![]()
|
|
||||||||
(Received for publication, November 12, 1996, and in revised form, February 5, 1997)
and
§¶
From the Departments of Activation of the TAL1 (or
SCL) gene, initially identified through its involvement by
a recurrent chromosomal translocation, is the most frequent
gain-of-function mutation recognized in T-cell acute lymphoblastic
leukemia. The translational products of this gene contain the basic
domain helix-loop-helix motif characteristic of a family of
transcription factors that bind to a consensus nucleotide sequence
termed the E-box. Previous work established that the TAL1 proteins are
phosphorylated exclusively on serine and identified Ser122
as a substrate for the mitogen-activated protein kinase ERK-1. We
provide evidence that an additional serine residue, Ser172,
located in a conserved region proximal to the DNA binding domain and
sharing homology with a similarly positioned sequence in the HLH
oncoprotein LYL1, can be phosphorylated in vitro and
in vivo by the catalytic subunit of
cAMP-dependent protein kinase. Phosphorylation was found to
alter TAL1 DNA binding activity in a target-dependent manner that was influenced by both the specific CANNTG E-box core motif
and its flanking sequences. In contrast, the ability of TAL1 to
interact with the E2A gene product E12 and its subcellular localization in transfected COS cells were unaffected by
Ser172 phosphorylation. These results suggest this serine
residue has a regulatory function and indicate a mechanism by which
phosphorylation could affect DNA binding site discrimination.
The TAL1 (or SCL) gene was initially
identified as a result of its involvement in a recurrent chromosomal
translocation with the T-cell receptor TAL1 belongs to the helix-loop-helix (HLH)1
family of transcription factors (8, 9), so-named for
the conformation adopted by its defining motif of two amphipathic
helices with an intervening loop (10-12). The HLH domain functions in
the formation of protein hetero- and homodimers, whereas an adjacent
basic region found in many of the members of this gene family mediates
sequence-specific DNA binding (13-15). As with other tissue-restricted
basic domain-HLH (bHLH) proteins, TAL1 binds DNA as a heterodimer with
the products of the widely expressed E2A gene (16, 17).
These complexes recognize a motif with the hexanucleotide core sequence
CANNTG termed the E-box (18, 19) and function as transcriptional regulators (20).
Within this larger family, distinct subgroups of HLH genes can be
recognized on the basis of sequence relatedness, expression pattern,
and function. In the best characterized example, the four bHLH genes
expressed in developing skeletal muscle share the ability to induce
myogenic differentiation when introduced into certain cell lines (21,
22) and appear capable of substituting for each other's functions
in vivo (23). TAL1 shows greater than 80%
sequence identity over its basic and HLH domains with two other genes,
LYL1 and TAL2, also involved by chromosomal
translocation in T-cell acute lymphoblastic leukemia (24).
The protein products of the TAL1 locus are expressed in a
number of cell types during development, becoming essentially
restricted to hematopoietic and endothelial cells postnatally (25, 26). A requirement for TAL1 in embryonic hematopoiesis was recently demonstrated by targeted mutation of the murine TAL1 coding
region (27, 28), and evidence also points to its involvement in the terminal, erythropoietin-regulated stages of red cell production (29,
30). TAL1 and LYL1 show overlapping expression in
several hematopoietic lineages (31) and may, by analogy to the myogenic HLH genes, share some similarities in function.
Up to three proteins can be translated from TAL1 transcripts
(32-34), with two potentially made from the full-length message (amino
acids 1-330 and 26-330, numbered according to the mouse protein). The
shorter of these, whose synthesis in cells has not been rigorously
demonstrated, likely arises by alternative translational initiation
(35). A significantly smaller protein (amino acids 176-330) lacking
the amino-terminal half of the molecule but retaining the basic and HLH
domains is translated from a series of spliced RNAs that exclude the
first coding exon. This species has been detected in leukemia cell
lines (33) and differentiating erythroblasts (30).
The TAL1 polypeptides are serine phosphoproteins (32, 33), with
phosphorylation of Ser122 by the mitogen-activated protein
kinase ERK-1 (34) found to increase the activity of a transcriptional
activation domain (36). We provide evidence that an additional serine
residue located proximal to the basic region can be phosphorylated
in vitro and in vivo by
cAMP-dependent protein kinase (PKA) and show that its phosphorylation alters TAL1 DNA binding activity in a
target-dependent manner.
