JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Obama, H.
Right arrow Articles by Ozawa, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Obama, H.
Right arrow Articles by Ozawa, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 17, Issue of April 25, 1997 pp. 11017-11020
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Identification of the Domain of alpha -Catenin Involved in Its Association with beta -Catenin and Plakoglobin (gamma -Catenin)*

(Received for publication, May 21, 1996, and in revised form, December 9, 1996)

Hiroya Obama and Masayuki Ozawa Dagger

From the Department of Biochemistry, Faculty of Medicine, Kagoshima University, 8-35-1 Sakuragaoka, Kagoshima 890, Japan

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

alpha -Catenin is a 102-kDa protein exhibiting homology to vincuin, and it forms complexes with cadherins or the tumor-suppressor gene product adenomatous polyposis coli through binding to beta -catenin or plakoglobin (gamma -catenin). The incorporation of alpha -catenin into the cadherin-catenin complexes is a prerequisite for expression of the cell-adhesive activity of cadherins. Using an in vitro assay system involving bacterially expressed proteins, we localized a region in alpha -catenin required for molecular interaction with beta -catenin and plakoglobin. Analysis of various truncated alpha -catenin molecules revealed that amino-terminal residues 48-163 are able to bind to beta -catenin and plakoglobin. Consistent with the observation that beta -catenin and plakoglobin bind to the same region of alpha -catenin, beta -catenin competed with the binding of plakoglobin to alpha -catenin and vice versa. Under the conditions used, beta -catenin bound to alpha -catenin with higher affinity than did plakoglobin. Scatchard analysis indicated that the affinity of the interaction between alpha -catenin and beta -catenin or that between alpha -catenin and plakoglobin was moderately strong (Kd = 3.8 × 10-8 and 7.7 × 10-8, respectively). When transfected into L cells expressing E-cadherin, the amino-terminal region of alpha -catenin (from residue 1 to 226) formed complexes with beta -catenin supporting the in vitro binding experiment results.


INTRODUCTION

Cadherins are a major group of calcium-dependent cell-cell adhesion molecules that bind through a homophilic mechanism and that are localized to specialized intercellular junctions called adherens junctions (1, 2). The cadherins are transmembrane proteins possessing an extracellular calcium-binding segment and an intracellular domain that is highly conserved (-90% identity) among most members of the family. Deletion of the conserved intracellular segment results in cadherin inactivation even if the extracellular binding domain seems to remain intact (3). The cytoplasmic domain of cadherins interacts with three molecules termed catenins (alpha , beta , and gamma ), and the resultant complexes seem to associate with cortical actin filaments (4). This interaction between cadherins and catenins is essential for cadherin-mediated adhesion and the association of the complexes with the cytoskeleton (5-7).

Two of the catenins have been cloned. alpha -Catenin is homologous to vinculin, a cytoskeleton-associated protein (8, 9). beta -Catenin is homologous to plakoglobin (a protein found in both adherens junctions and desmosomes) and Armadillo (a segment polarity gene product in Drosophila melanogaster (10-13)). Immunological data suggest that gamma -catenin is identical to plakoglobin (14, 15).

Recent in vitro and in vivo experiments have shown that beta -catenin and plakoglobin bind directly to the cytoplasmic domain of E-cadherin, while alpha -catenin binds directly to beta -catenin or plakoglobin (16-20). The amino-terminal parts of beta -catenin and plakoglobin have been shown to comprise their alpha -catenin-binding sites, and the central core region, which is composed of 13 copies of the so-called Armadillo repeat, is involved in the association with cadherins. The latter is also involved in the complex formation with the adenomatous polyposis coli tumor-suppressor protein and in the case of plakoglobin, with desmogleins (desmosomal cadherins). The region of alpha -catenin responsible for beta -catenin and plakoglobin binding, however, had not been identified. In this study, we report experiments that revealed the region in human alpha -catenin responsible for the binding of beta -catenin and plakoglobin.


