JBC Oz Biosciences

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Reid, R. J. D.
Right arrow Articles by Bjornsti, M.-A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reid, R. J. D.
Right arrow Articles by Bjornsti, M.-A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 18, Issue of May 2, 1997 pp. 12091-12099
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Camptothecin Sensitivity Is Mediated by the Pleiotropic Drug Resistance Network in Yeast*

(Received for publication, November 22, 1996, and in revised form, February 24, 1997)

Robert J. D. Reid Dagger , Eunkyung A. Kauh and Mary-Ann Bjornsti §

From the Department of Biochemistry and Molecular Pharmacology, Thomas Jefferson University, Philadelphia, Pennsylvania 19107

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

The antineoplastic alkaloid camptothecin interferes with the catalytic cycle of DNA topoisomerase I rendering it a cellular poison. Camptothecin stabilizes a covalent enzyme-DNA intermediate that is converted into lethal double strand DNA lesions during S phase of the cell cycle. Yeast SCT1 mutants were isolated in a screen for mutations in genes other than TOP1 that result in camptothecin resistance. Here we report SCT1 is allelic to PDR1 and that a Thr-879 to Met substitution in the PDR1-101 transcription factor confers multiple drug resistance. PDR1 regulates the expression of several gene products including the ATP-binding cassette transmembrane transport proteins PDR5, YOR1, and SNQ2. The PDR1 T879M mutant increased PDR5 transcription compared with wild-type PDR1 strains. Deletion of PDR1 or the downstream effector SNQ2 increased cell sensitivity to camptothecin, whereas deletion of YOR1 or PDR5 had little effect on camptothecin sensitivity. However, the camptothecin resistance accompanying GAL1-promoted overexpression of PDR5 suggests some substrate promiscuity among the ATP-binding cassette transporters. These data underscore the role of the pleiotropic drug resistance network in regulating camptothecin toxicity and are consistent with a model of decreased intracellular concentrations of camptothecin resulting from the increased expression of the SNQ2 transporter.


INTRODUCTION

Eukaryotic DNA topoisomerase I is a highly conserved enzyme that catalyzes changes in DNA topology during such processes as transcription and DNA replication (reviewed in Refs. 1-4). The enzyme transiently nicks and religates a single strand of duplex DNA, resulting in the relaxation of positively or negatively supercoiled DNA. This reaction is characterized by the formation of a covalent linkage between the active site tyrosine and the 3'-phosphate of the cleaved DNA strand, which conserves the energy of the broken phosphodiester bond in the DNA backbone. Thus, an exogenous energy source is not required for completion of the catalytic cycle.

Camptothecin is a potent anti-tumor drug that specifically targets DNA topoisomerase I by reversibly stabilizing a covalent enzyme-DNA intermediate (reviewed in Refs. 2, 4-7). In the yeast Saccharomyces cerevisiae, DNA topoisomerase I has been shown to constitute the cellular target of the drug (8-14). Yeast strains deleted for TOP1 (top1Delta )1 are camptothecin-resistant; however, the cytotoxic response of these top1Delta strains to camptothecin is restored by the expression of yeast or human TOP1 from plasmid-borne sequences (8, 12, 13). Formation of the ternary drug-enzyme-DNA complexes alone is insufficient to cause cell death. Studies with DNA synthesis inhibitors suggest that the collision of DNA replication forks with the drug-stabilized covalent intermediates produces double-stranded DNA breaks, which in turn result in cell cycle arrest in G2 phase and cell death (reviewed in Refs. 2 and 5). Other mammalian cell responses to camptothecin treatment include an inhibition of DNA synthesis (15, 16) and the increased expression of DNA damage responsive genes, such as p53 and p21 (17, 18). The increased expression of the yeast DNA damage-inducible genes DIN3 and RNR3 in response to camptothecin treatment and the camptothecin hypersensitivity of yeast cells defective in DNA double strand break repair, due to deletion of RAD52, suggest a conserved mechanism of drug-induced DNA damage and repair (reviewed in Refs. 9 and 11).

Camptothecin resistance in mammalian cells typically results from a decrease in DNA topoisomerase I activity or the expression of TOP1 mutants that produce a camptothecin-resistant enzyme (10, 19-21); although, two recent reports of camptothecin-resistant cell lines are intriguing because they suggest alternative mechanisms of drug resistance (22, 23). Mammalian cells overexpressing the ATP-binding cassette (ABC) transporter MDR1 acquire resistance to several important anticancer drugs including taxol, doxorubicin, amsacrine, and etoposide (24) but are not resistant to camptothecin or the analogues 10-hydroxycamptothecin and 10,11 methylenedioxycamptothecin (25-27). MDR1 overexpression confers an approximate 10-fold resistance to topotecan, SN-38, and 9-aminocamptothecin in cultured cells; however, no difference in tumor clearing is evident in animal models (25).

We recently developed a yeast genetic screen to identify mutations in genes other than TOP1 that suppress the cytotoxic action of camptothecin (14). We reported the isolation of several dominant SCT1 mutants that abrogated the cytotoxic action of camptothecin and the terminal G2-arrested phenotype, although the cells expressed high levels of wild-type DNA topoisomerase I. However, these SCT1 mutants were unable to suppress the camptothecin sensitivity accompanying human DNA topoisomerase I expression and remained sensitive to UV and x-ray-induced DNA damage.

In this study, we report that the camptothecin resistance of the SCT1 mutants results from a dominant mutation in PDR1, which encodes a transcription factor that regulates the expression of a large family of gene products responsible for pleiotropic drug resistance in yeast (reviewed in Ref. 28). Downstream targets of PDR1 include the ABC transporters PDR5, YOR1, and SNQ2 (28-30) that belong to the same transporter superfamily as mammalian MDR1. Our results show that camptothecin sensitivity in yeast is also modulated by the PDR1 regulatory network, primarily through SNQ2. Although the related PDR5 transporter was not required for camptothecin resistance, overexpression of PDR5 from the GAL1 promoter was sufficient to confer camptothecin resistance in wild-type PDR1 strains. The promiscuous nature of pleiotropic drug resistance in yeast suggests that the increased expression of other, as yet, undefined ABC transporters might also affect the activity of camptothecin analogues in human tumor cells.


EXPERIMENTAL PROCEDURES

Materials

Camptothecin, cycloheximide, and oligomycin were obtained from Sigma. Camptothecin was dissolved in dimethyl sulfoxide (Me2SO) at 4 mg/ml. Cycloheximide and oligomycin were dissolved at a final concentration of 1 mg/ml in water and ethanol, respectively. Aliquots of each were stored at -20 °C.

Plasmids and Strains

The plasmids and yeast strains used in these studies are described in Tables I and II, respectively. Except as noted, all strains were derived from parent strains FY250 and FY251. Due to differences in DNA sequence, the wild-type PDR1 allele in plasmid pSK-PDR1I, isolated from strain IL125-2B,2 is designated PDR1I and that isolated from the parent strain of EKY3 (FY250) is designated PDR1E. The PDR1E allele was isolated by the gap repair method of Rothstein (31). First, the ApaI site in the polylinker of plasmid YCpPDR1-101-T was excised by digesting with KpnI and SalI, repairing the ends with T4 DNA polymerase and ligating the blunt ends. The plasmid was then digested with ApaI and SacII, and the 6350-kb plasmid backbone with flanking PDR1 sequence was transformed into FY250 by the lithium acetate procedure (32). Following selection for tryptophan prototrophs, the YCpPDR1E plasmid was recovered by vortexing the cells in the presence of phenol and glass beads (33). The identity of the gap-repaired PDR1E and PDR5 sequences (in plasmid YCpPDR5, Table I) was confirmed by detailed restriction enzyme mapping and sequence analysis of the purified plasmid DNA.