A 640-base pair murine TAL1
cDNA derived by the polymerase chain reaction (25) was
subcloned into the EcoRI site of vector pMALc2 (New England
Biolabs) and the encoded maltose-binding protein (MBP)-murine TAL1
fusion (MBP-TAL1164-330) expressed in the DH5 MBP-TAL1 fusion proteins were purified on composite amylose-agarose
beads (New England Biolabs) and eluted with maltose as described (37).
Purified MBP was provided by Paul Riggs.
A 1.0-kilobase full-length mouse
TAL1 cDNA was subcloned into the BamHI site
of vector pALTER-1 (Promega), and oligonucleotide-mediated mutagenesis
of Ser172 to Ala was carried out according to the
supplier's instructions and verified by nucleotide sequencing. The
mutated cDNA was released from pALTER-1 and subcloned into the
BamHI site of vector pcDNA I (Invitrogen) for cell
transfection.
Affinity purified fusion proteins
(500 ng) were phosphorylated by the addition of 5 units of purified PKA
catalytic subunit (provided by Sharron Francis and Jackie Corbin) in a
20-µl reaction volume containing 10 mM Tris-HCl, pH 7.4, 2 mM magnesium acetate, 50 µM ATP, and 10 µCi of [ To determine the stoichiometry of phosphorylation, 1.57 µg of
MBP-TAL1164-330 fusion protein was incubated with
[ Electrophoretic
mobility shift assays (EMSA) of DNA binding activity were carried out
with an amino-terminally truncated E12 protein produced by coupled
transcription/translation (TnT system, Promega) of plasmid E12R (10) in
rabbit reticulocyte lysates and MBP-TAL1 fusion proteins purified from
bacterial sonicates. The indicated proteins were incubated in a buffer
containing 20 mM Hepes, pH 7.8, 20% glycerol, 100 mM KCl, 0.5 mM dithiothreitol, 0.2 mM EDTA, and 20 mM MgCl2 for 10 min. In some cases as noted, anti-TAL1 antibody was added for an
additional 5 min. Double-stranded oligonucleotides were labeled with
32P by T4 polynucleotide kinase and incubated with
transcription factor complexes in 30 µl of binding buffer containing
100 mM Hepes, pH 7.8, 2.5 mM dithiothreitol,
100 mM KCl, 60 mM MgCl2, 1 mM EDTA, and 1 µg of poly(dI-dC) for 20 min at room
temperature. Protein-DNA complexes were resolved in Tris borate buffer
on 5% polyacrylamide gels containing 3% glycerol. Dried gels were
exposed to film, and laser scanning densitometry was used to quantitate the relevant retarded complexes on the resulting autoradiographs. The
significance of differences in the DNA binding of complexes was
determined by a two-tailed t test. Mean values ± S.D.
were calculated from four independent experiments.
The sequences of the upper strand of each pair of oligonucleotides
used, with the core E-box sequences underlined, are as follows: µE2
enhancer, CCTGCAGGCAGGAA; µE5 enhancer,
GAACCAGAACAGCA; preferred binding site,
ACCTGAAGTCGGCT; chimeric site with core sequences
from preferred binding site and flanking sequences from µE2 enhancer,
CCTGCAGGCAGGAA; chimeric site with core sequences from µE2 enhancer and flanking sequences from preferred binding site, ACCTGAAGTCGGCT.
Metabolic labeling of COS cells was carried out 48 h following transfection (38) with the indicated expression vectors. Cells were rinsed once with phosphate-free modified Eagle's medium containing 10% dialyzed fetal bovine serum and incubated for 1 h
at 37 °C in this medium. [32P]Orthophosphate (ICN
Biomedicals) was added (1 mCi/ml) and incubation continued for an
additional 3 h. After labeling, the cells were washed with
phosphate-buffered saline and lysed directly on plates by addition of
radioimmunoprecipitation buffer (150 mM NaCl, 50 mM Tris, pH 8.0, 1.0% Nonidet P-40, 0.5% sodium
deoxycholate, 0.1% SDS) containing 1 mM
phenylmethylsulfonyl fluoride, 50 µg/ml aprotinin, 25 µg/ml
leupeptin, and 1 mM sodium vanadate. Murine erythroleukemia
cells (2.5 × 106 cells/ml) were incubated in
phosphate-free modified Eagle's medium for 1 h, labeled with 1 mCi/ml [32P]orthophosphate in the presence of 1 mM 8-(4-chlorophenylthio)-adenosine 3 TAL1 protein was immunoprecipitated
from nuclear extracts using affinity purified rabbit anti-TAL1 antibody
as described previously (25, 30). Antigen-antibody complexes were
collected with protein A-Sepharose and resolved on 8%
SDS-polyacrylamide gels. Proteins were transferred to polyvinylidene
difluoride (PVDF) membranes and visualized by autoradiography.
