Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cote, G. J.
Right arrow Articles by Morrison, R. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cote, G. J.
Right arrow Articles by Morrison, R. S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 2, Issue of January 10, 1997 pp. 1054-1060
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Sequence Requirements for Regulated RNA Splicing of the Human Fibroblast Growth Factor Receptor-1 alpha  Exon*

(Received for publication, May 25, 1996, and in revised form, August 20, 1996)

Gilbert J. Cote Dagger §, Eileen S-C. Huang Dagger , Wei Jin Dagger and Richard S. Morrison

From the Dagger  Section of Endocrinology, The University of Texas, M. D. Anderson Cancer Center, Houston, Texas 77030 and  Department of Neurological Surgery, University of Washington, Seattle, Washington 98195

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES


ABSTRACT

Progression of astrocytes from a benign to a malignant phenotype is accompanied by a change in the RNA processing of the fibroblast growth factor receptor 1 (FGFR-1) gene. The level of a high affinity form of the FGFR-1 is dramatically elevated as a result of alpha -exon skipping during RNA splicing. In this paper we have been able to duplicate this tumor-specific RNA processing pathway by transfection of a chimeric minigene containing a 4-kilobase fragment of the human FGFR-1 gene (including the alpha -exon) into a variety of cell lines. In a transfected human astrocytoma cell line, alpha -exon skipping was consistently observed for RNA transcripts derived from both the chimeric minigene and endogenous gene expression. This exon skipping phenotype was dependent on the size of the flanking intron as deletions which reduced the introns to less than ~350 base pairs resulted in enhanced alpha -exon inclusion. Increased exon inclusion was not sequence-specific as exon skipping could be restored with insertion of nonspecific sequence. Cell-specific exon recognition was maintained with a 375-nucleotide sequence inclusive and flanking the alpha -exon, provided that intron size was maintained. These results identify the minimal cis-regulatory sequence requirements for exclusion of FGFR-1 alpha -exon in astrocytomas.


INTRODUCTION

There are several mechanisms known to be involved in the malignant transformation of cells. One mechanism frequently overlooked is the disruption of pathways involving regulated RNA processing. Several different genes in multiple tumor types have demonstrated alterations in their RNA splicing pathways. Alterations in RNA processing fall into two broad categories, those involving cis effects where a specific gene is mutated and those believed to be trans-related because they lack a detectable mutation. The p53, BRCA1, hMLH1, and hMSH2 genes are examples of the former (1, 2, 3, 4, 5, 6, 7). Mutations in the splice site sequences of these genes have been associated with Li Fraumeni cancer syndrome, breast and ovarian cancer, and hereditary non-polyposis colorectal cancer (1, 2, 3, 4, 5, 6, 7). Genes without definable mutations but which have RNA processing changes associated with malignancy serve primarily as tumor markers or indicators of metastatic potential. In many cases these changes are peripheral and believed to result from the transformation process rather than be a contributing factor. For example, mutations in the RET protooncogene are the initiating event in transformation of the thyroid C-cell, but one outcome of transformation is a deregulation of calcitonin/calcitonin gene-related peptide alternative RNA processing (8, 9, 10). In other genes it is possible that alterations in RNA processing pathways may specifically contribute to the initiation or maintenance of the malignant phenotype. In breast cancer, several aberrant mRNA forms are observed for the estrogen receptor gene (11, 12, 13). Exon skipping results in receptor forms without DNA-binding or ligand-binding domains. The presence of dominant negative and positive receptor forms are believed to play a key role in estrogen-dependent cell proliferation as well as chemotherapeutic intervention with anti-estrogens (11, 12, 13). Finally, the CD44 gene product is believed to play a key role in tumor cell metastasis. Products of CD44 gene created by alternative RNA splicing are associated with increase tumor invasiveness and have been shown to enhance tumorigenicity (14, 15).

The focus of this paper involves changes in the RNA splicing patterns associated with astrocyte-derived neoplasm's of the central nervous system. It is hypothesized that the genesis of these tumors occurs as a multistep progression from benign astrocytoma to anaplastic astrocytoma, and finally, to glioblastoma multiforme. In this transformation numerous and, as of now, poorly understood cytogenetic and biochemical changes take place (16). Recent studies have been directed toward defining the genes and gene products responsible for glial tumorigenesis and progression. Among the several growth factors and growth factor receptors that are activated or overexpressed in glial tumors, the fibroblast growth factors (FGFs)1 and their cognate receptors (FGFRs) are believed to play key roles in the maintenance and possibly progression of tumorigenicity (17, 18, 19, 20).

Four structurally related genes encoding high affinity receptors have been identified (21, 22, 23). Features common to members of the FGFR family include a signal peptide, two or three immunoglobulin (Ig)-like loops in the extracellular domain, a hydrophobic transmembrane domain, and a highly conserved tyrosine kinase domain split by a short kinase insert sequence. Given the structural similarities, it is not surprising that multiple FGFRs can bind multiple FGFs. However, there are several reports of cell- and tissue-specific expression and responsivity to different FGF family members (21, 22, 23, 24, 25). One mechanism responsible for generating selective responsiveness to different FGF family members is alteration of the ligand binding domain by alternative RNA splicing (21, 22, 23). It is clear that for FGFR-1 and FGFR-2 alternative processing of the RNA precursor generates multiple mRNAs which produce receptors manifesting different ligand binding specificities and affinities (21, 22, 23). The role that these receptor forms play in development and cell growth is currently an active area of investigation.

