGKtheta cDNA is indeed used as a translation start codon. The antibody cross-reacted with overexpressed 86-kDa DGKalpha that was used as a positive control. A lysate of vector-transfected cells (control) showed no immunoreactivity (Fig. 6).


Fig. 6. Expression of DGKtheta protein. COS cells were transfected with cDNA of human DGKtheta , human DGKalpha (16), or the empty pmtSM vector as indicated. Two days later, cells were harvested and lysed. DGK proteins were visualized by Western blotting using a monoclonal antibody against a C-terminal epitope of rat DGKtheta , followed by enhanced chemiluminescence.
[View Larger Version of this Image (32K GIF file)]


DGK activity was subsequently assayed in the respective COS cell lysates. Table I shows that the expressed DGKtheta is indeed active as a DGK. Similar to DGKalpha , the new DGKtheta exhibits the highest activity toward 1,2-dioleoyl-sn-glycerol and 1-stearoyl-2-arachidonoyl-sn-glycerol. In contrast, ceramide, 1,3-dioleoyl-sn-glycerol, and monoacylglycerol are relatively poor substrates.

Table I.

Activity of DGK isozymes expressed in COS cells

Two days after COS cell transfection with cDNA of human DGKtheta , human DGKalpha , or empty vector (pmtSM), cell lysates were assayed for DG kinase activity, as described under "Experimental Procedures," with the substrates indicated. Data are means of duplicates and are representative of three independent experiments.


Substrate Substrate phosphorylation
pmtSM vector DGKalpha DGKtheta

nmol/mg protein/min
1,2-Dioleoyl-sn-glycerol 1.6  ± 0.2 47.7  ± 4.7 28.1  ± 0.2
1-Stearoyl-2-arachidonoyl-sn-glycerol 1.4  ± 0.1 34.8  ± 3.4 21.0  ± 0.0
1,3-Dioleoyl-sn-glycerol 0.03  ± 0.01 0.29  ± 0.08 0.44  ± 0.01
1-Monooleoyl-rac-glycerol 0.01  ± 0.00 0.07  ± 0.03 0.05  ± 0.00
Ceramide 0.04  ± 0.00 0.15  ± 0.01 0.26  ± 0.04


DISCUSSION

With the molecular cloning of DGKtheta , we add a new member to the growing family of DGKs (15-26). DGKtheta is structurally different from the previously characterized DGK isotypes and contains unique features, such as three (instead of two) CRDs, a proline- and glycine-rich region, and a recently identified RA domain (27). No other DGK isotype, except a putative DGK in Caenorhabditis elegans (42), contains such an RA domain (27). This implies that DGKtheta is a potential new effector of one or more of the Ras-like small GTP-binding proteins. The RA domain is located within a PH domain. DGKdelta (22) and DGKeta (23) also possess a PH domain, but it is differently (centrally) located in the molecule and is without an RA domain. The finding that a Ras-binding site coincides with another functional domain is not unique. In Raf-1, for example, a Ras-binding site (different from the RA domain) has been detected in its CRD (43). Analogous to this Raf-1 CRD, the PH/RA region in DGKtheta might play a multifunctional role, i.e. binding to a Ras-like small G protein and to another, PH domain-binding molecule. In general, PH domains are believed to function in protein-protein interactions among cytoskeletal and other signaling molecules (36). For example, they may interact with beta gamma -complexes of heterotrimeric G proteins (44) and with protein kinase C (45). In addition, PH domains can bind polyphosphoinositides (46-49). All these molecules, involved in signaling, are located in or at the membrane and may thus potentially be involved in proper membrane relocation and subsequent activation of DGKtheta . Enzymatic activity may be further regulated through phosphorylation, e.g. by PKC, as we have previously found for DGKalpha in vivo (50). DGKtheta contains six potential PKC phosphorylation sites (51) at amino acids 240, 260, 294, 311, 317, and 363 in an alanine- and glycine-rich region between CRD3 and the PH domain. It would be interesting to investigate whether DGKtheta activity in cells is regulated by phosphorylation through interaction of its PH domain with an activated PKC, as found for Bruton tyrosine kinase (45).

The presence of three CRDs is unique to DGKtheta . All other known DGK isotypes contain only two CRDs. In fact, no other protein has been described to contain three such domains. Most PKC isotypes, except the atypical ones, have two CRDs (39), while various other signaling proteins such as Raf isotypes (40, 43), Vav (52), and n-chimaerin (53) have only one CRD. While CRDs in these proteins are generally thought to mediate protein-protein interaction as well as to bind to acidic phospholipids in membranes (43, 54), those in the classical and "new" PKCs are also known to bind phorbol ester and DG (54). However, we found that DGKalpha and DGKtheta do not bind phorbol esters (data not shown).