After immunoprecipitation and fractionation by SDS-PAGE,
radiolabeled TAL1 protein was transferred to PVDF membranes and
digested in situ with chymotrypsin. Proteolytic fragments
were eluted and subjected to two-dimensional phosphopeptide analysis by
the method of Boyle et al. (39). Digests were applied to
cellulose thin layer electrophoresis plates (EM Science) and
fractionated by electrophoresis in pH 1.9 buffer at 1000 V for 20 min.
Dried plates were then subjected to ascending thin layer chromatography
in a solvent containing 39% butanol, 30% pyridine, and 6% glacial acetic acid. Radiolabeled digestion products were visualized by autoradiography and phosphorimaging (Molecular Dynamics).
Following transfer to PVDF membranes, radiolabeled TAL1 protein was
hydrolyzed for phosphoamino acid analysis in 6 M HCl at 110 °C for 1 h. Hydrolysates were lyophilized, dissolved in
water, lyophilized a second time to dryness, and finally dissolved in pH 1.9 electrophoresis buffer containing phosphoamino acid standards (phosphothreonine, phosphoserine, and phosphotyrosine). Samples were
applied to cellulose thin layer electrophoresis plates and electrophoresed in pH 1.9 buffer in one dimension and pH 3.5 buffer in
the second dimension, both at 1000 V for 20 min. Dried plates were
sprayed with ninhydrin to visualize standards and subjected to
autoradiography and phosphorimaging.
MBP-TAL1164-330
fusion protein treated with or without PKA was incubated for 10 min at
room temperature with a radiolabeled E12 polypeptide translated in
rabbit reticulocyte lysates in the presence of
[3H]leucine (158 Ci/mmol) (Amersham Corp.). Composite
amylose-agarose beads were added for an additional 15 min to adsorb
heterodimeric complexes through the maltose-binding moiety of the TAL1
fusion protein and then washed with 20 mM Tris-HCL, pH 7.4, 0.2 M NaCl. Bound proteins were released from beads by
boiling in loading buffer and resolved on 10% SDS-polyacrylamide gels.
Dried gels were subjected to fluorography, and the amount of E12 bound
was quantitated by laser scanning densitometry.
COS cells cultured on glass coverslips
were transfected by calcium phosphate coprecipitation (38) with an
expression vector (pcDNA I) containing a full-length murine
TAL1 cDNA or the corresponding Ser172 to Ala
mutant generated by site-directed mutagenesis, with or without an
expression vector encoding the To identify potential sites of TAL1 protein
phosphorylation, bacterial expressed MBP-TAL1 fusion proteins were
incubated with purified protein kinases and radiolabeled ATP in
in vitro kinase assays. TAL1, but not MBP, sequences were
efficiently phosphorylated by the catalytic subunit of PKA, and the
site(s) of phosphorylation was localized using a series of
amino-terminally truncated TAL1 fusion proteins as substrates to a
region encompassing amino acids 164-255 (not shown). Phosphoamino acid
analysis indicated further that PKA-stimulated TAL1 phosphorylation
occurred only on serine (not shown). By inspection, a potential PKA
recognition sequence (RVKRRPSPY) resembling, especially, that of the
To determine specifically whether Ser172 was the target of
PKA-stimulated phosphorylation, an MBP-TAL1 fusion protein containing this site (MBP-TAL1164-330) and its corresponding
Ser172 to Ala mutant (MBP-TAL1164-330(S172A))
were incubated with purified catalytic subunit of PKA in the presence
of [
Given its proximity to the basic domain, we investigated
whether phosphorylation of Ser172 would affect the binding
of TAL1-containing complexes to DNA. Previous work had demonstrated
sequence-specific DNA binding activity for hetero-oligomers of TAL1
with E12, E47, and HEB (18), and the ability of the
MBP-TAL1164-330 fusion protein to bind with E12 to E-box
sequences from the µE2 and µE5 immunoglobulin enhancers and one
identified by a polymerase chain reaction-assisted site-selection assay
(19) was tested by EMSA. In addition to a complex attributable to the
binding of E12 homodimers, particularly prominent with the µE5 probe, a less retarded complex dependent on the presence of both TAL1 and E12
protein and specifically disrupted by anti-TAL1 antibody was identified
(Fig. 3). Significantly greater binding of this TAL1-E12
heterodimeric complex was found to the preferred sequence, consistent
with it being a high affinity site (19) (not shown). No DNA binding was
noted with either purified MBP or unprogrammed reticulocyte lysate.