Alternative splicing of the FGFR-1 RNA has recently been associated with astrocyte malignancy (26). For this gene, changes in the number and not the amino acid composition of the extracellular Ig-like loops correlates with astrocyte malignancy. An examination of graded astrocytic tumors revealed that there was a switch from a three Ig-like domain form (FGFR-1alpha ) to a two Ig-like domain form (FGFR-1beta ) during the progression to malignancy (26). The production of the two Ig-like domain form of FGFR-1 (FGFR-1beta ) is the result of exon skipping (see Fig. 1). Normal human adult and fetal brain expressed a form containing three Ig-like disulfide loops (FGFR-1alpha ). While the functional consequence of a shift in alternative RNA splicing from the alpha -form to the beta -form of the FGFR is not entirely understood, FGFR-1beta has been shown to exhibit a 10-fold greater affinity for acidic and basic FGF than FGFR-1alpha (27, 28). If this is true, then glioma cells expressing FGFR-1beta would be more responsive to FGF than nontransformed cells or low-grade astrocytoma cells expressing primarily FGFR-1alpha . These types of structural differences may impart a growth or invasiveness advantage to glioma cells expressing FGFR-1beta .


Fig. 1. Genomic organization of the 5' region of the human fibroblast growth factor-1 (FGFR-1) gene. A, schematic representation of the partial gene structure. The first 5 exons of the FGFR-1 are depicted as boxes, and intervening sequences are shown as thin lines. Exon and intron size is shown in base pairs. Thick lines show the relative positions of the plasmid constructs pGFR-1, pGFR-2, and pGFR-3. Arrows indicate the position of the oligonucleotide primers used in screening. RNA splicing pathways observed in normal glia and glioblastoma are shown by dotted lines. B, sequences found at all intron/exon boundaries are shown. Intron sequence is given in lowercase letters.
[View Larger Version of this Image (17K GIF file)]


A better understanding of the mechanism(s) involved in recognition of the alpha -exon may lead to the identification of factor(s) directly involved in astrocyte transformation. We believe that the change in alpha -exon recognition results from a change in RNA processing factors and not gene mutation. Analysis of DNA sequence derived from the SNB 19 human astrocytoma cell line failed to find mutations within the alpha -exon and its flanking introns. Therefore, in an effort to begin clarification of the mechanisms involved in FGFR-1 RNA splicing, we have established a cell culture model system which mimics the RNA processing decisions observed in normal and malignant brain tissue. With this system we have determined that intron size plays a key role in the alpha -exon skipping phenotype and have defined a 375-bp minimal region that is required to maintain cell-specific RNA splicing.


EXPERIMENTAL PROCEDURES

Cell Lines

The following human cell lines T98G (glioblastoma), NTERA-2 cl.D1 (NT2/D1) (Pluripotent embryonal carcinoma), PFSK-1 (Primitive neuroectodermal tumor), and JEG-3 (Choriocarcinoma) were obtained from American Type Culture Collection (Bethesda, MD). These cultures were all maintained in monolayer cultures using standard methodology and conditions recommended by the ATCC. The human astrocytoma cell line SNB 19 was maintained as described previously (26).

Gene Mapping

All gene mapping studies were performed on the human genomic P1 clone DMPC-HFF#1-4609E obtained from Genome Systems, Inc. (St. Louis, MO). The oligonucleotide primers that were provided to Genomic Systems map to the alpha -specific exon for FGFR-1 gene (alpha F and alpha R). DMPC-HFF#1-4609E was one of three clones received from their screening. This clone was subjected to BamHI or BglII digestion, and the resultant fragments were subcloned into pGEM 4 or pUC 19 by standard methodology. Three subclones were obtained by colony hybridization using oligonucleotide probes (R1, P1A, and alpha F) derived from various positions in the 5'-most end of a cDNA encoding the secreted FGFR-1 form (GenBank Accession M34188[GenBank]) (29). From this screening we characterized three nonoverlapping clones, pGFR-1, pGFR-2, and pGFR-3, by restriction analysis and DNA sequencing. The distance between pGFR-1 and pGFR-2 was determined to be ~900 bp by polymerase chain reaction (PCR) analysis of the P1 clone using insert-specific primers FP-20 (pGFR-1) and FP-21 (pGFR-2). The distance between pGFR-2 and pGFR-3 was determined to be ~1.3 kb by PCR using insert-specific primers FP-1 (pGFR-3) and FP-10 (pGFR-2).