Table I. Plasmids


Plasmid Characteristic(s) Ref.

YEp24-PL URA3, 2-µm ARS, multiple cloning site. Made by ligating a 173-bp BssHII fragment containing the multiple cloning site from pBluescript II into the SmaI-PvuII sites of YEp24 (60). This study
YEpSCT1-1 (YEp-clone1) SCT1-1, URA3, 2-µm ARS. Isolated from a YEp24-PL based genomic library, made from strain EKY7, following electroporation into strain EKY5 and selection on camptothecin containing medium. This study
YCpSCT1-1 (YCp-clone1) SCT1-1, URA3, CEN6, ARSH4. A 6.4-kb BamHI genomic fragment from YEpSCT1-1 was ligated into the BamHI site of pRS416 (61). This study
YCpGPD-TOP1 pGPD-TOP1, URA3, CEN6, ARSH4. TOP1 expressed from the constitutive GPD promoter in pRS416 (61). 14
YCpGPD-TOP1-L pGPD-TOP1, LEU2, CEN6, ARSH4. Made by ligating a 4-kb EagI-XhoI fragment containing pGPD-TOP1 into the same sites in pRS415 (61). This study
YCpGAL1-TOP1-L pGAL1-TOP1, LEU2 CEN6, ARSH4. TOP1 expressed from the galactose-inducible GAL1 promoter. 41
YIpSCT1-1 (YIp-clone1) SCT1-1, URA3. An integrating vector made by ligating the 6.4-kb SalI-NcoI SCT1-1 fragment from YCpSCT1-1 into the integrating vector, pRS406 (61). This study
YCpPDR1-101 PDR1-101, URA3, CEN6, ARSH4. Constructed by removing a 1.5-kb SacI fragment of ERG4 from YCpSCT1-1. This study
YCpPDR1-101-T PDR1-101, TRP1, CEN6, ARSH4. A 5-kb SacI-BamHI fragment from YCpPDR1-101 was subcloned into pRS414 (61). This study
pSK-PDR1I PDR1I in pBluescript. J. Golin (Catholic University)
YCpPDR1IT PDR1I, TRP1, CEN6, ARSH4. 5-kb SacI-BamHI fragment bearing PDR1I from pSK-PDR1I cloned into pRS414. This study
YCpPDR1ET PDR1E, TRP1, CEN6, ARSH4. Contains PDR1E gap-repaired from yeast strain FY250 (see "Experimental Procedures"). This study
pKO-pdr1::URA3 pdr1Delta 1::URA3 (see "Experimental Procedures"). This study
pKO-pdr5::URA3 pdr5Delta 1::URA3 (see "Experimental Procedures"). This study
YCpPDR5 PDR5, URA3, CEN6, ARSH4. A 6-kb PDR5 fragment, PCR-amplified from FY250 genomic DNA, using primers 5'-CGTGTATTTCGCTGCTTAGGAAAG and 5'-TGAGAAGACGGTTCGCCATTC, was subcloned into pBluescript, excised in a SacI-KpnI fragment, and ligated into pRS416. This vector was digested with AvrII and BglII, transformed into strain EKY3, and the gap-repaired PDR5 plasmid was recovered. This study
YCpGAL1-L pGAL1, LEU2, CEN6, ARSH4. GAL1 promoter cloned into pRS415. 41
YCpGAL1-PDR5-L pGAL1-PDR5, LEU2, CEN6, AR5H4. A 460-bp fragment containing a BamHI site upstream of the 5' coding region of PDR5 was PCR-amplified with primers 5'-CGTGGATCCGACTTTAGACAAAAATGCCCGAGG and 5'-TGATAGGCGACATCTGCGGAAG, and ligated into the BamHI-SmaI sites of YCpGAL1-L. The 3'-PDR5 sequences were introduced in a Bsy36I and KpnI fragment from YCpPDR5. This study
pEAE9 snq2Delta ::hisG-URA3-hisG, SNQ2 disruption plasmid. W. S. Moye-Rowley (University of Iowa)
pDK30 yor1Delta ::hisG-URA3-hisG, YOR1 disruption plasmid. 29

Table II. Strains


Strain Genotype Reference

FY250 MATalpha , ura3-52, his3Delta 200, leu2Delta 1, trp1Delta 63 F. Winston (Harvard University)
EKY2 MATa, ura3-52, his3Delta 200, leu2Delta 1, trp1Delta 63, top1::HIS3 14
EKY3 MATalpha , ura3-52, his3Delta 200, leu2Delta 1, trp1Delta 63, top1::TRP1 14
EKY5 MATa, ura3-52, his3Delta 200, leu2Delta 1, trp1Delta 63, top1::(GPD-TOP1, HIS3) 14
EKY7 MATa, ura3-52, his3Delta 200, leu2Delta 1, trp1Delta 63, top1::TRP1, PDR1-101 14
EKY8 MATa, ura3-52, his3Delta 200, leu2Delta 1, trp1Delta 63, top1::TRP1, PDR1-102 14
EKY9 MATalpha , ura3-52, his3Delta 200, leu2Delta 1, trp1Delta 63, top1::TRP1, PDR1-104 14
JG200 MATa, PDR1, leu2, his3, can1-100 J. Golin (Catholic University)
JG204 MATa, PDR1-7, leu2, his3, can1-100 J. Golin
JN394t2-4 MATa, ade1, ura3-52, leu2, trp1, his7, tyr1, top2-4ts, ISE2, rad52::LEU2 (YCpD1TOP2) 50
RRY4-3 MATalpha , ura3-52, his3Delta 200, leu2Delta 1, trp1Delta 63, top1::TRP1, DIN3::pDIN3-lacZ-URA3 This work
RRY5-3 MATa, ura3-52, his3Delta 200, leu2Delta 1, trp1Delta 63, top1::TRP1, PDR1-101, DIN3::pDIN3-lacZ-URA3 This work
RRY9-1 MATa, ura3-52, his3Delta 200, leu2Delta 1, trp1Delta 63, top1::TRP1, SCT1-1, clone 1 int::URA3 This work
RRY14 MATalpha , ura3-52, his3Delta 200, leu2Delta 1, trp1Delta 63, top1::TRP1, pdr5Delta 1::URA3 This work
RRY18 MATa, ura3-52, his3Delta 200, leu2Delta 1, trp1Delta 63, top1::TRP1, PDR1-101, pdr5Delta 1::URA3 This work
RRY19 MATa, ura3-52, his3Delta 200, leu2Delta 1, trp1Delta 63, top1::TRP1, PDR1-102, pdr5Delta 1::URA3 This work
RRY21 MATalpha , ura3-52, his3Delta 200, leu2Delta 1, trp1Delta 63, top1::TRP1, pdr1Delta 1::URA3 This work
RRY22 MATa, ura3-52, his3Delta 200, leu2Delta 1, trp1Delta 63, top1::TRP1, pdr1-101Delta 1::URA3 This work
RRY23 MATa, ura3-52, his3Delta 200, leu2Delta 1, trp1Delta 63, top1::TRP1, pdr1-102Delta 1::URA3 This work
RRY24 MATalpha , ura3-52, his3Delta 200, leu2Delta 1, trp1Delta 63, top1::TRP1, pdr1-104Delta 1::URA3 This work
RRY29 MATalpha , ura3-52, his3Delta 200, leu2Delta 1, trp1Delta 63, top1::TRP1, yor1Delta 1 This work
RRY30 MATalpha , ura3-52, his3Delta 200, leu2Delta 1, trp1Delta 63, top1::TRP1, snq2Delta 1 This work
RRY31 MATa, ura3-52, his3Delta 200, leu2Delta 1, trp1Delta 63, top1::TRP1, PDR1-101, yor1Delta 1 This work
RRY32 MATa, ura3-52, his3Delta 200, leu2Delta 1, trp1Delta 63, top1::TRP1 PDR1-101, snq2Delta 1 This work