The effect of PKA-mediated TAL1 phosphorylation on the DNA binding
activity of TAL1-E12 complexes was further investigated using
MBP-TAL1164-330 protein as substrate. Phosphorylation
resulted in greater than 50% inhibition of binding of
MBP-TAL1164-330·E12 complexes to the µE2 and µE5
enhancers, whereas it had no effect with the preferred site as probe
(Figs. 4 and 5A).
Site-specific mutagenesis abrogated the effect of phosphorylation on
DNA binding activity concomitant with its inhibition of radiophosphate
incorporation (Figs. 4 and 5A), demonstrating the action of
PKA to be a direct one requiring Ser172 as
phosphoacceptor.
Although it demonstrated the same binding preferences as those reported
for the native protein (19), the MBP-TAL1 fusion used in these
experiments included comparatively little sequence amino-terminal to
the phosphorylation site and could, as a result, have been
differentially or uniquely sensitive to this effect of phosphorylation.
To address this possibility, an MBP fusion containing near full-length
TAL1 coding sequence (MBP-TAL15-330) was purified and
tested as described. Ser172 phosphorylation had the
identical effect on this protein as on the MBP-TAL1164-330
fusion (not shown), indicating that PKA regulation of TAL1 DNA binding
activity is not dependent on protein truncation.
The E-box probes used in these analyses each differed in both their
core and flanking nucleotide sequences. To clarify the DNA sequence
requirements for the effect of phosphorylation observed, chimeric
oligonucleotides containing portions of the µE2 and preferred binding
sites were synthesized, and the extent of binding of complexes containing PKA-treated versus untreated TAL1 fusion protein
was determined. Substitution of the flanking sequences from the µE2 enhancer for those in the preferred site had no effect on binding, whereas replacement of the flanking sequences of the µE2 E-box with
those from the preferred site ablated the effect of phosphorylation (Fig. 5B). Thus, Ser172 phosphorylation exerts a
template-dependent effect on DNA binding through a
mechanism involving discrimination of both the CANNTG core motif and
its immediate flanking sequences.
Although the domain involved in protein dimerization
is more distal from Ser172 than that mediating DNA binding
(Fig. 1), if phosphorylation were to alter the interaction of TAL1 with
its binding partners it could, indirectly, affect DNA binding activity.
To investigate this possibility, the extent of binding of
[3H]leucine-labeled E12 was measured in a solution
interaction assay to MBP-TAL1164-330 fusion protein that
had been incubated with and without purified catalytic subunit of
PKA. No difference was detected (Fig. 6), demonstrating that dimerization of TAL1 with at least one of
its known binding partners is unaffected by Ser172
phosphorylation.
Given the importance of the basic
region for nuclear uptake in addition to DNA binding (44), we also
investigated whether Ser172 phosphorylation could affect
the subcellular localization of TAL1 protein. To that end, an
expression vector containing a full-length murine TAL1
cDNA was transfected into COS cells with and without one encoding
the catalytic subunit of PKA, and the distribution of TAL1 protein was
analyzed by indirect immunofluorescence. Consistent with its location
in tissue sections (25, 26) and with previously published results in
this cell line (25, 32, 44), immunoreactive TAL1 was restricted to the
nuclei of transfected cells, where it appeared to be excluded from
nucleoli. This pattern was not altered by coexpression of PKA catalytic
subunit (Fig. 7), indicating that phosphorylation of
Ser172, verified by phosphopeptide mapping (see below), has
no effect on the protein's intracellular localization. The nuclear
uptake of full-length TAL1 proteins containing either
Ser172 to Ala or Ser172 to Glu substitutions
was similarly unaffected (not shown).
To
determine whether Ser172 could also function as a
phosphoacceptor in cells, two-dimensional phosphopeptide mapping was
carried out on immunoprecipitates from metabolically labeled COS cells engineered to express full-length TAL1 protein or the corresponding Ser172 to Ala mutant. Labeling of one major and one minor
proteolytic fragment likely resulting from incomplete enzymatic
digestion was markedly induced by coexpression of the catalytic subunit of PKA (not shown), and the presence of Ser172 in these
fragments was demonstrated by the specific abrogation of their labeling
following substitution of alanine for this serine (Fig.