MATERIALS AND METHODS

Expression of alpha -Catenin as a Fusion Protein with the Maltose-binding Protein

A full-length cDNA clone for human alpha -catenin has been described (20). To express alpha -catenin as a fusion protein with the maltose-binding protein (MBP)1 in Escherichia coli cells, cDNA encoding the protein was cloned into an MBP fusion vector (pMALc, New England Biolabs Inc.). cDNA fragments encoding various regions of alpha -catenin were generated by using convenient restriction enzyme sites within the cDNA clones or by means of the polymerase chain reaction. The combinations of restriction enzymes used were: BglII and SalI, BglII and HindIII, MluI and SalI, BglII and StuI, BglII and SphI, BglII and XhoI, BglII and ApaI, XbaI and SphI, ApaI and SphI, and XhoI and SphI. For the polymerase chain reaction, three sense primers (5'GAAGATCTTCTAATAAGAAGAGAGG, 5'GAAGATCTAAAATTGCGAAGGAG, and 5'GAAGATCTGAGTTCGCAGATGAT) and two antisense primers (5'GAAAGCTTCAAGATACCATCTTC and 5'GAAAGCTTGCCAACATCTTTCAA) containing a BglII or HindIII recognition sequence at the 5'-end, respectively, were used. The reaction mixture was subjected to 30 cycles of denaturation (93 °C, 1 min), annealing (45 °C, 1 min), and extension (72 °C, 1 min). The cDNA fragments were subcloned in frame into the vector, and the plasmid DNAs were introduced into JM109 cells. MBP fusion proteins were purified by affinity chromatography on columns of amylose resin (New England Biolabs Inc.) as described previously (20).

Expression of beta -Catenin and Plakoglobin as Fusion Proteins with Glutathione S-Transferase or MBP

The cDNA clones for human plakoglobin and beta -catenin have been described (20, 21). The full-length beta -catenin cDNA with a BamHI 5'-3' SalI orientation in Bluescript II KS(+) vector was excised by digestion with BamHI and SalI and then cloned into the BamHI/SalI sites of the glutathione S-transferase (GST) fusion protein (pGEX-4T3, Pharmacia Biotech Inc.) vectors. The GST fusion protein vectors containing cDNA for the entire coding region of plakoglobin have been described (20).

Nitrocellulose Blot Overlay Assay

The binding of GST fusion proteins to MBP fusion proteins was visualized as follows. Purified MBP fusion proteins (50 ng) were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then electroblotted onto nitrocellulose filters as described previously (20). The filters were incubated in phosphate-buffered saline containing 5% nonfat dried milk for 30 min and with GST fusion proteins (100 µg/ml) for 2 h. The filters were then washed with phosphate-buffered saline containing 0.05% Tween 20. The MBP fusion proteins bound to proteins on the filters were detected by incubation with affinity-purified anti-GST antibodies followed by horseradish peroxidase-labeled F(ab')2 fragments of goat anti-rabbit IgG (Jackson ImmunoResearch Laboratories, Inc.) and 4-chloro-1-naphthol as a substrate. For competitive binding assay of beta -catenin and plakoglobin, affinity-purified antibodies against beta -catenin or plakoglobin were used to detect the respective fusion protein bound to alpha -catenin. To quantify the binding, the peroxidase-labeled antibody was replaced by the 125I-labeled F(ab)2 fragment of goat anti-rabbit IgG (7.5 µCi/µg, DuPont NEN), and bound radioactivity was determined using a scintillation counter.

Antibodies

Rabbit antibodies against GST were prepared and purified as described previously (20). A monoclonal antibody against GST was purchased from Santa Cruz Biotechnology. Monospecific antibodies against the carboxyl-terminal part of plakoglobin or the full-length beta -catenin have been described previously (20, 21). A monoclonal antibody (12CA5) directed against hemagglutinin (HA) was kindly provided by Dr. A. Yoshimura (Kurume University, Fukuoka, Japan).

Scatchard Analysis of GST/beta -Catenin or GST/Plakoglobin Binding to alpha -Catenin

The alpha -catenin fusion proteins (10 µg) containing residues 1-906 (the entire protein, MBP/alpha -CN-(1-906) or residues 48-163 (MBP/alpha -CN-(48-163) were electroblotted onto nitrocellulose filters after SDS-PAGE. Each filter was incubated with varying concentrations (0-20 µg/ml) of GST/beta -catenin or GST/plakoglobin, and the bound GST/beta -catenin or GST/plakoglobin was detected by incubation with monoclonal anti-GST antibodies followed by the horseradish peroxidase-labeled F(ab')2 fragment of rabbit anti-mouse IgG. After washing, each filter was incubated for 2 min with orthophenylenediamine (0.4 mg/ml) in 0.1 M citric phosphate buffer, pH 5.0, containing 0.012% H2O2. The peroxidase reaction was stopped with 2 M sulfuric acid. The reaction was quantified by measuring the optical density at 492 nm.