Plasmid pKO-pdr1::URA3, which contains pdr1Delta 1::URA3, was made by digesting plasmid YCpPDR1-101-T with BclI, repairing the ends with T4 DNA polymerase, and purifying the 6.8-kb DNA backbone. This was ligated to a 1.6-kb BamHI fragment with repaired ends, which was excised from plasmid YDpU (34) and contains the URA3 gene. The resulting plasmid, with URA3 inserted in the opposite orientation of the PDR1 promoter, was digested with SacI and KpnI, and a 3-kb fragment containing pdr1[/delta]1::URA3 was used for single step gene replacement (31). Deletion of PDR1 in the resulting uracil prototrophs was confirmed by screening for increased cycloheximide sensitivity and by PCR using primers 5'-GAGACAATGGTTGACCTTTTGTCC and 5'-ACGCCCTTATACTGTCCAGTTGAG that flank the integration site.

Plasmid pKO-pdr5::URA3 was constructed in several steps. First, the PDR5 gene was PCR-amplified from FY250 genomic DNA using primers 5'-CGTGTATTTCGCTGCTTAGGAAAG and 5'-TGAGAAGACGGTTCGCCATTC and the GeneAmp XL kit (Perkin-Elmer). The resulting 6-kb fragment was treated with T4 DNA polymerase and T4 polynucleotide kinase, ligated to ApaI DNA linkers as per the manufacturer's instructions (New England Biolabs), and ligated into the ApaI site of pBluescriptII-KS(+) to give plasmid pBlue-PDR5. The coding and 5'-noncoding sequences of PDR5, between internal BglII and MscI sites, were excised. Blunt ends, prepared by treatment with T4 DNA polymerase, were ligated to the 1.6-kb URA3 fragment described above. The pdr5Delta 1::URA3 sequences were then excised from pKO-pdr5::URA3 in a 3-kb SacI and KpnI fragment and used to generate the pdr5Delta 1 strains indicated in Table II. The URA+ transformants were examined for increased cycloheximide sensitivity, and integrations were confirmed by PCR using primers 5' TGCAAAGGAATGGCAACTGAG and 5' GCCGTATATGAGAAGACGGTTCG that flank the integration site.

Construction of a Genomic DNA Library from Strain EKY7 and Isolation of SCT1-1

To identify the dominant mutation conferring camptothecin resistance in SCT1 mutant strains, a genomic DNA library was constructed from SCT1-1 strain EKY7 (Table II) using a modified version of that described by Rose and Broach (35). Briefly, EKY7 cells were grown in YPD, converted to spheroplasts, and lysed as described. The extracts were then sequentially treated with RNase and proteinase K. Following extraction with chloroform/isoamyl alcohol (24:1), the DNA was fractionated by CsCl gradient centrifugation and collected in 1-ml fractions. 10-µl aliquots were analyzed in 0.6% agarose gels, and the most viscous fractions containing high molecular weight DNA were pooled, dialyzed against TE buffer (0.1 M Tris, pH 8.0, 10 mM Na2EDTA), ethanol-precipitated, and resuspended in TE buffer. 25 µg of genomic DNA was partially digested with BamHI, under conditions that maximized the yield of DNA fragments in the 8-12-kb size range. Digestion was terminated by the addition of a final 25 mM Na2EDTA and 0.2 M NaCl. The DNA fragments were then pooled, phenol-extracted, ethanol-precipitated, and resuspended in TE at a final concentration of 0.3 mg/ml.

Approximately 10 µg of YEp24-PL DNA (Table I) was digested to completion with BamHI and dephosphorylated by incubation with calf intestinal alkaline phosphatase (1 unit of calf intestinal alkaline phosphatase/pmol of DNA ends). After phenol extraction and ethanol precipitation the DNA was resuspended in TE, pH 7.5. The DNA library was constructed by ligating 5 µg of the partially digested genomic DNA with equimolar amounts of the dephosphorylated YEp24-PL DNA. The multicopy genomic DNA library was amplified using SURE cells (Stratagene) and CsCl-purified (36). Based on restriction enzyme digestion of representative plasmid DNAs obtained from single bacterial transformants, the average insert size was approximately 6 kb, and 50% of the vectors contained insert DNA.

The genomic library DNA was electroporated into EKY5 cells, in which pGPD-TOP1 was integrated into the chromosome at the TOP1 locus (Table II), using a Bio-Rad Gene Pulser (37). The constitutive high levels of TOP1 expression from the GPD promoter were necessary to score cell sensitivity to camptothecin (14). Following electroporation, the cells were plated on SC-uracil, histidine media containing M sorbitol, 25 mM HEPES, pH 7.2, 10 µg/ml camptothecin, and a final 0.25% Me2SO. The plasmids were recovered from the drug-resistant colonies (33), and the DNA inserts were excised and subcloned into the BamHI site of plasmid pRS416. Plasmid YCp-clone1 (YCpSCT1-1 in Table I) consistently conferred camptothecin resistance upon transformation into TOP1 expressing yeast cells.

Plasmid YIp-clone1 was constructed (Table I), linearized at a unique Bsu36I site within the insert, and transformed into EKY7 to target integration to the chromosomal position of the clone 1 sequences. The resulting strain, RRY9-1 (Table II), was mated with EKY1 and sporulated. The meiotic products of 26 tetrads were grown, transformed with YCpGPD-TOP1, and examined for co-segregation of camptothecin resistance and uracil prototrophy. SCT1-1 was then localized to chromosome VII by hybridizing blots containing the entire yeast genome in ordered, overlapping arrays of lambda clones and cosmids (obtained from ATCC) (38) with a 32P-labeled probe prepared from the 6.4-kb clone 1 insert using the Megaprime kit (Amersham Corp.). This was confirmed by aligning restriction maps of clone 1 DNA with those derived from the published sequence of the centromere-proximal left arm of chromosome VII (39). The C-terminal 800 bp of the PDR1I, PDR1E, and PDR1-101 alleles were sequenced using primers F1 (5'-CCAACCTCGATGTTATCTCC), F2 (5'-CGCAACCAACAAATGGG), R1 (5'-GAGAAGGAGATCGCCCTAG), and R2 (5'-GGACTTGCGAATTATTTTGCCC) on an Applied Biosystems Sequencer by cycle sequencing.

beta -Galactosidase Assays

RRY4-3 and RRY5-3 cells (Table II), transformed with plasmid YCpGPD-TOP1-L, were grown in SC-leucine media supplemented with 25 mM HEPES, pH 7.2. At an A595 = 0.3, the cultures were treated with 100 µM camptothecin or Me2SO alone. At the times indicated, aliquots were taken, and beta -galactosidase activity was assayed in crude cell extracts as described (40). Briefly, the cells were concentrated and lysed by vortexing with glass beads, and extracts were clarified by centrifugation. Cleavage of o-nitrophenyl beta -D-galactopyranoside was measured by absorbance at 420 nm, and beta -galactosidase activity was calculated as A420 × assay volume/0.0045 × total protein concentration × extract volume × time. Protein concentrations were determined with the Bio-Rad dye reagent as per the manufacturer's recommendations.