All CRDs typically contain the Cys6/His2 core structure with defined spacing, which is important for binding of zinc in a tetrahedral geometry (55). Between these core residues, however, the primary sequence (inter-Cys sequence) varies according to the type of protein. In DGKtheta , the inter-Cys sequence of CRD3 is homologous to that of CRD2 in other DGKs, but quite distinct from CRD1 domains and DGKtheta CRD2, which are more homologous to CRDs of PKC (39) and Raf-1 (40). Most interesting, within the CRD2/DGKtheta CRD3 group, the sequence homology extends 12 amino acids C-terminally beyond the last core cysteine. Together with additional conserved amino acids within the inter-Cys sequence, it makes this structure very typical and specific for DGKs and different from CRDs of PKC (39) and Raf-1 (40). While the function of the three CRDs in DGKtheta or the two CRDs in DGKs in general is unknown, we found that deletion of the CRDs in DGKalpha inactivates the enzyme.3 It is therefore tempting to speculate that the CRDs, particularly the "extended" most C-terminal one, are somehow involved in DG binding and/or presentation to the catalytic domain.

The proline- and glycine-rich region near the N terminus of DGKtheta is intriguing. It includes a pXPXXP motif, which is characteristic of SH3 domain-binding proteins (41). We found this motif also in DGKepsilon (21) and DGKzeta (24) (likewise near the N terminus), but not in other DGKs. Whether DGKtheta , -epsilon , and -zeta actually bind to SH3 domains of other proteins remains to be demonstrated. A little downstream from this motif, DGKtheta also contains a conspicuous proline-glycine tandem repeat. Data base screening revealed one other protein, a DNA-binding regulatory factor, RFX5 (56), with such a motif. The precise function of this (PG)n domain is unknown. It may induce a loop or turn in the three-dimensional structure of DGKtheta , which is important for proper folding of the molecule, or it might be involved in protein-protein interaction.

The (putative) catalytic domain of DGKtheta is homologous (62%) to that in other DGKs and is contiguous, as in all DGKs except DGKdelta and DGKeta (22, 23), where it is separated into two subdomains (Fig. 3A). Although a protein kinase ATP-binding motif was found in the catalytic domain of several DGK isotypes, such a motif is not present in DGKtheta and DGKdelta (22). In fact, based on mutational analysis of DGKalpha , we have previously argued that the consensus sequence for ATP-binding sites in protein kinases does not apply to DGKs (57).

The substrate specificity of DGKtheta is not much different from that of most other DGK isotypes. The activity of DGKtheta is optimal toward DG with an unsaturated fatty acid at the sn-2 position, but is not specific for arachidonoyldiacylglycerol, as has been found for DGKs in the testis (21, 58).

DGKtheta shows a narrow tissue distribution, as do other DGK isotypes except DGKeta (24). Expression of DGKtheta mRNA is highest in the brain, as was also found for DGKalpha , -beta , -gamma , and -zeta , but not for DGKdelta (skeletal muscle) (22) and DGKepsilon (testis) (21). In situ hybridization revealed the highest DGKtheta mRNA levels in the cerebellum and hippocampus. Compared with DGKgamma (DGK-III), which is also dominantly expressed in the cerebellum, most strongly in Purkinje cells (20), DGKtheta shows a wider expression in gray matter and a more equal expression in Purkinje and granule cells (Fig. 5).

Very little is known about the detailed function of DGK in signal transduction. The substantial sequence (domain) diversity among DGK family members, however, suggests their physiological importance and their unique functions in distinct signaling pathways. The finding of several distinct structural and functional domains in DGKtheta may help to discover in which signaling pathway(s) this isozyme operates.


FOOTNOTES

*   This work was supported by the Dutch Cancer Society and by the Netherlands Organization for Scientific Research.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) L38707[GenBank].


§   Contributed equally to this work.
   Present address: Dept. of Parasitology, Intervet International, P. O. Box 31, 5830 AA Boxmeer, The Netherlands.
Dagger Dagger    To whom correspondence should be addressed. Tel.: 31-20-5121976; Fax: 31-20-5121989; E-mail: wblit{at}nki.nl.
1   The abbreviations used are: DGK, diacylglycerol kinase; DG, diacylglycerol; PA, phosphatidic acid; PKC, protein kinase C; CRD, cysteine-rich domain; PH domain, pleckstrin homology domain; RA domain, Ras-associating domain; kb, kilobase pair(s); bp, base pair(s); PCR, polymerase chain reaction.
2   In Ref. 27, our human DGKtheta was listed as DAGK_h.
3   D. Schaap, J. van der Wal, and W. J. van Blitterswijk, unpublished data.