Expression of the Amino-terminal Domain of alpha -Catenin in Cells

alpha -Catenin cDNA encoding the amino-terminal region (from residue 1 to 226) was subcloned in frame into a vector (BX-C-Flu, a gift from Dr. Yoshimura) containing a 9-amino acid HA sequence (YPYDVPDYA) using an oligonucleotide (5'AATTCGATATCGGC) as a linker. Thus the cDNA codes for truncated alpha -catenin (residues 1-226) and a sequence (EFDIA) followed by the HA tag sequence. The cDNA was cloned into the mammalian expression vector pCAGGS neo (a gift from Dr. K. Yamamura, Kumamoto University, Kumamoto, Japan), which contains an enhancer derived from cytomegalovirus and the beta -actin promoter (22) as described previously (21). A mouse L cell line expressing E-cadherin (EL-8) was established as described previously (4) and used for transient expression experiments. EL-8 cells (1 × 106) were transfected with an expression vector (pC-alpha CN1-226) by electroporation using a Bio-Rad Gene Pulser set at 700 V and 25 microfarads. After 48 h, the transfected cells were analyzed as described below. To isolate stable transfectants, Madin-Darby canine kidney cells (1 × 106) were transfected with pC-alpha CN1-226 as described above except that the voltage was set at 600 V. Stable transfectants were selected and cloned as described before (4). The cells were lysed in 10 mM Tris-HCl buffer, pH 7.5, containing 0.5% Nonidet P-40, 1 mM EDTA, and 1 mM phenylmethylsulfonyl fluoride. The truncated alpha -catenin with the HA tag was collected with the anti-HA monoclonal antibody 12CA5, which had been preabsorbed to protein A-Sepharose CL-4B. The immune complex was washed with a washing buffer (10 mM Tris-HCl, pH 7.5, 0.5% Nonidet P-40, 0.5 M NaCl, 1 mM phenylmethylsulfonyl fluoride).


RESULTS

Localization of the beta -Catenin-binding Site on alpha -Catenin Using alpha -Catenin Fusion Proteins

To localize the sites for beta -catenin and plakoglobin binding in alpha -catenin, different regions of the alpha -catenin molecule (Fig. 1) were expressed as maltose-binding protein (MBP) fusion proteins in E. coli and then purified to homogeneity by affinity chromatography on amylose resin. Each fusion protein migrated on an SDS-PAGE gel as a band corresponding to the expected size calculated from the sequence (Fig. 2, A and C). The ability of the alpha -catenin fusion proteins to bind to beta -catenin was assessed using a blot overlay assay as described under "Materials and Methods."


Fig. 1. Schematic representation of alpha -catenin and its derivatives produced by genetic engineering. The three regions of alpha -catenin showing homology with vinculin are shaded, and the degree of homology of each region is shown above the scheme. The derivatives were constructed using convenient restriction enzyme sites or the polymerase chain reaction procedure and were expressed as MBP fusion proteins. The alpha -catenin derivatives to which beta -catenin or plakoglobin bind are shaded.
[View Larger Version of this Image (30K GIF file)]



Fig. 2. Binding of the GST/beta -catenin fusion protein and GST/plakoglobin fusion protein to the purified MBP/alpha -catenin fusion proteins. The MBP/alpha -catenin fusion proteins were purified by affinity chromatography on amylose resin columns and then run on 8% polyacrylamide gels. The proteins were stained with either Coomassie Brilliant Blue (A) or incubated with anti-MBP antibodies (C), GST/beta -catenin (B and D), or GST/plakoglobin (E) after transfer to a nitrocellulose membrane. The binding of GST/beta -catenin to the MBP/alpha -catenin fusion proteins was visualized as described under "Materials and Methods." The band indicated by the arrowhead in B may represent a bacterial stress protein (DnaK) (33) co-purified with the MBP/alpha -catenin fusion proteins and recognized by the antibodies used in the experiments. The degree of contamination of the protein varies depending on the fusion protein.
[View Larger Version of this Image (37K GIF file)]


As shown in Fig. 2B, GST/beta -catenin bound to the alpha -catenin fusion proteins containing residues 1-906 (the entire protein, MBP/alpha -CN-(1-906) and residues 1-449 (the amino-terminal half of the protein, MBP/alpha -CN-(1-449), but it did not bind to a protein spanning residues 326-906 (the carboxyl-terminal two-thirds of the protein, MBP/alpha -CN-(326-906). The binding appeared to be specific for these portions of the MBP fusion proteins as no binding was observed between GST/beta -catenin and MBP alone. Furthermore, GST itself had no ability to bind to MBP/alpha -CN-(1-906) or MBP/alpha -CN-(1-449) (data not shown), indicating that the beta -catenin portion of GST/beta -catenin is responsible for the binding between GST/beta -catenin and the MBP fusion proteins. The binding of GST/beta -catenin to the MBP fusion proteins was abolished if GST/beta -catenin was boiled for 5 min immediately before the blot overlaying was performed (data not shown). The results indicate that beta -catenin binding to alpha -catenin is limited to the amino-terminal 449 residues of the alpha -catenin molecule.