Drug Sensitivity

To assay yeast cell sensitivity to cycloheximide, oligomycin, or camptothecin, overnight cultures were serially 10-fold diluted, and 5-µl aliquots were spotted onto the appropriate selective agar plates containing the indicated drug concentrations. Oligomycin sensitivity was assessed on YP glycerol plates, and plates containing camptothecin were buffered with 25 mM HEPES, pH 7.2, and contained a final 0.125% Me2SO as described (41, 42).

Hybridization Analysis

For Northern blots, total yeast RNA was prepared by mechanical shearing of the cells as described previously (43). Briefly, 40 ml of exponentially growing cells in SC-uracil media, or cells induced for 8 h with a final 2% galactose in SC-uracil plus raffinose media, were washed and resuspended in 300 µl of RNA buffer (200 mM Tris, pH 7.0, 500 mM NaCl, and 10 mM EDTA). 300 µl of unbuffered, H2O-saturated phenol/chloroform and 250 µl of acid-washed glass beads were added and the cell suspensions vortexed 10 min at 4 °C. Following the addition of 300 µl of RNA buffer, the cell debris and glass beads were removed by centrifugation. The aqueous phase was extracted two more times with H2O-saturated phenol/chloroform. The RNA was then ethanol-precipitated and resuspended in 50 µl of RNA buffer.

Northern hybridization analysis was performed as described (44) using 10 µg of total RNA electrophoresed in a 1% agarose, 6% formaldehyde gel. Probes were labeled by random priming using the Megaprime kit (Amersham Corp.) and hybridized at 65 °C in buffer containing 5% (w/v) SDS, 0.5 mM sodium phosphate, pH 7.0, and 1% bovine serum albumin (45). The blots were washed repeatedly in 5% SDS, 40 mM sodium phosphate and once in 1% SDS, 40 mM sodium phosphate (45). The bands were visualized by autoradiography and quantitated using a Molecular Dynamics PhosphorImager.


RESULTS

Induction of DNA Damage in Camptothecin-treated SCT1-1 Strains

We previously developed a yeast genetic screen to identify the cellular factors that participate in the process of camptothecin-induced cell killing (14). Dominant camptothecin-resistant SCT1 mutants were isolated that express wild-type DNA topoisomerase I, yet suppress the terminal G2-arrested phenotype and cell lethality induced by drug treatment of wild-type strains. In contrast, the camptothecin sensitivity of SCT1 mutants expressing human DNA topoisomerase I is not suppressed at high drug concentrations (14).

To resolve this discrepancy, we first examined the cytotoxic response of yeast cells expressing the yeast or human enzyme, over a range of drug concentrations. In experiments with decreasing concentrations of camptothecin, top1Delta strains expressing human DNA topoisomerase I from the GAL1 promoter on a single copy vector were approximately 50-fold more sensitive than the same strains expressing yeast TOP1 (data not shown). Similar levels of cell killing were apparent at drug concentrations of 0.1 µg/ml with human TOP1 expressing cells versus 5 µg/ml for cells expressing the yeast enzyme. However, less than a 10-fold increment in the camptothecin sensitivity of the human enzyme was detected in DNA cleavage assays in comparisons of yeast and human DNA topoisomerase I purified from the same strains (41, 42, and data not shown). These data suggest that differences in the in vivo activity of the endogenous and heterologous enzymes in yeast might render human DNA topoisomerase I a more potent poison in the presence of camptothecin. This is consistent with the limited resistance of SCT1-1 mutants expressing human TOP1 observed at lower doses of camptothecin, in comparisons with isogenic wild-type strains (data not shown).

A reduction in the levels of camptothecin-induced DNA damage in SCT1-1 cells was evident in assays of DNA damage-inducible gene expression. Yeast cells carrying an integrated bacterial lacZ gene fused to the damage-inducible DIN3 and RNR3 promoters express beta -galactosidase in response to DNA damage induced by UV, methyl methanesulfonate, and camptothecin (12, 46). In the present studies, DIN3-lacZ reporter constructs were integrated into the genome of SCT1-1 and wild-type SCT1+ strains to yield strains RRY4-3 and RRY5-3 (Table II). These cells were transformed with an ARS/CEN vector expressing TOP1 from the constitutive GPD promoter, YCpGPD-TOP1 (Table I) (14), and treated with 100 µM camptothecin, and the levels of beta -galactosidase activity were assayed over time. As shown in Fig. 1, SCT1-1 strains expressed approximately 50% of the beta -galactosidase activity of isogenic SCT1+ strains over a 9-h period following camptothecin treatment. beta -Galactosidase activity in control cultures treated with Me2SO was negligible. Similar results were obtained using the damage-inducible RNR3-lacZ fusions (data not shown). Consistent with these data, the camptothecin sensitivity of SCT1-1 cells expressing yeast TOP1 was restored when the cells' ability to repair double-stranded DNA breaks was impaired by disrupting the RAD52 gene (data not shown). rad52Delta strains are deficient in the recombinational repair of double-stranded DNA breaks and, as such, are hypersensitive to low doses of camptothecin (8, 12). Thus, drug-induced DNA damage does occur in the SCT1-1 mutant strain, albeit at levels tolerated in the presence of functional RAD52.


Fig. 1. Camptothecin treatment induces DNA damage in SCT1-1 cells. Strains RRY4-3 (SCT1+, DIN3::pDIN3-lacZ-URA3 (square ) and RRY5-3 (SCT1-1, DIN3::pDIN3-lacZ-URA3) (open circle ) were transformed with YCpGPD-TOP1-L and grown in SC-uracil, leucine dextrose media supplemented with 25 mM HEPES, pH 7.2. Overnight cultures were diluted to A595 = 0.3 and treated with 100 µM camptothecin (filled symbols) or 0.9% Me2SO alone (open symbols) as a control. Aliquots were collected at the indicated times for beta -galactosidase assays as described under "Experimental Procedures." beta -Galactosidase activities shown represent the average of two experiments for each treatment.
[View Larger Version of this Image (16K GIF file)]

Cloning and Characterization of PDR1-101 from SCT1-1 Cells

To identify the dominant mutation responsible for the camptothecin resistance of the SCT1 mutants, a 2-µm vector based DNA library was constructed with a partial BamHI digest of genomic DNA purified from strain EKY7 (Table II). To simplify screening for camptothecin-resistant transformants, the library DNA was electroporated into the wild-type SCT1+ strain, EKY5, which also contains a GPD-promoted TOP1 construct integrated into the chromosome. The constitutive expression of TOP1 in these cells results in a 104-fold drop in cell viability in the presence of camptothecin, which obviates the need for a second plasmid expressing DNA topoisomerase I. Over 50,000 transformants were screened for camptothecin resistance, by replica plating onto media containing drug or Me2SO alone. One vector, YEp-clone1 (Table I), contained a 6.4-kb DNA fragment (Fig. 2A) that also conferred camptothecin resistance when the genomic DNA insert was subcloned into an ARS/CEN vector (YCp-clone1) (Fig. 3).