REFERENCES

  1. Kanoh, H., Yamada, K., and Sakane, F. (1990) Trends Biochem. Sci. 15, 47-50 [CrossRef][Medline] [Order article via Infotrieve]
  2. Kanoh, H., Sakane, F., Imai, S.-I., and Wada, I. (1993) Cell. Signalling 5, 495-503 [CrossRef][Medline] [Order article via Infotrieve]
  3. van Blitterswijk, W. J., Schaap, D., and van der Bend, R. L. (1994) Curr. Top. Membr. 40, 413-437
  4. Nishizuka, Y. (1984) Nature 308, 693-698 [CrossRef][Medline] [Order article via Infotrieve]
  5. Exton, J. H. (1994) Biochim. Biophys. Acta 1212, 26-42 [Medline] [Order article via Infotrieve]
  6. English, D. (1996) Cell. Signalling 8, 341-347 [CrossRef][Medline] [Order article via Infotrieve]
  7. Limatola, C., Schaap, D., Moolenaar, W. H., and van Blitterswijk, W. J. (1994) Biochem. J. 304, 1001-1008
  8. McPhail, L. C., Qualliotine-Mann, D., and Waite, K. A. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 7931-7935 [Abstract/Free Full Text]
  9. Khan, W. A., Blobe, G. C., Richards, A. L., and Hannun, Y. A. (1994) J. Biol. Chem. 269, 9729-9735 [Abstract/Free Full Text]
  10. Jones, G. A., and Carpenter, G. (1993) J. Biol. Chem. 268, 20845-20850 [Abstract/Free Full Text]
  11. Moritz, A., De Graan, P. N. E., Gispen, W. H., and Wirtz, K. W. A. (1992) J. Biol. Chem. 267, 7207-7210 [Abstract/Free Full Text]
  12. Jenkins, G. H., Fisette, P. L., and Anderson, R. A. (1994) J. Biol. Chem. 269, 11547-11554 [Abstract/Free Full Text]
  13. Ghosh, S., Strum, J. C., Sciorra, V. A., Daniel, L., and Bell, R. M. (1996) J. Biol. Chem. 271, 8472-8480 [Abstract/Free Full Text]
  14. Zhao, Z., Shen, S.-H., and Fischer, E. H. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 4251-4252 [Abstract/Free Full Text]
  15. Sakane, F., Yamada, K., Kanoh, H., Yokoyama, C., and Tanabe, T. (1990) Nature 344, 345-348 [CrossRef][Medline] [Order article via Infotrieve]
  16. Schaap, D., de Widt, J., van der Wal, J., Vandekerckhove, J., van Damme, J., Gussow, D., Ploegh, H. L., van Blitterswijk, W. J., and van der Bend, R. L. (1990) FEBS Lett. 275, 151-158 [CrossRef][Medline] [Order article via Infotrieve]
  17. Goto, K., Watanabe, M., Kondo, H., Yuasa, H., Sakane, F., and Kanoh, H. (1992) Mol. Brain Res. 16, 75-87 [Medline] [Order article via Infotrieve]
  18. Goto, K., and Kondo, H. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 7598-7602 [Abstract/Free Full Text]
  19. Kai, M., Sakane, F., Imai, S., Wada, I., and Kanoh, H. (1994) J. Biol. Chem. 269, 18492-18498 [Abstract/Free Full Text]
  20. Goto, K., Funayama, M., and Kondo, H. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 13042-13046 [Abstract/Free Full Text]
  21. Tang, W., Bunting, M., Zimmerman, G. A., McIntyre, T. M., and Prescott, S. M. (1996) J. Biol. Chem. 271, 10237-10241 [Abstract/Free Full Text]
  22. Sakane, F., Imai, S., Kai, M., Wada, I., and Kanoh, H. (1996) J. Biol. Chem. 271, 8394-8401 [Abstract/Free Full Text]
  23. Klauck, T. M., Xu, X., Mousseau, B., and Jaken, S. (1996) J. Biol. Chem. 271, 19781-19788 [Abstract/Free Full Text]
  24. Bunting, M., Tang, W., Zimmerman, G. A., McIntyre, T. M., and Prescott, S. M. (1996) J. Biol. Chem. 271, 10230-10236 [Abstract/Free Full Text]
  25. Goto, K., and Kondo, H. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 11196-11201 [Abstract/Free Full Text]
  26. Masai, I., Okazaki, A., Hosoya, T., and Hotta, Y. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 11157-11161 [Abstract/Free Full Text]