Plasmids

pGFR-1 contains a ~6.6-kb BamHI fragment mapping to exon 1 inserted in pGEM 4. pGFR-2 contains an ~8-kb BglII fragment containing exon 2 inserted into pUC 19. pGFR-3 contains an ~4-kb BamHI fragment containing the alpha -exon inserted into pGEM 4. All the above inserts were derived from DMPC-HFF#1-4609E. The parental minigene splicing construct pFGFR-17 was created by inserting the BamHI fragment of pGFR-3 containing the alpha - and gamma -exons into the BglII site in intron 1 of a human metallothionein 2A minigene (pRSVhMT2A) (see Fig. 2A) (30). Deletions of the 3' end of the insert were created using restriction sites within the BamHI insert. The clones pFGFR-18 (XbaI to SmaI) and pFGFR-19 (SacI to SmaI) were deletions of pFGFR-17. The clone pFGFR-20 is a BamHI to BglII fragment inserted into the BglII site of pRSVhMT2A. In the "stuffer" clone pFGFR-21, the ApaI to SmaI region containing the gamma -exon has been replaced with an ApaI to SmaI fragment from pGFR-3. The replacement sequence is derived from intronic sequence located ~1.4 kb upstream of the alpha -exon. The fragment is inserted in the antisense orientation. Deletions of the 5' end of the BamHI insert were created using the following restriction sites: BglII (pFGFR-22), BstXI (pFGFR-23), MscI (pFGFR-24). The stuffer sequence in clone pFGFR-25 is a BglII to SmaI fragment from pGFR-3. The replacement sequence is derived from intronic sequence located ~1 kb upstream of the alpha -exon. The fragment is inserted in the antisense orientation. The construct pFGFR-26 has a BglII fragment derived from pGFR-3 inserted into the BglII site of pRSVhMT2A. Constructs pFGFR-27, pFGFR-28, pFGFR-29, and pFGFR-30 all contain the same stuffer sequence used to create pFGFR-28. A second series of stuffer clones was made using sequence derived from the 5'-flanking region of the FGFR-1 gene (approximately -4200 to -700). The construct pFGFR-31 was made by insertion of an ~3500-bp BamHI to ScaI fragment of pGFR-1 into the BglII and SmaI sites of pRSVhMT2A, followed by deletion of a HindIII site contained within vector multilinker. The plasmids pFGFR-32 and pFGFR-33 were constructed by insertion of PCR-generated fragments containing alpha -exon (primers FP-2 and FP-4) and exon 4 (primers FP-11 and FP-12) sequences, respectively, into the HindIII and SmaI sites of pFGFR-31 (see Fig. 7). In some cases multiple cloning steps and/or partial restriction digestions were required to obtained the desired plasmid construct. Specific details describing the construction of each plasmid are available upon request.


Fig. 2. Cell-specific inclusion of the FGFR-1 alpha -exon in transcripts derived from a chimeric minigene. A, schematic representation of the chimeric minigene construct (pFGFR-17) and expected RNA splicing pathways. FGFR-1 genomic sequence is depicted by thin lines. Thick lines depict sequence derived from human metallothionein (hMT) or Rous sarcoma virus (RSV) (enhancer/promoter). The predicted alpha -exon inclusion and exclusion products and their specific RT-PCR products are shown. Arrows shown relative position of PCR primers, transcription start (|) and polyadenylation signal (A). B, examination of endogenous FGFR-1 splicing in five human cell lines. Total RNA was prepare from five different cell lines 48 h after transfection with pFGFR-17. The level of alpha -exon inclusion versus exclusion in the endogenous FGFR-1 transcripts was determined by 16-cycle RT-PCR using radiolabeled primers derived from FGFR-1 exons 1 and 3 (see Fig. 1 and "Experimental Procedures"). C, RNA splicing of transcripts derived from the pFGFR-17 minigene. RT-PCR was performed as in B using RSV- and hMT-specific primers (DS8 and HMT3) to differentiate minigene products from endogenous RNA. RT-PCR bands representing inclusion and exclusion products are indicated. Cell lines used include T98G (lane 1), SNB 19 (lane 2), NTERA-2 cl.D1 (lane 3), PFSK-1 (lane 4), and JEG-3 (lane 5).
[View Larger Version of this Image (42K GIF file)]



Fig. 7. Cell-specific splicing dependent on alpha -exon and its flanking sequence. A, schematic representation of constructs pFGFR-32 and pFGFR-33. Substitutions are indicated by the shaded rectangles. B, SNB 19 and JEG-3 cells were independently transfected in duplicate with pFGFR-17, pFGFR-32, and pFGFR-33 (see "Experimental Procedures"). RNA splicing of transcripts derived from the plasmid minigenes was examined by RT-PCR analysis as in Fig. 2 using RSV- and hMT-specific primers (DS8 and HMT2/3). RT-PCR bands representing inclusion and exclusion products are indicated. Note the size of the pFGFR-33 inclusion band differs due to the smaller size of exon 4.
[View Larger Version of this Image (41K GIF file)]


Transfections

All transfections were performed using LipofectAMINETM according to protocols suggested by the manufacturer (Life Technologies, Inc.). Briefly, cells were plated in duplicate on 100-mm dishes and allowed to grow to ~80% confluency prior to transfection. The DNA/lipofectAMINETM mixture (10 µg/40 µl) was allowed to associate at room temperature for 40 min. This mixture was then added to 4 ml of serum-free medium, which then replaced the culture medium. Transfection was allowed to proceed for 6 h prior to switching to medium containing serum. Total RNA was isolated 72 h after transfection by RNAzol B extraction as suggested by the manufacturer (TEL-TEST, Friendswood, TX). All results are representative of at least three transfections for each plasmid.