Fig. 2. The camptothecin resistance of SCT1-1 cells results from a mutation in PDR1. A, a map of plasmid pClone1. Several unique restriction enzyme sites within the genomic insert are labeled, and open reading frames are represented as boxes. A SacI-BamHI restriction fragment was subcloned to make plasmid YCpPDR1-101-T. Chimeric plasmids containing DNA fragments derived from PDR1-101 (solid bars) and PDR1I (open bars) were used to delineate the region of PDR1-101 sufficient for camptothecin resistance following transformation of wild-type PDR1E strains expressing TOP1. Plasmids conferring drug resistance are indicated with a plus sign, and plasmids that did not are indicated with a minus sign. B, the C-terminal amino acid sequence of proteins encoded by the PDR1I, PDR1E, and PDR1-101 alleles. Differences between sequences are indicated by bullet . The number scheme is based on the PDR1I allele. The double underlined M at position 879 is the amino acid substitution in the PDR1-101 allele responsible for the drug-resistant phenotype.
[View Larger Version of this Image (32K GIF file)]


Fig. 3. Increased dosage of wild-type PDR1 sequences increases yeast cell resistance to cycloheximide but not camptothecin. Strain EKY1 (PDR1E) was cotransformed with TOP1 expression vector YCpGPD-TOP1-L and the indicated plasmids. Duplicate transformant colonies were grown overnight, and serially 10-fold diluted and 5-µl aliquots were spotted on SC-uracil, leucine dextrose or SC-tryptophan, leucine dextrose plates containing 25 mM HEPES, pH 7.2, and Me2SO (DMSO) (0.125% final concentration), 5 µg/ml camptothecin (in 0.125% Me2SO) or 0.25 µg/ml cycloheximide.
[View Larger Version of this Image (81K GIF file)]

The genetic identity of clone 1 as SCT1 was confirmed by integrating the DNA into the chromosome of SCT1-1 strain EKY7 with the URA3 marked plasmid YIpSCT1-1 (YIp-clone1, Table I). This strain was mated to wild-type SCT1+ strain EKY1, sporulated, and the spores tested for camptothecin sensitivity and for growth in the absence of uracil. The integrated URA3 marker co-segregated with the camptothecin-resistant phenotype in 23 of 26 tetrads examined, indicating linkage between clone 1 and SCT1-1. Tetratypes were identified as 3:1 segregation of camptothecin resistance in which one camptothecin-resistant haploid was auxotrophic for uracil. A map distance of 5.8 centimorgans between clone 1 and SCT1-1 was due to the presence of the intervening URA3 sequences.

The 6.4-kb genomic DNA was mapped to the centromere-proximal left arm of chromosome VII by probing a panel of yeast lambda clones and cosmids containing the complete yeast genome (ATCC). A comparison of the clone 1 restriction map with the restriction maps derived from published sequences (39) revealed the presence of complete ERG4 and PDR1 genes, as well as portions of SCL1 and open reading frame YGL023 (Fig. 2A). Yeast PDR1 mutants display a semidominant pleiotropic drug-resistant phenotype to such structurally diverse drugs as cycloheximide and oligomycin (28, 47). To determine if PDR1 was responsible for the drug-resistant phenotype, a 1.6-kb SacI fragment was removed from clone 1 to delete over half of the ERG4 gene. The plasmid YCpPDR1-101-T was then cotransformed with YCpGPD-TOP1 into a wild-type yeast strain, and the transformants were tested for drug sensitivity (Fig. 3). The pattern of camptothecin resistance in cells containing clone 1 or PDR1-101 sequences was identical. In comparison with the vector control, the increased copy number of the wild-type PDR1I allele produced only a slight increment in cycloheximide resistance. Thus, the camptothecin-resistant phenotype of SCT1-1 cells results from a dominant mutation in PDR1-101.

Regulation of Camptothecin Sensitivity by PDR1

To identify the specific lesion, DNA fragments spanning the PDR1-101 allele were used to replace the corresponding sequences in wild-type PDR1I (obtained from Dr. John Golin, Catholic University) in plasmid YCpPDR1I. As shown in Fig. 2A, plasmids containing the C-terminal end of PDR1-101 conferred camptothecin resistance. In Fig. 2B, a comparison of PDR1-101 and PDR1I sequences spanning this region indicated four differences: a C to T transition at nucleotide 2636 resulting in a Thr-879 to Met substitution, a T to C transition at nucleotide 3218 resulting in a Ile-921 to Thr substitution, a T to A transversion at 3397 resulting in a Ser-981 to Thr substitution and an additional 15 nucleotides inserting five Asn residues after residue Ile-1010. Since the PDR1 locus exhibits strain-specific differences,2 the wild-type PDR1E allele was recovered from the EKY3 progenitor strain, FY250, by gap repair of the plasmid-borne PDR1-101 allele. As with PDR1I, transformation of EKY1 cells with the plasmid-encoded wild-type PDR1E allele produced a slight decrease in cycloheximide sensitivity yet did not confer camptothecin resistance (Fig. 3). While higher levels of PDR1E expression from the GAL1 promoter did enhance the cycloheximide resistance of the cells, there was no effect on camptothecin-induced cytotoxicity (data not shown). Thus, the camptothecin-resistant phenotype was the direct result of mutation(s) in PDR1E. The C-terminal PDR1E and PDR1-101 sequences were identical except for the Thr-879 to Met change (Fig. 2B), which occurs near an asparagine-rich domain that may function in transcriptional activation (48). Replacing the C-terminal PDR1E sequence with sequence from PDR1-101 containing the Thr-879 to Met substitution resulted in a dominant camptothecin-resistant PDR1 allele, confirming that this single point mutation was responsible for the drug-resistant phenotype (data not shown).

The camptothecin-resistant strains EKY7 and EKY8 were also resistant to cycloheximide and oligomycin (Fig. 4), consistent with a model of pleiotropic drug resistance mediated by the increased expression of several target genes. Moreover, this effect is not restricted to dominant mutations near the putative transactivation domain in PDR1-101. A previously reported mutation of residue Pro-298 in PDR1-7 produces a similar pattern of multi-drug resistance (47). This mutation, in strain JG204, was also sufficient to render the cells resistant to camptothecin, in comparison to the isogenic PDR1I strain, JG200 (Fig. 4).