To further define the beta -catenin-binding site within the amino-terminal 449 residues of the alpha -catenin molecule, we expressed a series of alpha -catenin fusion proteins with deletions from the amino terminus or from the carboxyl terminus of MBP/alpha -CN-(1-449). These proteins were then examined as to their ability to bind to beta -catenin. Although the alpha -catenin fusion proteins containing residues 48-163 exhibited such an ability, those with deletions in residues 48-163 did not (Fig. 2D). These results suggest that the beta -catenin-binding site in alpha -catenin is localized within residues 48-163 (as summarized and shown in Fig. 1).

Localization of the Plakoglobin-binding Site in alpha -Catenin

The high degree of sequence identity (82%) between the alpha -catenin-binding site of beta -catenin and that of plakoglobin (20) suggested that the binding site of alpha -catenin for beta -catenin and plakoglobin is the same. To determine whether this is the case or not, we analyzed the binding of the plakoglobin fusion protein with GST (GST/plakoglobin) to the alpha -catenin fusion proteins as above. As in the case of GST/beta -catenin binding, GST/plakoglobin bound to the alpha -catenin fusion proteins containing residues 48-163 but not to the alpha -catenin fusion proteins without these residues (Fig. 2E). These results suggest that the plakoglobin-binding site in alpha -catenin is also localized within residues 48-163.

To confirm that beta -catenin and plakoglobin bind to the same region of alpha -catenin, a competition experiment was carried out. When GST/plakoglobin was included on the incubation of GST/beta -catenin with an alpha -catenin fusion protein, the binding of GST/beta -catenin to the alpha -catenin fusion protein decreased with increasing amounts of GST/plakoglobin and vice versa (Fig. 3). The binding of GST/plakoglobin, however, seems to be more sensitive to the presence of the competitor. The presence of an approximately 12-fold molar excess of GST/plakoglobin reduced the binding of GST/beta -catenin, but the presence of an approximately 4-fold molar excess of GST/plakoglobin did not (Fig. 3A). The binding of GST/plakoglobin to an alpha -catenin fusion protein was significantly reduced by the presence of a 4-fold molar excess of GST/beta -catenin and almost completely inhibited by the presence of a 12-fold molar excess of GST/beta -catenin (Fig. 3B). These results may suggest that beta -catenin has a higher affinity to alpha -catenin than plakoglobin.


Fig. 3. Competition between beta -catenin and plakoglobin as to binding to alpha -catenin. The purified MBP/alpha -CN-(48-226) fusion protein (100 ng) was run on gels and then blotted onto nitrocellulose membranes. The membranes were incubated with GST/beta -catenin (10 µg/ml) in the presence of the indicated concentrations of GST or GST/plakoglobin (A) or incubated with GST/plakoglobin (10 µg/ml) in the presence of the indicated concentrations of GST or GST/beta -catenin (B). The binding of GST/beta -catenin or GST/plakoglobin was quantified as described under "Materials and Methods." The degree of binding was expressed as a percentage of the bound radioactivity in the absence of the competitor. Note that GST has almost no effect on the binding. Each experiment was performed in duplicate with the mean values presented here.
[View Larger Version of this Image (23K GIF file)]


To better characterize the interaction of beta -catenin or plakoglobin with alpha -catenin, Scatchard analysis was carried out (Fig. 4). Increasing concentrations of GST/beta -catenin or GST/plakoglobin were incubated with MBP/alpha -catenin (residues 1-906) fixed on nitrocellulose membranes followed by quantification of the amounts of the bound GST/beta -catenin or GST/plakoglobin. The results demonstrated that GST/beta -catenin bound to alpha -catenin with a dissociation constant (Kd) of 3.8 × 10-8 M and that GST/plakoglobin bound to alpha -catenin with a Kd of 7.7 × 10-8 M. When the truncated alpha -catenin with residues 48-163 was subjected to the same analysis, Kd values of 1.5 × 10-8 M and 5.6 × 10-8 M were obtained for GST/beta -catenin and GST/plakoglobin, respectively.