Reverse Transcription-Polymerase Chain Reactions (RT-PCR)

All RT-PCR reactions were performed as described previously with minor modifications (30, 31). Both the reverse transcription and PCR steps were prepared in the same tube. Five µg of total RNA was used for each RT-PCR. The reverse transcription reaction was performed using the downstream PCR primer (Endo R, HMT3, or HMT2/3). PCR reactions were performed by diluting the RT reaction with a mixture containing 32P-end-labeled upstream primer (Endo F or DS8). Each amplification cycle consisted of denaturation at 94 °C for 1 min, annealing at 55 °C for 1 min, and extension at 72 °C for 2 min. PCR reactions were performed for 16 amplification cycles which were empirically determined to be in the linear range for the reaction primers and target sequence. PCR products were analyzed by polyacrylamide gel electrophoresis and visualized by autoradiography. The identity of all PCR products was confirmed by both restriction enzyme analysis and DNA sequencing.

Primers

alpha F, GGAGCCCCTGTGGAAGTGGA; alpha R, CTCCTCCCCTGTGATGCGGG; R1, GAACCCAAGGACTTTTCTC; P1A, CGAGCTCACTGTGGAGTATCCATG; FP-1, CCCAAGAGAATGCAGCAAAG; FP-2, GGGGAAGCTTGGCCAGCGTAATTCCCT; FP-4, GGGGAGTACTGGCTACCAACCTGAAACA; FP-10, CTGGAACCTGGGGGCTGAAG; FP-11, GGGGAAGCTTGCAAGACACCTCCAGGT; FP-12, GGGGAGTACTACACGTACCTTGTAGCC; FP-20, AACTCAGATTCTTCAGGCCT; FP-21, TGCCCCATCCTTATATGTCC; Endo F, CCACGGCGGACTCTCCCGAG; Endo R, TGGCAGCCGGCACTGCATGC; DS8, TTGACCATTCACCACATTGGTGTGC; HMT3, ATCTGGGAGCGGGGCTGT; HMT2/3, GCAGCAGGAGCAGCAGCTTT.


RESULTS

The fibroblast growth factor receptor 1 (FGFR-1) RNA precursor is known to undergo several alternative RNA processing events affecting both the extracellular and intracellular domains of the protein. The production of a receptor containing three extracellular Ig-like binding domains results from the inclusion of a single exon termed alpha . Deregulation of this RNA splicing has been observed in astrocyte malignancy with a predominant alpha -exon skipping pathway observed (Fig. 1A) (26). Exon skipping is likely to result from changes in trans-factor composition as analysis of glioblastoma DNA failed to demonstrate mutations within the alpha -exon and flanking intron sequence (data not shown). The goal of these studies was to develop a model for examining the regulatory event(s) involved in alpha -exon recognition. While much of the structure of the FGFR-1 gene has been well characterized, the genomic organization of the 5' end of the human gene as well as the sequences surrounding the alpha -exon remain to be defined. Because the genomic structure and intronic sequences frequently play a role in alternative RNA processing decisions, we sought to first clarify the genomic organization in this region.

Structure of the 5' Region of the FGFR-1 Gene

A P1 clone was obtained from Genome Systems, Inc., using PCR primers specifically mapping to the alpha -exon (alpha F and alpha R). Southern analysis of the P1 clone using a primer mapping to the 5'-most end of a cDNA (R1) suggested the presence of the transcription start site in our clone (31). Three nonoverlapping subclones were obtained from the P1 clone by colony hybridization using cDNA-derived oligonucleotide probes (R1, P1B, and alpha F) (Fig. 1A). Comparison of genomic sequence with reported cDNA sequence confirmed the location of the alpha -exon boundaries and, like mouse, two exons are located upstream of the alpha -exon (32) (Fig. 1). DNA sequence obtained from the 3' end of exon 1 allowed the determination of the exon/intron boundary. Our genomic DNA sequence diverged from the cDNA sequence 641 bp from the predicted transcription start site. As expected, this new intron sequence began with a 5' splice site consensus (33). This observation would place the translation initiation site in exon 2, as has been reported for the mouse gene (32). The size of the introns flanking exon 2 are estimates based on Southern and PCR analysis of the P1 clone (data not shown).