8, A-B). The finding that PKA-induced TAL1
protein phosphorylation was completely inhibited by this mutation
provides further confirmation that Ser172 is the principal
site in TAL1 for phosphorylation by this kinase.
A radiolabeled peptide with mobility identical to the major COS cell
fragment was noted in TAL1 chymotryptic digests from murine
erythroleukemia cells incubated with the cAMP analog
8-(4-chlorophenylthio)-adenosine 3 A fundamental problem in gene regulation is that of how the
appropriate binding site on DNA is selected by structurally related members of transcription factor families each able to recognize the
same consensus nucleotide sequence. For the bHLH proteins, at least
three strategies appear to be used to ensure binding specificity. These
include differential heterodimerization (45), interaction with
DNA-binding proteins of other classes (46), and discrimination of bases
flanking the core E-box motif (47, 48).
Although the ability of phosphorylation to modify the binding of a
variety of transcription factors to their cognate DNA sequences is well
known (reviewed in Ref. 49), it has only recently been appreciated that
this action may be target-dependent. For p53 (50, 51) and
the POU homeodomain protein GHF-1 (Pit-1) (52, 53), phosphorylation has
been shown to increase or decrease binding in a manner dependent on the
specific DNA elements tested. We have found that a conserved serine
residue in the oncoprotein TAL1, Ser172, can be
phosphorylated by PKA and that its phosphorylation regulates DNA
binding activity in a template-dependent fashion without
effect on protein dimerization or subcellular localization.
Site selection analysis has demonstrated a preference of
TAL1-containing complexes for specific sequences flanking, in addition to those comprising, the central CANNTG motif of the E-box, and these
same bases appear also to be important for the effect of PKA on TAL1
DNA binding activity. Discrimination of E-box-flanking bases has been
similarly noted for E47 and MyoD homodimers (45), and the crystal
structures of these bHLH proteins bound to DNA indicate their basic
regions can make contact with them (11, 12). Although
Ser172 would not be expected to interact with DNA directly,
transfer of a charged phosphate group to this residue potentially could induce a conformational change that alters the strength of such interactions.
Our studies suggest that a region of extended homology between TAL1 and
another member of the subgroup of HLH oncoproteins activated by
chromosomal rearrangement, LYL1, represents a conserved regulatory site
through which phosphorylation could alter protein function. Although
not specifically tested, given the extent of homology over these
sequences and the similarity in their location, phosphorylation of the
corresponding serine residue in LYL1 (Fig. 1) would be predicted to
have the same template-dependent effect on DNA binding. In
view of the considerable homology in their basic and HLH domains,
near-identical preference in DNA binding sites (19, 54), and
overlapping patterns of expression (31), it is likely the biological
consequences of this modification would be similar as well.
Although a requirement for TAL1 in embryonic hematopoiesis
was demonstrated by targeted mutation of the mouse gene (27, 28) and a
role in erythroid differentiation postnatally is suggested by antisense
studies (29), little is actually known about the specific functions of
this transcription factor, the identity of its molecular targets, and
how its activity might be regulated. PKA has been variously proposed to
be required for (55, 56) and inhibitory to (57) erythroid
differentiation, and although its catalytic subunit potently and
selectively phosphorylated Ser172 of TAL1 in
vitro, it is not proven this kinase does so uniquely in
vivo. Irrespective of the kinase(s) responsible, the
demonstration that phosphorylation of this site has a
sequence-dependent effect on DNA binding suggests a mechanism by
which the affinity of TAL1-containing complexes and, potentially, the
sets of target genes activated could be subject to regulation.
We thank Liying Yang for assistance in
preparation of TAL1 fusion proteins, Steven Hanks for providing the PKA
expression vector, Glenn Begley for providing a full-length murine
TAL1 cDNA, Paul Riggs for providing purified MBP and MBP
expression vectors, Sharron Francis and Jackie Corbin for supplying
purified catalytic subunit of PKA and helpful discussions, and Greg den
Haese for advice on phosphopeptide mapping.
Medicine and
§ Cell Biology,
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
/
locus in T-cell acute
lymphoblastic leukemia (1-3). It was recognized subsequently that its
coding region could be juxtaposed to the promoter of the upstream
SIL (for SCL interrupting locus) gene as a result
of certain interstitial deletions inapparent cytogenetically (4-6). In
still other patients, the gene can be misexpressed in the apparent
absence of chromosomal rearrangement (7). In aggregate, ectopic
TAL1 expression characterizes up to 60% of individuals with
T-cell acute lymphoblastic leukemia, making it the most frequent
gain-of-function mutation recognized in this disorder.