Fig. 4. Dominant PDR1-101, PDR1-102, and PDR1-7 mutant alleles confer resistance to camptothecin, cycloheximide, and oligomycin. Overnight cultures of strains EKY3 (PDR1E), EKY7 (PDR1-101), EKY8 (PDR1-102), JG200 (PDR1I), and JG204 (PDR1-7), transformed with plasmid YCpGPD-TOP1, were serially 10-fold diluted, and 5-µl volumes were spotted onto SC-uracil dextrose plates containing 25 mM HEPES, pH 7.2, and Me2SO (DMSO) (0.125%), 5 µg/ml camptothecin (in 0.125% Me2SO) or 5 µg/ml cycloheximide, or onto YPEG plates containing 0 and 0.8 µg/ml oligomycin.
[View Larger Version of this Image (65K GIF file)]

Etoposide is a potent anti-tumor drug that targets eukaryotic DNA topoisomerase II by stabilizing the covalent enzyme-DNA intermediate (reviewed in Refs. 7 and 49). Mammalian cells overexpressing the ABC transporter MDR1 are resistant to a wide variety of chemotherapeutic agents, including etoposide and taxol (24), but are not resistant to camptothecin and only weakly resistant to the water-soluble camptothecin analogue, topotecan (25-27). Yet, despite the similarities between the downstream targets of PDR1 and the MDR1 encoded P-glycoprotein, the PDR1-101 allele had no obvious effects on yeast cell sensitivity to etoposide (Fig. 5). Strain JN394t2-4 contains a dominant ISE2 mutation that renders cells permeable to etoposide and a single copy plasmid carrying the TOP2 gene fused to a constitutive DED1 promoter to complement the top2-4 ts mutant (50). Following transformation of strain JN394t2-4 with plasmids expressing PDR1E or PDR1-101, the cells were assayed for growth in media containing etoposide. In all cases, 9 h of etoposide treatment produced a 75% reduction in the number of viable cells, in contrast to the 4-fold increase in the number of untreated cells. Nevertheless, the PDR1-101 transformants were resistant to cycloheximide, which is indicative of PDR1-101 function in this strain background (data not shown).


Fig. 5. PDR1-101 does not increase cell resistance to etoposide. Strain JN394t2-4 carrying a TOP2 expression plasmid was transformed with YCpPDR1-101-T (square ), YCpPDR1I-T (open circle ), or pRS414 (triangle ) as a vector control. Duplicate overnight cultures of each transformant were diluted to A595 = 0.2, grown in SC-tryptophan dextrose media to A595 = 0.3, and treated with 100 µg/ml etoposide (filled symbols) or left untreated (open symbols). In all cases, the final Me2SO concentration was 0.5%. At the times indicated, aliquots were serially diluted, plated, and assayed for the number of viable cells forming colonies.
[View Larger Version of this Image (17K GIF file)]

To establish that PDR1 function is absolutely required for the camptothecin resistance of the SCT1 strains, the PDR1 gene sequences were deleted in wild-type PDR1E, and mutant PDR1-101, PDR1-102, and PDR1-104 strains by one-step gene replacement (31). The latter correspond to the SCT1-1, SCT1-2, and SCT1-4 strains, EKY7, EKY8, and EKY9, respectively (14). The resultant strains were transformed with plasmid YCpGPD-TOP1 and assayed for camptothecin sensitivity. As seen in Fig. 6, deletion of the dominant PDR1 alleles not only abolished the camptothecin-resistant phenotype at 5 µg/ml drug but actually increased cell sensitivity to camptothecin (compare the growth of the PDR1E cells with that of the pdr1Delta 1 strains at 1 µg/ml camptothecin). This hypersensitive phenotype of pdr1Delta 1 cells shows that, even in wild-type yeast strains, the PDR1 network is a major determinant of camptothecin metabolism.


Fig. 6. Deletion of PDR1 sequences renders PDR1E and mutant PDR1 strains hypersensitive to camptothecin. Strains EKY3 (PDR1E), EKY7 (PDR1-101), EKY8 (PDR1-102), EKY9 (PDR1-104), RRY21 (pdr1Delta 1), RRY22 (pdr1-101Delta 1), RRY23 (pdr1-102Delta 1), and RRY24 (pdr1-104Delta 1), transformed with YCpGPD-TOP1, were grown overnight, diluted, and spotted onto SC-uracil dextrose plates containing the indicated concentrations of camptothecin in a final 0.125% Me2SO.
[View Larger Version of this Image (69K GIF file)]

The Function of PDR5 in PDR1-101-induced Camptothecin Resistance

The PDR5 gene product (PDR5) is a transmembrane ATPase in the ABC family of transporters (28, 51, 52). PDR5 is overexpressed in PDR1 mutant strains and is the principle effector of cycloheximide resistance (28, 51, 53). The PDR5 gene was disrupted in strains EKY3 (PDR1E) and EKY7 (PDR1-101) to determine the role of PDR5 in mediating the drug-resistant phenotypes. As shown in Fig. 7A, the PDR1E, pdr5Delta 1 strain and the PDR1-101, pdr5Delta 1 strain were both hypersensitive to cycloheximide, in comparison with isogenic PDR5 control strains. However, deletion of PDR5 had no effect on the camptothecin sensitivity of PDR1E or PDR1-101 strains, which suggests that camptothecin is not a good substrate for the PDR5 transporter.


Fig. 7. PDR5 is not required for PDR1-101-induced camptothecin resistance, yet confers drug resistance when overexpressed from the GAL1 promoter. A, strains EKY3 (PDR1E), EKY7 (PDR1-101), RRY14 (PDR1E, pdr5Delta 1), and RRY18 (PDR1-101, pdr5Delta 1), transformed with YCpGPD-TOP1-L, were grown overnight and spotted on SC-leucine dextrose plates containing 25 mM HEPES, pH 7.2, and 0.125% Me2SO, 5 µg/ml camptothecin in 0.125% Me2SO (DMSO) or 0.25 µg/ml cycloheximide. B, strains EKY3 (PDR1E) and EKY7 (PDR1-101) were cotransformed with plasmid YCpGPD-TOP1 and the indicated pGAL1 expression plasmid. Duplicate transformant cultures were grown overnight in SC-uracil, leucine dextrose, and spotted on SC-uracil, leucine plates containing galactose or dextrose, 25 mM HEPES, pH 7.2, and 0.125% Me2SO, 5 µg/ml camptothecin in 0.125% Me2SO or 0.25 µg/ml cycloheximide.
[View Larger Version of this Image (68K GIF file)]

Surprisingly, elevated levels of PDR5 expression from the GAL1 promoter did suppress the camptothecin sensitivity of wild-type PDR1E cells. Plasmid YCpGAL1-PDR5-L or YCpGAL1-L (as a vector control) was transformed into PDR1E and PDR1-101 strains and induced by growth on galactose. In Fig. 7B, overexpression of PDR5 caused a slight defect in cell growth in the absence of drug (compare YCpGAL1-PDR5-L transformants with YCpGAL1-L transformants grown on dextrose and galactose Me2SO plates). Nevertheless, GAL1-induced PDR5 expression in the PDR1E strain conferred resistance to both cycloheximide and camptothecin, at levels comparable to the drug-resistant PDR1-101 mutant containing the YCpGAL1-L control. Consistent with these findings, expression of PDR1-101 produced only a 4-fold increment in PDR5 mRNA levels in comparison with wild-type PDR1I and PDR1E controls (Fig. 8). On the other hand, induction of PDR5 expression from the GAL1 promoter construct resulted in greater than a 16-fold increase in PDR5 mRNA levels, relative to the uninduced control (Fig. 8). Taken together, these data suggest that while camptothecin is a poor substrate for PDR5, elevated levels of PDR5 expression can result in promiscuous transport.