Construction and RNA Splicing of a Chimeric FGFR-1 Minigene

Based on our genomic clones and previously published data (34), we estimate the FGFR-1 gene to contain 20 exons that map to a region in excess of 30 kb. Therefore, it is impractical to perform cis element mapping in the intact gene. To overcome this problem we employed a strategy similar to that used to map the cis-regulatory regions of the human calcitonin gene (30, 31). The ~4-kb insert of pGFR-3 was inserted into intron 1 of the human metallothionein 2A (MT 2A) splicing reporter gene construct to create pFGFR-17 (Fig. 2A). Transcription of this minigene is driven by the Rous sarcoma virus LTR enhancer/promoter. This provides both a high level of expression and a means of distinguishing transcripts derived from the minigene from endogenous MT 2A expression. The construct maintains the alternatively spliced downstream gamma -exon but replaces the upstream exon 2. pFGFR-17 was transiently transfected into several cell lines (primarily of central nervous system origin) in order to determine whether RNA processing of the minigene transcripts mirrored the processing observed for endogenous FGFR-1 precursor RNA. Splicing pattern was determined by quantitative RT-PCR analysis for both endogenous FGFR-1 and pFGFR-17 RNA transcripts. As seen in Fig. 2 the pattern of alpha -exon inclusion for transcripts derived from the minigene was similar to those observed for endogenous RNA precursor splicing. The glioblastoma-derived cell lines, T98G and SNB 19, showed almost exclusive alpha -exon skipping. The neuroectodermal-derived cells PFSK-1 also exhibited a predominant alpha -exon skipping pattern for both the endogenous and transfected FGFR-1 gene transcripts. In contrast, the embryonal carcinoma cell line (NTERA-2 cl.D1) and choriocarcinoma cell line (JEG-3) both displayed predominant alpha -exon inclusion pathways. The level of endogenous gene expression did not differ between the cell lines, except for the JEG-3 cells which had significantly lower levels. Differences between the level of transcript derived from the minigene likely result from differences in transfection efficiency.

Downstream Intron Size and Not the Presence of gamma -Exon Plays a Role in alpha -Exon Selection

The observed RNA processing pattern for the pFGFR-17 minigene in several cell lines confirmed that minigene transcripts are capable of mimicking the RNA processing pathway observed for the endogenous gene. However, the FGFR-1 gene insert size of this construct exceeds 4 kb. A series of 3' end insert deletions were introduced into the pFGFR-17 construct to determine the role of downstream intron and gamma -exon sequence on alpha -exon skipping (Fig. 3). Constructs pFGFR-17, pFGFR-18, pFGFR-19, and pFGFR-20 were transiently transfected into the SNB 19 glioblastoma cell line. RNA splicing pathways were determined by 16 cycle RT-PCR (see "Experimental Procedures"). As previously observed pFGFR-17-derived transcripts predominantly excluded the alpha -exon (Fig. 3, lane 1). The stepwise removal of downstream sequence resulted in a gradual increase in the level of alpha -exon inclusion, with the highest level observed for pFGFR-20. This effect appeared to be nonspecific with no significant increase coinciding with the removal of the gamma -exon (Fig. 3, lane 3 versus lane 4). To confirm the nonspecific effect, the downstream intron size was expanded with antisense sequence derived from intron 2 (pFGFR-21). Transfection of pFGFR-21 into SNB 19 cells demonstrated that the intron expansion was capable of restoring the RNA splicing phenotype (compare lanes 1 and 5). These results suggest that downstream intron size and not the presence of specific sequence or the gamma -exon plays a role in alpha -exon selection. The results obtained above from the 3' end deletion clones suggest that while the ~950 bp of deleted sequence is necessary for appropriate alpha -exon skipping, the specific sequence is not required as it can be substituted.


Fig. 3. Deletion of sequence downstream of the FGFR-1 alpha -exon causes increased inclusion. A, schematic representation of deletions introduced into pFGFR-17. Deletions used to create constructs pFGFR-18 to -21 are described under "Experimental Procedures." In construct pFGFR-21 deleted sequence has been replaced (thicker line) to maintain intron size. Exon and intron sizes are indicated below in base pairs. B, examination of RNA splicing for transcripts derived from the minigene constructs transfected into SNB 19 glioblastoma cells. RT-PCR analysis was performed as in Fig. 2. Bands representing inclusion and exclusion products are indicated. Individual constructs transfected are shown above respective lanes.
[View Larger Version of this Image (37K GIF file)]


Upstream Intron Size Also Plays a Key Role in alpha -Exon Selection

The intronic sequence upstream of the alpha -exon in the pFGFR-17 clone accounts for the majority of the FGFR-1 insert. In order to define further the sequence requirements for regulated alpha -exon recognition, additional deletions were made in this upstream intron sequence. As above, series of 5' stepwise deletions of ~1500 bp (pFGFR-22), ~2250 bp (pFGFR-23), and ~2300 bp (pFGFR-24) were introduced into pFGFR-17. The constructs were then transfected into SNB 19 cells and total RNA analyzed by RT-PCR for splicing products (see "Experimental Procedures"). For these constructs, removal of intronic sequence resulted in a dramatic increase in alpha -exon inclusion (Fig. 4, lanes 2-4). The average ratio of alpha -exon inclusion/exclusion was 5.5 for pFGFR-23 and 8.1 for pFGFR-24 compared with 0.2 observed for pFGFR-17 (as determined by measurement using a PhosphorImager, Molecular Dynamics). This increase in alpha -exon inclusion suggested that an inhibitory element preventing exon recognition may have been deleted in these clones. To test this possibility the deleted sequence was replaced with a nonspecific stuffer to create pFGFR-25. Analysis of splicing from products derived from this clone showed alpha -exon skipping was restored to the wild-type level (compare lanes 1 and 5). Therefore, as above, these results again suggest a role for intron size and not specific sequence, with a dramatic increase in alpha -exon recognition occurring when the intron was reduced below ~330 bp.