TAL1 Fusion Proteins
strain of
Escherichia coli. To express the corresponding
Ser172 to Ala mutant (MBP-TAL1164-330(S172A)),
oligonucleotides TATGGGGCAGGCCTCCTCTTCACCCGGTTGTTG and
AATTCAACAACCGGGTGAAGAGGAGGCCTGCCCCA were annealed and ligated in
a trimolecular reaction to EcoRI- and
BamHI-digested pMALc2 and an
NdeI-BamHI murine TAL1 cDNA
extending from bases 519 to 1003. For preparation of an
MBP-TAL15-330 fusion protein, a 1.0-kilobase
NotI- and BamHI-digested fragment of a
full-length murine TAL1 cDNA (provided by Glenn Begley)
was subcloned into EcoRI and BamHI-digested
pPR1166 (provided by Paul Riggs) after blunting of the NotI
site of the insert and the EcoRI site of the vector with the
Klenow fragment of DNA polymerase I. Automated nucleotide sequencing of
fusion constructs was carried out using dye-labeled dideoxy terminators
(Applied Biosystems) to confirm that the malE and
TAL1 coding regions were in the same reading frame.
-32P]ATP (specific activity, 3000 Ci/mmol).
The reaction mixture was incubated for 20 min at 30 °C, and the
radiolabeled proteins were immunoprecipitated with rabbit polyclonal
antibody raised against a bacterial expressed TAL1 fusion protein (25),
and immunoprecipitates were analyzed by SDS-polyacrylamide gel
electrophoresis. For electrophoretic mobility shift assays, 2 µg of
protein were phosphorylated in a reaction containing 200 µM unlabeled ATP and 20 units of PKA. Control reactions
lacked only enzyme and were processed in parallel.
-32P]ATP and PKA under the conditions described above
and fractionated by SDS-PAGE. Protein was visualized by Coomassie Blue
staining, and the radioactivity incorporated into a gel slice
containing the fusion protein was quantitated in a liquid scintillation
counter. The mean number of mol of phosphate incorporated per mol of
protein ± S.D. was determined for three independent reactions,
taking into account the specific activity of the
[
-32P]ATP and the efficiency of the counter.
:5
-cyclic
monophosphate and 1 mM theophylline for 3 h, and processed as described for COS cells.
type catalytic subunit of PKA (40).
After an additional 48 h in culture, cells were fixed in 2%
formaldehyde and permeabilized with 0.1% dimethyl sulfoxide.
Coverslips were rinsed in phosphate-buffered saline, incubated with
affinity purified anti-TAL1 antibody at a 1:1500 dilution for 1 h,
and washed. Following incubation with fluorescein-conjugated goat
anti-rabbit antibody, coverslips were washed extensively, mounted on
glass slides in aqueous medium (1.2% polyvinyl alcohol, 5% glycerol),
and examined with a microscope equipped with epifluorescence.
TAL1 Is a Substrate for Phosphorylation by PKA in Vitro:
Identification of Ser172 as the Site of
Phosphorylation
chain of phosphorylase kinase (41) was noted that contains
Ser172. This sequence is completely conserved between the
chicken (42), mouse (1), and human (2, 43) TAL1 proteins and shows
considerable homology to one found in a similar context in another HLH
oncoprotein expressed in hematopoietic cells, LYL1 (Fig.
1).
Fig. 1.
Location of Ser172 and
conservation of potential phosphorylation motif in the HLH oncoprotein
LYL1. The indicated amino acid sequence encompassing
Ser172 is completely conserved between chicken, mouse, and
human TAL1 proteins and shows considerable homology with the denoted
sequence in LYL1 protein. Amino acids are numbered according
to the murine TAL1 coding region. Basic region,
filled. HLH domain, shaded. Previously mapped
site of TAL1 phosphorylation (Ser122), P.
[View Larger Version of this Image (11K GIF file)]
-32P]ATP. Under the conditions described, the
MBP-TAL1164-330 fusion was phosphorylated to a
stoichiometry of 0.78 ± 0.17 mol of phosphate/mol of protein. The
alanine substitution mutant, in contrast, showed no measurable
phosphorylation by PKA (Fig. 2), demonstrating the
ability of Ser172 to function as a phosphoacceptor for this
kinase in vitro.