Fig. 4. Scatchard analysis of beta -catenin or plakoglobin binding to alpha -catenin. The binding of increasing concentrations (0-20 µg/ml) of GST/beta -catenin or GST/plakoglobin to the MBP/alpha -catenin protein (MBP/alpha -CN-(1-906) was quantified as described under "Materials and Methods." The ratio of the bound and free concentrations was plotted as a function of the concentration of beta -catenin (circles) or plakoglobin (squares) bound to a fixed amount of MBP/alpha -CN-(1-906) immobilized on nitrocellulose. Each experiment was performed in duplicate with the mean values plotted here. Each Kd was determined from the slope of the straight line graph thus obtained.
[View Larger Version of this Image (18K GIF file)]


Residues 1-220 of alpha -Catenin Are Sufficient for beta -Catenin Binding in Vivo

To prove that the results obtained in in vitro binding experiments reflect the activity of alpha -catenin in vivo, we expressed the amino-terminal region of alpha -catenin in living cells. We constructed an expression vector containing a cDNA encoding residues 1-226 of alpha -catenin and a sequence of an epitope of HA. The presence of the HA tag at the carboxyl terminus of the truncated alpha -catenin enabled us to collect the expressed protein by immunoprecipitation. An L cell line expressing E-cadherin (and thus also expressing beta -catenin) was transiently transfected with an expression vector, and the expressed alpha -catenin was collected with the anti-HA monoclonal antibodies to determine whether or not it could bind to beta -catenin. After SDS-PAGE and transfer to a nitrocellulose membrane, the collected materials were probed with antibodies to beta -catenin. As shown in Fig. 5, beta -catenin was precipitated by anti-HA antibodies from the cells transfected with the expression vector but not from the cells transfected with a control vector. Therefore, the truncated alpha -catenin containing amino-terminal residues 1-226 was able to bind to beta -catenin. To estimate the amount of beta -catenin bound to the mutant alpha -catenin in cells, Madin-Darby canine kidney cells were transfected with the same vector, and stable transfectants were isolated. The amounts of beta -catenin co-precipitated with the truncated alpha -catenin were compared with those of beta -catenin in the total cell lysates. Quantitative analysis revealed that about 5% of beta -catenin in the lysates was associated with the mutant alpha -catenin (data not shown).


Fig. 5. In vivo binding of the amino-terminal domain of alpha -catenin to beta -catenin. L cells expressing E-cadherin were transfected with an expression vector for the truncated alpha -catenin with the HA tag as described under "Materials and Methods." Cells transfected with a control vector (pCAGGS neo, lane 1) or with the expression vector (lane 2) were lysed, and then the lysates were incubated with anti-HA antibodies. The collected proteins were run on an 8% gel and then transferred to a nitrocellulose membrane. beta -Catenin was detected using anti-beta -catenin antibodies and ECL detection reagents (Amersham Corp.).
[View Larger Version of this Image (58K GIF file)]



DISCUSSION

Using an in vitro binding system, we analyzed the molecular interaction of alpha -catenin with beta -catenin and plakoglobin and localized the binding site for the latter two molecules in alpha -catenin. Furthermore, by expressing the amino-terminal region of alpha -catenin in living cells, we obtained evidence that the region can bind to beta -catenin in vivo. During the preparation of this manuscript, we noticed a report that the amino-terminal 606 amino acids of alpha -catenin bind to beta -catenin in a yeast two-hybrid system (23). Our results indicating that amino-terminal residues 48-163 of alpha -catenin bind to beta -catenin are consistent with this observation and also further extend it. Furthermore, we showed that plakoglobin and beta -catenin bind to the same region in alpha -catenin. Scatchard analysis revealed that beta -catenin binds to alpha -catenin with higher affinity (Kd = 3.8 × 10-8 M) than plakoglobin (Kd = 7.7 × 10-8 M).

cDNA cloning revealed that alpha -catenin is a vinculin-related protein. Vinculin is a cytoskeletal protein associated with both cell-cell and cell-extracellular matrix adherens-type junctions (24, 25). The homology between vinculin and alpha -catenin is restricted to three major regions in the amino-terminal, central, and carboxyl-terminal parts of the two proteins. Vinculin has been shown to bind to F-actin (26) and talin (27). The latter protein can bind directly to the cytoplasmic domain of beta 1 integrins (28, 29), which are members of the integrin superfamily of transmembrane heterodimeric glycoproteins. The actin-binding site of vinculin has been localized to the carboxyl-terminal region (26), whereas the talin-binding site is in the amino-terminal region of residues 1-258 (30). Therefore, we found similarities between alpha -catenin and vinculin not only in the primary sequence but also in the position of the region used for hierarchical molecular interactions in cell adhesion molecule complexes. The amino-terminal region of both proteins is involved in the interaction with a molecule (beta -catenin in the case of alpha -catenin and talin in the case of vinculin) that binds directly to the cell adhesion molecules (cadherins and integrins, respectively). The 116 amino acid residues identified in human alpha -catenin as the beta -catenin- and plakoglobin-binding site in this study, however, show only a 19.8% identity to the sequence of human vinculin. Therefore, it is not surprising that these two proteins interact with distinct proteins despite their overall structural similarity.