  27. Ponting, C. P., and Benjamin, D. R. (1996) Trends Biochem. Sci. 21, 422-425 [CrossRef][Medline] [Order article via Infotrieve]
  28. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  29. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 5463-5468 [Abstract/Free Full Text]
  30. Devereux, L., Haeberli, P., and Smithies, O. (1984) Nucleic Acids Res. 12, 387-395
  31. Graham, F. L., and van der Eb, A. J. (1983) Virology 54, 536-539
  32. Laemmli, U. K. (1970) Nature 227, 680-685 [CrossRef][Medline] [Order article via Infotrieve]
  33. Bradford, M. M. (1976) Anal. Biochem. 72, 248-254 [CrossRef][Medline] [Order article via Infotrieve]
  34. Kato, M., and Takenawa, T. (1990) J. Biol. Chem. 265, 794-800 [Abstract/Free Full Text]
  35. Kozak, M. (1987) Nucleic Acids Res. 15, 8125-8148 [Abstract/Free Full Text]
  36. Gibson, T. B., Hyvönen, M., Musacchio, A., Saraste, M., and Birney, E. (1994) Trends Biochem. Sci. 19, 349-353 [CrossRef][Medline] [Order article via Infotrieve]
  37. Obar, R. A., Collins, C. A., Hammarback, J. A., Shpetner, H. S., and Vallee, R. B. (1990) Nature 347, 256-261 [CrossRef][Medline] [Order article via Infotrieve]
  38. Habets, G. G. M., Scholtes, E. H. M., Zuydgeest, D., van der Kammen, R. A., Stam, J. C., Berns, A., and Collard, J. G. (1994) Cell 77, 537-549 [CrossRef][Medline] [Order article via Infotrieve]
  39. Ono, Y., Fujii, T., Igarashi, K., Kikkawa, U., Ogita, K., and Nishizuka, Y. (1988) Nucleic Acids Res. 16, 5199-5200 [Free Full Text]
  40. Bonner, T. I., Oppermann, H., Seeburg, P., Kerby, S. B., Gunnell, M. A., Young, A. C., and Rapp, U. R. (1986) Nucleic Acids Res. 14, 1009-1015 [Abstract/Free Full Text]
  41. Yu, H., Chen, J. K., Feng, S., Dalgarno, D. C., Brauer, A. W., and Schreiber, S. L. (1994) Cell 76, 933-945 [CrossRef][Medline] [Order article via Infotrieve]
  42. Wilson, R., Ainscough, R., Anderson, K., et al. (1994) Nature 368, 32-38 [CrossRef][Medline] [Order article via Infotrieve]
  43. Ghosh, S., Xie, W. Q., Quest, A. F. G., Mabrouk, G. M., Strum, J. C., and Bell, R. M. (1994) J. Biol. Chem. 269, 10000-10007 [Abstract/Free Full Text]
  44. Inglese, J., Koch, W. J., Touhara, K., and Lefkowitz, R. J. (1995) Trends Biochem. Sci. 20, 151-156 [CrossRef][Medline] [Order article via Infotrieve]
  45. Yao, L., Kawakami, Y., and Kawakami, T. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 9175-9179 [Abstract/Free Full Text]
  46. Harlan, J. E., Hajduk, P. J., Yoon, H. S., and Fesik, S. W. (1994) Nature 371, 168-170 [CrossRef][Medline] [Order article via Infotrieve]
  47. Pitcher, J. A., Touhara, K., Payne, E. S., and Lefkowitz, R. J. (1995) J. Biol. Chem. 270, 11707-11710 [Abstract/Free Full Text]
  48. Ferguson, K. M., Lemmon, M. A., Schlessinger, J., and Sigler, P. B. (1995) Cell 83, 1037-1046 [CrossRef][Medline] [Order article via Infotrieve]
  49. Franke, T. F., Yang, S., Chan, T. O., Datta, K., Kazlauskas, A., Morrison, D. K., Kaplan, D. R., and Tsichlis, P. N. (1995) Cell 81, 727-736 [CrossRef][Medline] [Order article via Infotrieve]
  50. Schaap, D., van der Wal, J., van Blitterswijk, W. J., van der Bend, R. L., and Ploegh, H. L. (1993) Biochem. J. 289, 875-881
  51. Pearson, R, B., and Kemp, B. E. (1991) Methods Enzymol. 200, 62-77 [Medline] [Order article via Infotrieve]
  52. Coppola, J., Bryant, S., Koda, T., Conway, D., and Barbacid, M. (1991) Cell Growth & Differ. 2, 95-105 [Abstract]