Fig. 2.
Effect of Ser172 to Ala
substitution on in vitro phosphorylation of
MBP-TAL1164-330 fusion protein by PKA. Purified
MBP-TAL1164-330 fusion protein (wild type) and the
corresponding fusion containing a Ser172 to Ala
substitution (MBP-TAL1164-330(S172A)) (mutant) were
incubated with the catalytic subunit of PKA in the presence of
[
-32P]ATP. Proteins were then immunoprecipitated with
anti-TAL1 antibody and resolved on an 8% SDS-polyacrylamide gel. The
dried gel was exposed to film and analyzed by autoradiography. Sizes of
protein standards run in parallel are given in kDa.
[View Larger Version of this Image (45K GIF file)]
Fig. 3.
DNA binding activity of MBP-TAL1·E12
complexes. Purified MBP-TAL1164-330 fusion protein
was mixed with in vitro translated E12 protein and tested
for DNA binding activity by EMSA using 32P-labeled
double-stranded oligonucleotides corresponding to E-box sequences in
the µE2 and µE5 immunoglobulin enhancers and one identified as a
preferred sequence for binding by a polymerase chain
reaction-assisted site-selection method. Heterodimeric
MBP-TAL1·E12 complexes denoted with arrowhead were
identified by their dependence on both MBP-TAL1 fusion protein and E12
for formation and their specific abrogation with anti-TAL1 antibody
(TAL1 ab). Autoradiographic exposure times varied with
different probes.
[View Larger Version of this Image (105K GIF file)]
Fig. 4.
Effect of Ser172 phosphorylation
on TAL1 DNA binding activity. DNA-binding activities of
MBP-TAL1·E12 heterodimeric complexes (arrowhead) were
analyzed by EMSA using double-stranded oligonucleotides containing the
µE2, µE5, and preferred E-box binding sites as probes. To test the
effect of phosphorylation on binding, MBP-TAL1164-330
fusion protein was incubated with (TAL1P) and
without (TAL1) purified catalytic subunit of PKA and ATP prior to incubation with in vitro translated E12 protein
(E12). Similar studies were also carried out with
MBP-TAL1164-330(S172A) protein (not shown).
[View Larger Version of this Image (119K GIF file)]
Fig. 5.
Effect of Ser172 phosphorylation
on TAL1 DNA binding activity. A,
MBP-TAL1164-330 (solid bars) and
MBP-TAL1164-330(S172A) (open bars) proteins
incubated with or without PKA were mixed with in vitro
translated E12 protein and subjected to EMSA with each of the indicated
binding sites. Binding was quantitated by densitometric analysis of the
retarded TAL1·E12 complex on autoradiograms, and the relative binding
for complexes containing PKA-treated versus those containing
untreated TAL1 protein is expressed as a percentage for each fusion
protein and binding site. For the MBP-TAL1164-330 fusion,
these results provide a graphical representation of the data in Fig. 4.
Plotted is the mean percent binding ± S.D. from four independent
experiments. The statistical significance of the difference in the
means of adjacent conditions is denoted by the symbol, *
(p < 0.001). B,
MBP-TAL1164-330 protein incubated with or without PKA was
mixed with in vitro translated E12 protein and subjected to
EMSA with each of the four binding sites illustrated schematically
below. Probes consisted of the µE2 enhancer, the preferred binding
site, a chimeric site containing the core E-box sequences from the
preferred site with flanking sequences from the µE2 oligonucleotide,
and the reciprocal oligonucleotide containing the core E-box sequences
of the µE2 enhancer with flanking sequences from the preferred
binding site. Binding was quantitated by densitometric analysis of the
retarded TAL1·E12 complex on autoradiograms, and the relative binding
for complexes containing PKA-treated versus those containing
untreated TAL1 protein was calculated as a percentage for each binding
site. Plotted is the mean percent binding ± S.D. from three
independent experiments. The statistical significance of the difference
in the means of adjacent conditions is denoted by the symbols, * (p < 0.05) and ** (p < 0.0001).
[View Larger Version of this Image (24K GIF file)]
Fig. 6.
Effect of Ser172 phosphorylation
on the interaction of TAL1 with E12.
[3H]Leucine-labeled E12 protein was incubated in solution
with MBP-TAL1164-330 fusion protein that had been
incubated with (denoted P) and without (denoted
C) catalytic subunit of PKA. Bound protein was collected by
the addition of composite amylose-agarose beads and quantitated by
fluorography following SDS-PAGE.