The alternative splicing of an mRNA primary transcript is a widespread means of generating structurally and functionally distinct protein isoforms and contributes to tissue-specific and developmentally regulated patterns of gene expression. The presence of splice variants of alpha -catenin and alpha N-catenin (a neural form of alpha -catenin) has been reported (31, 32), although their biological activities have not been determined. The variant forms included a 24- or 48-amino acid insertion in their carboxyl-terminal regions, respectively. The present study suggests that these variant forms have similar, if not identical, abilities to bind to beta -catenin and plakoglobin.


FOOTNOTES

*   This work was supported by Grant 07273258 from the Ministry of Education, Science, and Culture of Japan and a grant from the Ciba-Geigy Foundation (Japan) for the Promotion of Science.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Dagger    To whom correspondence should be addressed. Tel.: 81-99-275-5246; Fax: 81-99-264-5618.
1   The abbreviations used are: MBP, maltose-binding protein; GST, glutathione S-transferase; HA, hemagglutinin; PAGE, polyacrylamide gel electrophoresis.

ACKNOWLEDGEMENTS

We thank Drs. Akihiko Yoshimura and Ken-ichi Yamamura for the reagents, Drs. Jun-ichiro Tsutsui and Tomo Hashiguchi for suggestions, and Kumiko Sato for secretarial assistance.