Fig. 8. PDR1-101 increases the level of PDR5 expression. Strain EKY1 was transformed with the indicated PDR1 plasmid. Transformants were grown to A595 = 1.0, and total RNA was prepared, blotted, and hybridized with a PDR5 probe as described under "Experimental Procedures." The probed filter was analyzed using an applied biosystems PhosphorImager. Numbers beneath the bands represent the average band density relative to pRS414 ± the range between duplicate experiments.
[View Larger Version of this Image (28K GIF file)]

PDR1-101-induced Camptothecin Resistance Requires SNQ2

Two other recently characterized downstream targets of PDR1, SNQ2, and YOR1 are required for resistance to 4-nitroquinoline oxide and oligomycin, respectively (28-30). To assess the function of SNQ2 and YOR1 in suppressing camptothecin-mediated cell death, SNQ2 and YOR1 were individually disrupted in PDR1-101 or PDR1E strains (using constructs kindly provided by W. Scott Moye-Rowley). As with PDR5, deletion of YOR1 had little effect on the camptothecin resistance of PDR1-101 cells expressing wild-type DNA topoisomerase I (Fig. 9). In contrast, the camptothecin sensitivity of PDR1-101, snq2Delta 1 cells was close to that of the wild-type PDR1E control at 5 µg/ml. PDR1E, snq2Delta 1 cells also exhibited a hypersensitive phenotype at lower camptothecin concentrations (Fig. 9). Thus, SNQ2 appears to be the primary effector of camptothecin resistance in the PDR1-1E, mutant strains, with minor contributions from other members of the pleiotropic drug resistance network regulated by PDR1.


Fig. 9. SNQ2 is required for PDR1-101-mediated camptothecin resistance. Strains EKY3 (PDR1E), RRY30 (PDR1E, snq2Delta 1), RRY29 (PDR1E, yor1Delta 1), EKY7 (PDR1-101), RRY32 (PDR1-101, snq2Delta 1), and RRY31 (PDR1-101, yor1Delta 1) were transformed with YCpGPD-TOP1, grown overnight, and spotted onto SC-uracil dextrose plates containing 25 mM HEPES, pH 7.2, and the indicated amount of camptothecin in a final 0.125% Me2SO.
[View Larger Version of this Image (59K GIF file)]


DISCUSSION

Camptothecin is a potent antineoplastic agent that reversibly stabilizes the covalent intermediate formed between eukaryotic DNA topoisomerase I and DNA. In drug-treated cells, double strand DNA breaks accumulate resulting in cell cycle arrest in G2 and cell death (reviewed in Refs. 2, 4, and 5). Experiments in yeast support a similar mechanism of drug-induced DNA damage during S phase that leads to a G2-arrested terminal phenotype (9, 11, 14). As TOP1 is nonessential in yeast (54), this genetically tractable system has been exploited to define the cellular processes and structural aspects of DNA topoisomerase I essential for the cytotoxic action of camptothecin. For example, DNA topoisomerase I constitutes the sole cellular target of the drug, as cells deleted for TOP1 are camptothecin-resistant (12, 13). Furthermore, the mechanism of drug-induced cell killing appears to be conserved in that drug sensitivity is restored when plasmid-borne yeast or human TOP1 sequences are expressed in these top1Delta cells (8, 12, 13). Specific amino acid substitutions have also been described in the yeast and human DNA topoisomerase I that render the catalytically active enzymes resistant to the drug (9, 10, 41, 42). In addition, we recently described the isolation of dominant SCT1 mutants that suppressed the cytotoxic activity of camptothecin in yeast, despite the fact that these cells expressed catalytically active, camptothecin-sensitive DNA topoisomerase I (14). In this report, we have identified SCT1-1 as a dominant mutation in PDR1.

PDR1 is the major transcriptional regulator of a network of gene products that respond to cellular toxins (reviewed in Ref. 28). Dominant PDR1 mutations have been reported that confer pleiotropic drug resistance by increasing the expression of target genes that affect drug metabolism (28). These include ABC transporters for which drug or peptide substrates have been defined, including PDR5, YOR1, STE6, and SNQ2 (28-30, 53, 55). Other targets of PDR1 include ABC transporter homologues, whose functions have yet to be determined, membrane-associated proteins, and the glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (28). The regulated expression of this diverse set of genes suggests a general response to toxins and stress that includes drug efflux.

The T879M mutation in PDR1-101 occurs near an asparagine-rich domain that may function similarly to other asparagine-rich transcriptional activators (48). The activation domain of the homologous PDR3 protein is also localized to the C terminus (56). In addition to camptothecin, PDR1-101 cells exhibited resistance to other structurally unrelated drugs, including cycloheximide and oligomycin, suggesting the increased expression of several downstream ABC transporters. Consistent with previous studies (57), the observed cycloheximide resistance of PDR1-101 strains correlated with elevated levels of PDR5 expression and was suppressed in PDR1-101, pdr5Delta strains. However, the camptothecin resistance of these cells was indistinguishable from isogenic PDR-101, PDR5 strains. Instead, the camptothecin resistance phenotype of PDR1-101 cells appeared to be mediated primarily by SNQ2. Deletion of PDR1-101 or SNQ2 sequences not only restored drug sensitivity but actually produced an increase in camptothecin sensitivity at lower drug doses. Although the intracellular concentrations of camptothecin were not assayed in these mutants, these data indicate that PDR1 and SNQ2 also play a role in mediating camptothecin-induced toxicity in wild-type yeast strains. In this regard, deletion of PDR1 may prove advantageous when using yeast to screen for novel therapeutics or to establish the mechanism of drug action.

Although the PDR1-101 mutant suppressed the cytotoxic response of TOP1 expressing yeast cells, significant levels of drug-induced DNA damage were indicated by elevated levels of damage-inducible DIN3 and RNR3 expression. Moreover, experiments with rad52Delta strains suggest that this level of DNA damage was sufficient to kill cells impaired in their ability to repair double strand DNA breaks. These results are also consistent with the inability of PDR1-101 to suppress the camptothecin sensitivity of yeast cells expressing human DNA topoisomerase I. In yeast cells, the human enzyme appears to constitute a more effective target for camptothecin than the yeast enzyme. Thus, only at significantly reduced concentrations of drug was PDR1-101 able to reduce the amount of camptothecin-mediated DNA damage to non-lethal levels.

ABC transporter function is conserved among eukaryotes. One mode of multi-drug resistance in mammalian cells involves the overexpression of the MDR1 ABC transporter (gp170). gp170 overexpressing cells are resistant to a wide variety of clinically important drugs including taxol, doxorubicin, etoposide, and amsacrine (24) but show no resistance to camptothecin or the camptothecin analogues 10-hydroxycamptothecin and 10,11-methylenedioxycamptothecin (25-27). gp170 overexpression confers an approximate 10-fold resistance to camptothecin analogues topotecan, SN-38, and 9-aminocamptothecin in culture; however, no difference in tumor clearing is evident in animal models (25). Examples of functional conservation across species include complementation of yeast cells deleted for the a factor transporter, STE6, by the mouse MDR3 gene (58) and the restoration of cadmium resistance to yeast cells lacking the YCF1 transporter by the mammalian CFTR gene (59). The recent report of a mitoxantrone-resistant human breast carcinoma cell line exhibiting cross-resistance to camptothecin, without any discernible alterations in DNA topoisomerase I (22), raises the intriguing possibility that a drug transporter might be involved.

It was surprising to us that the PDR1-101 mutant which results in resistance to multiple drugs including camptothecin did not confer resistance to etoposide, a substrate of MDR1 protein in human cells (24). In our studies, two distinct mechanisms of camptothecin resistance were observed. One resulted from a dominant mutation in PDR1-101 that requires SNQ2 function. The other was induced by the overexpression of PDR5 from the GAL1 promoter in wild-type PDR1E cells. This apparent promiscuity in ABC transporter function further supports the notion that similar mechanisms of camptothecin resistance might be achieved by the increased expression of other as yet unidentified drug transporters in human cells.