Fig. 4. Deletion of upstream intron sequence increases alpha -exon inclusion. A, schematic representation of deletions introduced into pFGFR-17. Specific deletions used to create constructs pFGFR-22 through pFGFR-25 are described under "Experimental Procedures." In construct pFGFR-25 deleted sequence has been replaced (thicker line) to maintain intron size. B, examination of RNA splicing for transcripts derived from the minigene constructs transfected into SNB 19 glioblastoma cells. RT-PCR analysis was performed as in Fig. 2. Bands representing inclusion and exclusion products are indicated. Individual constructs transfected are shown above respective lanes.
[View Larger Version of this Image (37K GIF file)]


Defining the Intronic Sequence Requirements for alpha -Exon Selection

Deletion of intronic sequence flanking the alpha -exon suggested that individually neither sequence was specifically required for exon inclusion and that only intron size was important. In order to define further the sequence requirements and test for redundancy of elements, additional constructs were created. The construct pFGFR-26 (Fig. 5) combines the 5' and 3' deletions of pFGFR-20 and pFGFR-22. As observed for the individual deletions, there was an enhancement of alpha -exon inclusion during RNA processing relative to pFGFR-17 (compare lanes 1 and 2, Fig. 5). However, the level of alpha -exon inclusion was not significantly greater than that observed for the pFGFR-22 deletion construct. Therefore, any redundancy or synergism involving downstream elements would involve sequences 5' of the pFGFR-22 deletion point. To test this possibility, the same 5' deletions introduced into pFGFR-17 were created in pFGFR-21 (constructs pFGFR-27, pFGFR-28, and pFGFR-29). As previously observed, there was a dramatic increase in the level of alpha -exon inclusion with the deletions leaving 151 (pFGFR-28) and 95 (pFGFR-29) nucleotide of intron sequence preceding the alpha -exon, even when stuffer sequence was included downstream (compare lanes 5 and 6 with lane 4, Fig. 5). Finally, a construct containing replacement sequence both 5' and 3' of the alpha -exon (pFGFR-30, Fig. 5) was made to confirm the role of intron size and rule out the possibility of redundant elements flanking the alpha -exon. Like pFGFR-21 (lane 3, Fig. 5) and pFGFR-25 (Fig. 4), exclusion of the alpha -exon was maintained in the absence of specific flanking sequence. This would suggest that the alpha -exon with 95 nucleotides of 5'-flanking intron and 191 nucleotides of downstream intron provides sufficient sequence information for regulated exclusion when provided with large flanking introns.


Fig. 5. Deletion of upstream intron sequence increases alpha -exon inclusion in the absence of downstream sequence. A, schematic representation of deletions and substitutions introduced into pFGFR-17. Specific deletions and substitutions used to create constructs pFGFR-26 through pFGFR-30 are described under "Experimental Procedures." Substitutions are indicated by a thicker lines. B, examination of RNA splicing for transcripts derived from the minigene constructs transfected into SNB 19 glioblastoma cells. RT-PCR analysis was performed as in Fig. 2. Bands representing inclusion and exclusion products are indicated. Individual constructs transfected are shown above respective lanes.
[View Larger Version of this Image (38K GIF file)]


The splicing pathway observed for pFGFR-30 transcripts in transfected SNB 19 cells could result either from regulated skipping of alpha -exon or deletion of constitutive processing signals. To determine if the pFGFR-30 construct maintained sequences required for cell-specific alpha -exon inclusion, this construct was transfected into the five cell lines described in Fig. 2. Total RNA was isolated 48 h post-transfection, and the processing pathways were determined by RT-PCR analysis (see "Experimental Procedures") (Fig. 6). The level of alpha -exon inclusion in each cell line was similar to that observed for pFGFR-17 (compare with Fig. 2B). The alpha -exon was predominantly excluded in T98G and SNB 19 glioblastoma cell lines, while predominantly included in NT-2 and JEG-3 cell lines. This observation strongly suggests that the key elements required for cell-specific alpha -exon recognition are contained within the 553-nucleotide sequence inclusive and flanking the alpha -exon. However, it does not rule out the possibility that the stuffer sequence may contain a cell-specific regulatory element. This might result fortuitously or because the stuffer sequence used to create the pFGFR-30 construct is derived from intron upstream of the alpha -exon. A palindromic element might still function in the antisense orientation. To address these concerns and narrow the regulatory region, additional constructs were created. The construct pFGFR-32 contains a 375-bp insert, deleting an additional 180 bp of the downstream intron while leaving the 5' splice site intact. The new stuffer sequences are derived from the 5'-flanking region of the FGFR-1 gene (Fig. 7A). To control for the possibility of an unforeseen regulatory element contained within this stuffer sequence, the alpha -exon and its flanking sequence in pFGFR-32 was replaced with analogous FGFR-1 exon 4 sequence to create pFGFR-33 (Fig. 7A). FGFR-1 exon 4 was chosen because like the alpha -exon it encodes Ig loop sequence but, unlike the alpha -exon, is not involved in cell-specific splicing (21-23, and data not shown).