REFERENCES

  1. Takeichi, M. (1991) Science 251, 1451-1455 [Abstract/Free Full Text]
  2. Kemler, R. (1993) Trends Genet. 9, 317-321 [CrossRef][Medline] [Order article via Infotrieve]
  3. Nagafuchi, A., and Takeichi, M. (1988) EMBO J. 7, 3679-3684 [Medline] [Order article via Infotrieve]
  4. Ozawa, M., Baribault, H., and Kemler, R. (1989) EMBO J. 8, 1711-1717 [Medline] [Order article via Infotrieve]
  5. Ozawa, M., Ringwald, M., and Kemler, R. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 4246-4250 [Abstract/Free Full Text]
  6. Nagafuchi, A., and Takeichi, M. (1989) Cell Regul. 1, 37-44 [Medline] [Order article via Infotrieve]
  7. Hirano, S., Kimoto, N., Shimoyama, Y., Hirohashi, S., and Takeichi, M. (1992) Cell 70, 293-301 [CrossRef][Medline] [Order article via Infotrieve]
  8. Herrenknecht, K., Ozawa, M., Eckerskorn, C., Lottspeich, F., Lenter, M., and Kemler, R. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 9156-9160 [Abstract/Free Full Text]
  9. Nagafuchi, A., Takeichi, M., and Tsukita, S. (1991) Cell 65, 849-857 [CrossRef][Medline] [Order article via Infotrieve]
  10. McCrea, P. D., Turck, C. W., and Gumbiner, B. (1991) Science 254, 1359-1361 [Abstract/Free Full Text]
  11. Butz, S., Stappert, J., Weissig, H., and Kemler, R. (1992) Science 257, 1142-1144 [Free Full Text]
  12. Franke, W. W., Goldschmidt, M. D., Zimbelmann, R., Mueller, H. M., Schiller, D. L., and Cowin, P. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 4027-4031 [Abstract/Free Full Text]
  13. Peifer, M., and Wieschaus, E. (1990) Cell 63, 1167-1178 [CrossRef][Medline] [Order article via Infotrieve]
  14. Knudsen, K. A., and Wheelock, M. J. (1992) J. Cell Biol. 118, 671-679 [Abstract/Free Full Text]
  15. Piepenhagen, P. A., and Nelson, W. J. (1993) J. Cell Sci. 104, 751-762 [Abstract]
  16. Aberie, H., Butz, S., Stappert, J., Weissig, H., Kemler, R., and Hoschuetzky, H. (1994) J. Cell Sci. 107, 3655-3663 [Abstract]
  17. Hülsken, J., Birchmeier, W., and Behrens, J. (1994) J. Cell Biol. 127, 2061-2069 [Abstract/Free Full Text]
  18. Rubinfeld, B., Souza, B., Albert, I., Munemitsu, S., and Polakis, P. (1995) J. Biol. Chem. 270, 5549-5555 [Abstract/Free Full Text]
  19. Sacco, P. A., McGranahan, T. M., Wheelock, M. J., and Johnson, K. R. (1995) J. Biol. Chem. 270, 20201-20206 [Abstract/Free Full Text]
  20. Ozawa, M., Terada, H., and Pedraza, C. (1995) J. Biochem. (Tokyo) 118, 1077-1082 [Abstract/Free Full Text]
  21. Tsutsui, J., Moriyama, M., Arima, N., Ohtsubo, H., Tanaka, H., and Ozawa, M. (1996) J. Biochem. (Tokyo) 120, 1034-1039 [Abstract/Free Full Text]
  22. Niwa, H., Yamamura, K., and Miyazaki, J. (1991) Gene (Amst) 108, 193-200 [CrossRef][Medline] [Order article via Infotrieve]
  23. Jou, T-S., Stewart, D. B., Stappert, J., Nelson, W. J., and Marrs, J. A. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 5067-5071 [Abstract/Free Full Text]
  24. Geiger, B. (1979) Cell 18, 193-205 [CrossRef][Medline] [Order article via Infotrieve]
  25. Burridge, K., Fath, K., Kelly, T., Nuckolls, G., and Turner, C. (1988) Annu. Rev. Cell Biol. 4, 487-525 [CrossRef]
  26. Johnson, R. P., and Craig, S. W. (1995) Nature 373, 261-264 [CrossRef][Medline] [Order article via Infotrieve]
  27. Burridge, K., and Mangeat, P. (1984) Nature 308, 744-746 [CrossRef][Medline] [Order article via Infotrieve]
  28. Horwitz, A., Duggan, K., Buck, C. A., Beckerle, M. C., and Burridge, K. (1986) Nature 320, 531-533 [CrossRef][Medline] [Order article via Infotrieve]
  29. Tapley, P., Horwitz, A., Buck, C., Duggan, K., and Rohrschneider, L. (1989) Oncogene 4, 325-333 [Medline] [Order article via Infotrieve]
  30. Gilmore, A. P., Jackson, P., Waites, G. T., and Critchley, D. R. (1992) J. Cell Sci. 103, 719-731 [Abstract]
  31. Rimm, D. L., Kebriaei, P., and Morrow, J. S. (1994) Biochem. Biophys. Res. Commun. 203, 1691-1699 [CrossRef][Medline] [Order article via Infotrieve]
  32. Uchida, N., Shimamura, K., Miyatani, S., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., and Takeichi, M. (1994) Dev. Biol. 163, 75-85 [CrossRef][Medline] [Order article via Infotrieve]
  33. Blum, P., Velligan, M., Lin, N., and Matin, A. (1992) Bio/Technology 10, 301-304 [CrossRef][Medline] [Order article via Infotrieve]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
A. Nakashima, T. Katagiri, and M. Tamura
Cross-talk between Wnt and Bone Morphogenetic Protein 2 (BMP-2) Signaling in Differentiation Pathway of C2C12 Myoblasts
J. Biol. Chem., November 11, 2005; 280(45): 37660 - 37668.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. D. Merdek, N. T. Nguyen, and D. Toksoz
Distinct Activities of the {alpha}-Catenin Family, {alpha}-Catulin and {alpha}-Catenin, on {beta}-Catenin-Mediated Signaling
Mol. Cell. Biol., March 15, 2004; 24(6): 2410 - 2422.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M. Hatzfeld, K. J. Green, and H. Sauter
Targeting of p0071 to desmosomes and adherens junctions is mediated by different protein domains
J. Cell Sci., April 1, 2003; 116(7): 1219 - 1233.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Biol.Home page
S. Matsubara and M. Ozawa
Expression of {alpha}-catenin in {alpha}-catenin-deficient cells increases resistance to sphingosine-induced apoptosis
J. Cell Biol., August 6, 2001; 154(3): 573 - 584.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M Ozawa and T Ohkubo
Tyrosine phosphorylation of p120(ctn) in v-Src transfected L cells depends on its association with E-cadherin and reduces adhesion activity
J. Cell Sci., January 2, 2001; 114(3): 503 - 512.
[Abstract] [PDF]


Home page
J. Biol. Chem.Home page
H. Lickert, A. Bauer, R. Kemler, and J. Stappert
Casein Kinase II Phosphorylation of E-cadherin Increases E-cadherin/beta -Catenin Interaction and Strengthens Cell-Cell Adhesion
J. Biol. Chem., February 18, 2000; 275(7): 5090 - 5095.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Roura, S. Miravet, J. Piedra, A. G. de Herreros, and M. Dunach
Regulation of E-cadherin/Catenin Association by Tyrosine Phosphorylation
J. Biol. Chem., December 17, 1999; 274(51): 36734 - 36740.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Ohkubo and M. Ozawa
p120ctn Binds to the Membrane-proximal Region of the E-cadherin Cytoplasmic Domain and Is Involved in Modulation of Adhesion Activity
J. Biol. Chem., July 23, 1999; 274(30): 21409 - 21415.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
E. Pötter, C. Bergwitz, and G. Brabant
The Cadherin-Catenin System: Implications for Growth and Differentiation of Endocrine Tissues
Endocr. Rev., April 1, 1999; 20(2): 207 - 239.
[Abstract] [Full Text]