  53. Hall, C., Monfries, C., Smith, P., Lim, H. H., Kozma, R., Armed, S., Vannaisigham, V., Leung, T., and Lim, L. (1990) J. Mol. Biol. 211, 11-16 [CrossRef][Medline] [Order article via Infotrieve]
  54. Quest, A. F. G., Bardes, E. S. G., and Bell, R. M. (1994) J. Biol. Chem. 269, 2953-2960 [Abstract/Free Full Text]
  55. Schwabe, J. W. R., and Klug, A. (1994) Nat. Struct. Biol. 1, 345-349 [CrossRef][Medline] [Order article via Infotrieve]
  56. Steimle, V., Durand, B., Barras, E., Zufferey, M., Hadam, M. R., Mach, B., and Reith, W. (1995) Genes Dev. 9, 1021-1032 [Abstract/Free Full Text]
  57. Schaap, D., van der Wal, J., and van Blitterswijk, W. J. (1994) Biochem. J. 304, 661-662
  58. Walsh, J. P., Suen, R., Lemaitre, R. N., and Glomset, J. A. (1994) J. Biol. Chem. 269, 21155-21164 [Abstract/Free Full Text]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
E. Merino, M. A. Sanjuan, I. Moraga, A. Cipres, and I. Merida
Role of the Diacylglycerol Kinase {alpha}-Conserved Domains in Membrane Targeting in Intact T Cells
J. Biol. Chem., November 30, 2007; 282(48): 35396 - 35404.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
D. Li, A. N. Urs, J. Allegood, A. Leon, A. H. Merrill Jr., and M. B. Sewer
Cyclic AMP-Stimulated Interaction between Steroidogenic Factor 1 and Diacylglycerol Kinase {theta} Facilitates Induction of CYP17
Mol. Cell. Biol., October 1, 2007; 27(19): 6669 - 6685.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Matsubara, Y. Shirai, K. Miyasaka, T. Murakami, Y. Yamaguchi, T. Ueyama, M. Kai, F. Sakane, H. Kanoh, T. Hashimoto, et al.
Nuclear Transportation of Diacylglycerol Kinase {gamma} and Its Possible Function in the Nucleus
J. Biol. Chem., March 10, 2006; 281(10): 6152 - 6164.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S.-i. Imai, M. Kai, S. Yasuda, H. Kanoh, and F. Sakane
Identification and Characterization of a Novel Human Type II Diacylglycerol Kinase, DGK{kappa}
J. Biol. Chem., December 2, 2005; 280(48): 39870 - 39881.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. C. Gomez-Merino, F. A. Arana-Ceballos, L. I. Trejo-Tellez, A. Skirycz, C. A. Brearley, P. Dormann, and B. Mueller-Roeber
Arabidopsis AtDGK7, the Smallest Member of Plant Diacylglycerol Kinases (DGKs), Displays Unique Biochemical Features and Saturates at Low Substrate Concentration: THE DGK INHIBITOR R59022 DIFFERENTIALLY AFFECTS AtDGK2 AND AtDGK7 ACTIVITY IN VITRO AND ALTERS PLANT GROWTH AND DEVELOPMENT
J. Biol. Chem., October 14, 2005; 280(41): 34888 - 34899.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
R. Fukunaga-Takenaka, Y. Shirai, K. Yagi, N. Adachi, N. Sakai, E. Merino, I. Merida, and N. Saito
Importance of chroman ring and tyrosine phosphorylation in the subtype-specific translocation and activation of diacylglycerol kinase {alpha} by D-{alpha}-tocopherol
Genes Cells, April 1, 2005; 10(4): 311 - 319.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. van Baal, J. de Widt, N. Divecha, and W. J. van Blitterswijk
Translocation of Diacylglycerol Kinase {theta} from Cytosol to Plasma Membrane in Response to Activation of G Protein-coupled Receptors and Protein Kinase C
J. Biol. Chem., March 18, 2005; 280(11): 9870 - 9878.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. M. Jose and M. R. Koelle
Domains, Amino Acid Residues, and New Isoforms of Caenorhabditis elegans Diacylglycerol Kinase 1 (DGK-1) Important for Terminating Diacylglycerol Signaling in Vivo
J. Biol. Chem., January 28, 2005; 280(4): 2730 - 2736.
[Abstract] [Full Text] [PDF]