Fig. 6. Identification of the minimal FGFR-1 sequence required to maintain cell-specific splicing of alpha -exon. A, schematic representation of construct pFGFR-30. Substitutions of pFGFR-17 sequence are indicated by the thicker line. B, RNA splicing of transcripts derived from the pFGFR-30 minigene. RT-PCR analysis was performed as in Fig. 2 using RSV- and hMT-specific primers (DS8 and HMT3). RT-PCR bands representing inclusion and exclusion products are indicated. Cell lines used include T98G (lane 1), SNB 19 (lane 2), NTERA-2 cl.D1 (lane 3), PFSK-1 (lane 4), and JEG-3 (lane 5).
[View Larger Version of this Image (39K GIF file)]


The constructs pFGFR-17, pFGFR-32, and pFGFR-33 were transfected into SNB 19 and JEG-3 cells to compare the RNA processing of transcripts derived from these constructs. As was previously observed, transcripts derived from constructs pFGFR-17 showed alpha -exon exclusion in SNB 19 cells (~80%) and inclusion in JEG-3 cells (~70%) (Fig. 7B). The RNA processing of transcripts derived pFGFR-32 construct displayed a similar cell-specific splicing pathway (~70% exclusion in SNB 19 cells and ~70% inclusion in JEG-3 cells, as determined by measurement using a PhosphorImager, Molecular Dynamics). Therefore, cell-specific alpha -exon exclusion and inclusion was both maintained with the smaller 375-bp fragment and occurred independently of the stuffer sequence used. Finally, when alpha -exon was replaced with exon 4, transcripts derived from this construct (pFGFR-33) no longer displayed cell-specific exon recognition (Fig. 7B). While exon 4 was not efficiently recognized in the two cell types, it was included at a similar ratio (~60% by as determined by measurement using a PhosphorImager, Molecular Dynamics). These results clearly indicate that the sequence contained within and flanking the alpha -exon is sufficient to mediate cell-specific recognition of this exon. However, they cannot rule out the possibility that additional elements located outside the defined region might play some role in modulating this event.


DISCUSSION

The alternative recognition of exons during RNA processing not only allows creation of genetic diversity but regulated processing decisions provide key switches to several developmental and tissue-specific processes. Changes in cell-specific exon recognition have been correlated to numerous cellular events including cell differentiation and the cellular transformation associated with tumorigenesis (10, 11, 12, 13, 14, 35, 36, 37, 38). Correlations involving a change in RNA processing are most often recognized by examination of a single gene. However, it is easy to imagine that the identification of a single aberrant RNA processing event provides a mechanism for monitoring a change which would have a global effect and possibly lead to cellular transformation.

In this report we have focused on alternative RNA processing of FGFR-1 transcripts. Processing of this gene's RNA precursor is quite complex and known to alternatively recognize at least six different exons (21, 22, 23, 29, 39, 40). While the expression of the FGFR-1 gene is widespread, occurring in almost all cell types, little is known about the distribution of the alternative RNA forms. It is important to note that these RNA processing changes greatly impact upon the functionality of the protein, altering ligand affinity and specificity, subcellular localization, and tyrosine kinase activity. For the alpha -exon, inclusion in the final transcript encodes for the production of a receptor with three Ig-like domains in the extracellular domain, while exclusion encodes a receptor with only two domains. This change has no effect on ligand specificity but has been demonstrated to reduce FGF-1 binding affinity (27, 28). The impact of the change in this splicing decision on glial cell growth is unclear and currently under investigation.

The goal of this study was to develop a model system with which the mechanisms involved in alternative alpha -exon recognition might be elucidated. Similar model systems have been developed to examine RNA processing for several alternatively regulated genes, including FGFR-2 (41, 42). In the process of defining the human FGFR-1 gene structure, we found that like the mouse gene the first two introns are disproportionately large relative to other introns in the gene (the next largest, intron 10, is ~2100 bp) (Fig. 1) (34). Similar sized introns are observed for other receptor genes in this family. For example, the platelet-derived growth factor receptor has been found to have a 23-kb first intron (43). Therefore, it is possible that the size of these introns play a role in regulation of alpha -exon recognition. This concept is supported by our observation that a reduction in the size of the intron preceding the alpha -exon in the chimeric minigene had such a dramatic effect on RNA splicing (Fig. 4). However, cell-specific splicing can be restored by insertion of nonspecific sequence. Therefore, this regulatory mechanism is likely to be nonspecific.