Home page
J. Cell Biol.Home page
Y. Imamura, M. Itoh, Y. Maeno, S. Tsukita, and A. Nagafuchi
Functional Domains of alpha -Catenin Required for the Strong State of Cadherin-based Cell Adhesion
J. Cell Biol., March 22, 1999; 144(6): 1311 - 1322.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Ozawa
Identification of the Region of alpha -Catenin That Plays an Essential Role in Cadherin-mediated Cell Adhesion
J. Biol. Chem., November 6, 1998; 273(45): 29524 - 29529.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Bauer, H. Lickert, R. Kemler, and J. Stappert
Modification of the E-cadherin-Catenin Complex in Mitotic Madin-Darby Canine Kidney Epithelial Cells
J. Biol. Chem., October 23, 1998; 273(43): 28314 - 28321.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Biol.Home page
M. Watabe-Uchida, N. Uchida, Y. Imamura, A. Nagafuchi, K. Fujimoto, T. Uemura, S. Vermeulen, F. van Roy, E. D. Adamson, and M. Takeichi
alpha -Catenin-Vinculin Interaction Functions to Organize the Apical Junctional Complex in Epithelial Cells
J. Cell Biol., August 10, 1998; 142(3): 847 - 857.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Biol.Home page
I. Simcha, M. Shtutman, D. Salomon, J. Zhurinsky, E. Sadot, B. Geiger, and A. Ben-Ze'ev
Differential Nuclear Translocation and Transactivation Potential of beta -Catenin and Plakoglobin
J. Cell Biol., June 15, 1998; 141(6): 1433 - 1448.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Biol.Home page
E. E. Weiss, M. Kroemker, A.-H. Rudiger, B. M. Jockusch, and M. Rudiger
Vinculin Is Part of the Cadherin-Catenin Junctional Complex: Complex Formation between alpha -Catenin and Vinculin
J. Cell Biol., May 4, 1998; 141(3): 755 - 764.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Ozawa and R. Kemler
Altered Cell Adhesion Activity by Pervanadate Due to the Dissociation of alpha -Catenin from the E-Cadherin·Catenin Complex
J. Biol. Chem., March 13, 1998; 273(11): 6166 - 6170.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
A. Kowalczyk, P Navarro, E Dejana, E. Bornslaeger, K. Green, D. Kopp, and J. Borgwardt
VE-cadherin and desmoplakin are assembled into dermal microvascular endothelial intercellular junctions: a pivotal role for plakoglobin in the recruitment of desmoplakin to intercellular junctions
J. Cell Sci., January 10, 1998; 111(20): 3045 - 3057.
[Abstract] [PDF]


Home page
J. Biol. Chem.Home page
R. B. Hazan, L. Kang, S. Roe, P. I. Borgen, and D. L. Rimm
Vinculin Is Associated with the E-cadherin Adhesion Complex
J. Biol. Chem., December 19, 1997; 272(51): 32448 - 32453.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Biol.Home page
A. P. Kowalczyk, E. A. Bornslaeger, J. E. Borgwardt, H. L. Palka, A. S. Dhaliwal, C. M. Corcoran, M. F. Denning, and K. J. Green
The Amino-terminal Domain of Desmoplakin Binds to Plakoglobin and Clusters Desmosomal Cadherin-Plakoglobin Complexes
J. Cell Biol., November 3, 1997; 139(3): 773 - 784.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. R. Koslov, P. Maupin, D. Pradhan, J. S. Morrow, and D. L. Rimm
alpha -Catenin Can Form Asymmetric Homodimeric Complexes and/or Heterodimeric Complexes with beta -Catenin
J. Biol. Chem., October 24, 1997; 272(43): 27301 - 27306.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. L. Giannini, M. d. M. Vivanco, and R. M. Kypta
alpha -Catenin Inhibits beta -Catenin Signaling by Preventing Formation of a beta -Catenin{middle dot}T-cell Factor{middle dot}DNA Complex
J. Biol. Chem., July 14, 2000; 275(29): 21883 - 21888.
[Abstract] [Full Text] [PDF]