FOOTNOTES

*   This work was supported by Public Health Service Grant CA57855 (to M.-A. B) from the National Cancer Institute.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Dagger    Supported by National Institutes of Health Training Grant CA09678.
§   To whom reprint requests should be addressed: Dept. of Biochemistry and Molecular Pharmacology, Thomas Jefferson University, 233 S. 10th St., Philadelphia, PA 19107. Tel.: 215-503-4616; Fax: 215-923-9162; E-mail: bjornsti{at}hendrix.jci.tju.edu.
1   The abbreviations used are: top1Delta , DNA topoisomerase I deletion mutant; ABC, ATP-binding cassette; PCR, polymerase chain reaction; kb, kilobase; bp, base pair.
2   A. Goffeau and E. Balzi, personal communication.

ACKNOWLEDGEMENTS

We thank John Golin, Thomas McQuire, and W. Scott Moye-Rowley for plasmids, strains, and many helpful discussions; Elisabetta Balzi and Andre Goffeau for communicating results prior to publication, and Joyce Agati and Jolanta Fertala for their excellent assistance.


REFERENCES

  1. Wang, J. C. (1996) Annu. Rev. Biochem. 65, 635-692 [CrossRef][Medline] [Order article via Infotrieve]
  2. Gupta, M., Fujimori, A., and Pommier, Y. (1995) Biochim. Biophys. Acta 1262, 1-14 [Medline] [Order article via Infotrieve]
  3. Champoux, J. (1990) in DNA Topology and Its Biological Effects (Cozzarelli, N. R., and Wang, J. C., eds), pp. 217-242, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  4. Bjornsti, M.-A. (1991) Curr. Opin. Struct. Biol. 1, 99-103
  5. Chen, A., and Liu, L. F. (1994) Annu. Rev. Pharmacol. Toxicol. 34, 191-218 [CrossRef][Medline] [Order article via Infotrieve]
  6. Caron, P. R., and Wang, J. C. (1993) in Molecular Biology of DNA Topoisomerases (Andoh, T., Ikeda, H., and Oguro, M., eds), pp. 243-263, CRC Press, Inc., Boca Raton, FL
  7. Froelich-Ammon, S. J., and Osheroff, N. (1995) J. Biol. Chem. 270, 21429-21432 [Free Full Text]
  8. Bjornsti, M.-A., Benedetti, P., Viglianti, G. A., and Wang, J. C. (1989) Cancer Res. 49, 6318-6323 [Abstract/Free Full Text]
  9. Bjornsti, M.-A., Knab, A. M., and Benedetti, P. (1994) Cancer Chemother. Pharmacol. 34, S1-S5 [CrossRef]
  10. Benedetti, P., Fiorani, P., Capuani, L., and Wang, J. C. (1993) Cancer Res. 53, 4343-4348 [Abstract/Free Full Text]
  11. Nitiss, J. L., and Wang, J. C. (1991) in DNA Topoisomerases in Cancer (Potmesil, M., and Kohn, K. W., eds), pp. 77-92, Oxford University Press, New York
  12. Nitiss, J., and Wang, J. C. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 7501-7505 [Abstract/Free Full Text]
  13. Eng, W.-K., Faucette, L., Johnson, R. K., and Sternglanz, R. (1988) Mol. Pharmacol. 34, 755-760 [Abstract]
  14. Kauh, E. A., and Bjornsti, M.-A. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 6299-6303 [Abstract/Free Full Text]
  15. Tsao, Y.-P., D'Arpa, P., and Liu, L. F. (1992) Cancer Res. 52, 1823-1829 [Abstract/Free Full Text]
  16. Horwitz, S. B., and Horwitz, M. S. (1973) Cancer Res. 33, 2834-2836 [Abstract/Free Full Text]
  17. Nelson, W. G., and Kasten, M. B. (1994) Mol. Cell. Biol. 14, 1815-1823 [Abstract/Free Full Text]
  18. Logan, T. J., Evans, D. L., Mercer, E., Bjornsti, M.-A., and Hall, D. J. (1995) Cancer Res. 55, 2883-2891 [Abstract/Free Full Text]
  19. Madelaine, I., Prost, S., Naudin, A., Riou, G., Lavelle, F., and Riou, J. F. (1993) Biochem. Pharmacol. 45, 339-348 [CrossRef][Medline] [Order article via Infotrieve]
  20. Fujimori, A., Harker, W. G., Kohlhagen, G., Hoki, Y., and Pommier, Y. (1995) Cancer Res. 55, 1339-1346 [Abstract/Free Full Text]
  21. Tanizawa, A., Bertrand, R., Kohlhagen, G., Tabuchi, A., Jenkins, J., and Pommier, Y. (1993) J. Biol. Chem. 268, 25463-25468 [Abstract/Free Full Text]
  22. Yang, C.-H. J., Hortin, J. K., Cowan, K. H., and Schneider, E. (1995) Cancer Res. 55, 4004-4009 [Abstract/Free Full Text]
  23. Beidler, D. R., Chang, J.-Y., Zhou, B.-S., and Cheng, Y.-C. (1996) Cancer Res. 56, 345-353 [Abstract/Free Full Text]
  24. Gottesman, M. M., and Pastan, I. (1993) Annu. Rev. Biochem. 62, 385-427 [CrossRef][Medline] [Order article via Infotrieve]
  25. Mattern, M. R., Hofmann, G. A., Polsky, R. M., Funk, L. R., McCabe, F. L., and Johnson, R. K. (1993) Oncol. Res. 5, 467-474 [Medline] [Order article via Infotrieve]
  26. Hendricks, C. B., Rowinsky, E. K., Growchow, L. B., Donehower, R. C., and Kaufmann, S. H. (1992) Cancer Res. 52, 2268-2278 [Abstract/Free Full Text]
  27. Chen, A., Chiang, Y., Potmesil, M., Wall, M. E., Wani, M. C., and Liu, L. F. (1991) Cancer Res. 51, 6039-6044 [Abstract/Free Full Text]
  28. Balzi, E., and Goffeau, A. (1995) J. Bioenerg. Biomembr. 27, 71-76 [CrossRef][Medline] [Order article via Infotrieve]
  29. Katzmann, D. J., Hallstrom, T. C., Voet, M., Wysock, W., Golin, J., Volckaert, G., and Moye-Rowley, W. S. (1995) Mol. Cell. Biol. 15, 6875-6883 [Abstract]
  30. Decottignies, A., Lambert, L., Catty, P., Degand, H., Epping, E. A., Moye-Rowley, W. S., Balzi, E., and Goffeau, A. (1995) J. Biol. Chem. 270, 18150-18157 [Abstract/Free Full Text]
  31. Rothstein, R. (1991) Methods Enzymol. 194, 281-301 [CrossRef][Medline] [Order article via Infotrieve]
  32. Rose, M. D., Winston, F., and Hieter, P. (1990) Methods in Yeast Genetics, A Laboratory Course Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  33. Strathern, J. N., and Higgins, D. R. (1991) Methods Enzymol. 194, 319-329 [Medline] [Order article via Infotrieve]
  34. Berben, G., Dumont, J., Gilliquet, V., Bolle, P.-A., and Hilger, F. (1991) Yeast 7, 475-477 [CrossRef][Medline] [Order article via Infotrieve]
  35. Rose, M. D., and Broach, J. D. (1991) Methods Enz