[View Larger Version of this Image (100K GIF file)]
Fig. 7.
Effect of Ser172 phosphorylation
on the subcellular location of TAL1. COS cells cultured on
coverslips were mock-transfected (top) and transfected with
an expression vector for full-length mouse TAL1 cDNA without
(middle) and with (bottom) one encoding the
catalytic subunit of PKA. Cells were fixed 48 h later with 2%
formaldehyde, permeabilized with 0.1% dimethyl sulfoxide, and stained
with rabbit anti-TAL1 antibody. TAL1 protein localization was
determined by indirect immunofluorescence using fluorescein-conjugated goat anti-rabbit antibody. Fluorescence photomicroscopic images are
shown on the left and corresponding phase contrast images on
the right. Original magnification, 500 ×.
[View Larger Version of this Image (103K GIF file)]
Fig. 8.
Two-dimensional phosphopeptide patterns of
full-length TAL1 protein and corresponding Ser172 to Ala
mutant. COS cells coexpressing catalytic subunit of PKA and
full-length TAL1 protein (left) or the corresponding
Ser172 to Ala mutant (middle) were metabolically
labeled with [32P]orthophosphate. Murine erythroleukemia
(MEL) cells (right) cultured with
8-(4-chlorophenylthio)-adenosine 3
:5
-cyclic monophosphate and
theophylline were similarly labeled. TAL1 proteins were
immunoprecipitated from cellular extracts with polyclonal anti-TAL1
antibody, resolved on an 8% SDS-polyacrylamide gel, transferred to a
PVDF membrane, and subjected to chymotryptic digestion. Radiolabeled
proteolytic fragments were subjected to two-dimensional phosphopeptide
analysis as described under "Experimental Procedures" and
visualized by phosphorimaging. Major proteolytic fragment containing
Ser172 is denoted with an arrow. Equivalent
amounts of radioactivity were applied to cellulose thin layer
chromatography plates for the two COS cell digests.
[View Larger Version of this Image (68K GIF file)]
:5
-cyclic monophosphate and the
phosphodiesterase inhibitor theophylline (Fig. 8C). This
result demonstrates that Ser172 also undergoes
phosphorylation in cells in which the protein would normally be
expressed.
*
This work was supported in part by United States Public
Health Service Grant R29 HL49118 (to S. J. B.) and by the Lucille P. Markey Charitable Trust (to S. J. B.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Division of
Hematology, Rm. 547 MRB II, Vanderbilt University Medical Center, Nashville, TN 37232. Tel.: 615-936-1809; Fax: 615-936-1812.
1
The abbreviations used are: HLH,
helix-loop-helix; bHLH, basic domain helix-loop-helix; PKA,
cAMP-dependent protein kinase; MBP, maltose binding
protein; PAGE, polyacrylamide gel electrophoresis; EMSA,
electrophoretic mobility shift assay; PVDF, polyvinylidene difluoride.
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
This article has been cited by other articles:
![]() |
A. Palamarchuk, A. Efanov, V. Maximov, R. I. Aqeilan, C. M. Croce, and Y. Pekarsky Akt Phosphorylates Tal1 Oncoprotein and Inhibits Its Repressor Activity Cancer Res., June 1, 2005; 65(11): 4515 - 4519. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Palozza, S. Serini, N. Maggiano, G. Tringali, P. Navarra, F. O. Ranelletti, and G. Calviello {beta}-Carotene Downregulates the Steady-State and Heregulin-{alpha}-Induced COX-2 Pathways in Colon Cancer Cells J. Nutr., January 1, 2005; 135(1): 129 - 136. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kotzka, S. Lehr, G. Roth, H. Avci, B. Knebel, and D. Muller-Wieland Insulin-activated Erk-mitogen-activated Protein Kinases Phosphorylate Sterol Regulatory Element-binding Protein-2 at Serine Residues 432 and 455 in Vivo J. Biol. Chem., May 21, 2004; 279(21): 22404 - 22411. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Herblot, P. D. Aplan, and T. Hoang Gradient of E2A Activity in B-Cell Development Mol. Cell. Biol., February 1, 2002; 22(3): 886 - 900. [Abstract] [Full Text] [PDF] |
||||
![]() |
C Porcher, E. Liao, Y Fujiwara, L. Zon, and S. Orkin Specification of hematopoietic and vascular development by the bHLH transcription factor SCL without direct DNA binding Development, January 10, 1999; 126(20): 4603 - 4615. [Abstract] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||