Cell-specific RNA splicing of the alpha -exon was maintained with only 375 bp of FGFR-1 gene sequence. The sequence is comprised of the alpha -exon with 95 nucleotides of upstream and 11 nucleotides of downstream flanking sequence. This places the specific regulatory sequences either within or immediately adjacent to the alpha -exon. This finding is not unexpected. For several alternatively recognized exons where regulatory elements have been identified, these sequences are often found near the splice site regions. Splicing of the FGFR-2 gene RNA transcript provides a specific example. Mutually exclusive splicing of two exons encoding part of the third immunoglobulin-like loop determines ligand specificity. Inclusion of a K-SAM encoding exon in epithelial cells produces a receptor with high affinity for keratinocyte growth factor. Regulated splicing of this exon has been shown to require three different elements all located within or flanking the exon (41, 42). The three elements are suboptimal splice sites, a splicing enhancer (recognized in epithelial cells), and an inhibitory sequence (recognized in other cell types). For this RNA a purine-rich exon element functions to inhibit splicing of the K-SAM exon, whereas a pyrimidine-rich intronic element stimulates exon inclusion. Similar purine-rich sequences are present in the 375-bp FGFR-1 fragment on the pFGFR-32 minigene construct. Whether these sequences function in an analogous fashion remains to be addressed.

The observation that cell-specific RNA splicing of the FGFR-1 alpha -exon can be maintained in a chimeric minigene provides a useful tool for the further study of this splicing event. While a relatively small region (375 bp) is required to maintain regulated splicing of FGFR-1 alpha -exon, the mechanism(s) of exon recognition may be quite complex, involving several elements and possibly sequences outside the defined region which might modulate the response. The failure to include the alpha -exon as a result of astrocyte transformation would suggest some alteration of factors that function through splicing enhancers. This could involve a pyrimidine-rich element, such as that used for FGFR-2 K-SAM or some other regulatory sequence. For example, the purine-rich exonic splicing enhancers have been identified in several exons and regulate the splicing of several transcripts (44). Sequences resembling the exonic splicing enhancer consensus can also be found in the alpha -exon. These elements function through interactions with a class of RNA binding proteins (SR proteins) to regulate exon inclusion (45). It is not know if neoplastic transformation is associated with a change in the expression of individual SR proteins, but they do show tissue-specific distribution. These proteins, therefore, become an attractive candidate for regulators of this splicing event. Additional experimentation to first define the specific cis-regulatory sequences, however, is required before a role for these proteins in alpha -exon splicing can be determined.


FOOTNOTES

*   This work was supported in part by United States Public Health Service Grant CA67946 (to G. J. C.) and an American Cancer Society grant (to R. S. M.). DNA sequencing and oligonucleotide synthesis was provided by M. D. Anderson Core Facilities, and additional funds (to G. J. C.) were derived from United States Public Health Service Center Grant 2P30-CA16672. The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§   To whom correspondence should be addressed: M.D. Anderson Cancer Center, 1515 Holcombe Blvd., Section of Endocrinology, Box 15, Houston, TX 77030. Tel.: 713-792-2840; Fax: 713-794-4065; E-mail: gilbert_cote{at}isqm.mda.uth.tmc.edu.
1    The abbreviations used are: FGF, fibroblast growth factor; FGFR, fibroblast growth factor receptor; hMT, human metallothionein; RSV, Rous sarcoma virus; PCR, polymerase chain reaction; RT-PCR, reverse transcription-polymerase chain reaction; bp, base pair(s); kb, kilobase pair(s).

REFERENCES

  1. Warneford, S. G., Witton, L. J., Townsend, M. L., Rowe, P. B., Reddel, R. R., Dalla-Pozza, L., and Symonds, G. (1992) Cell Growth & Differ. 3, 839-846 [Abstract]
  2. Frebourg, T., Barbier, N., Yan, Y. X., Garber, J. E., Dreyfus, M., Fraumeni, J., Li, F. P., and Friend, S. H. (1995) Am. J. Hum. Genet. 56, 608-615 [Medline] [Order article via Infotrieve]
  3. Friedman, L. S., Ostermeyer, E. A., Szabo, C. I., Dowd, P., Lynch, E. D., Rowell, S. E., and King, M. C. (1994) Nat. Genet. 8, 399-404 [CrossRef][Medline] [Order article via Infotrieve]
  4. Neuhausen, S. L., Mazoyer, S., Friedman, L., Stratton, M., Offit, K., Caligo, A., Tomlinson, G., Cannon-Albright, L., Bishop, T., Kelsell, D., Solomon, E., Weber, B., Couch, F., Struewing, J., Tonin, P., Durocher, F., Narod, S., Skolnick, M. H., Lenoir, G., Serova, O., Ponder, B., Stoppa-Lyonnet, D., Easton, D., King, M. C., and Goldgar, D. E. (1996) Am. J. Hum. Genet. 58, 271-280 [Medline] [Order article via Infotrieve]
  5. Nystrom-Lahti, M., Kristo, P., Nicolaides, N. C., Chang, S. Y., Aaltonen, L. A., Moisio, A. L., Jarvinen, H. J., Mecklin, J. P., Kinzler, K. W., Vogelstein, B., De La Chapelle, A., and Peltomaki, P. (1995) Nat. Med. 1, 1203-1206 [CrossRef][Medline] [Order article via Infotrieve]
  6. Hall, N. R., Taylor, G. R., Finan, P. J., Kolodner, R. D., Bodmer, W. F., Cottrell, S. E., Frayling, I., and Bishop, D. T. (1994) Eur. J. Cancer 30, 1550-1552 [CrossRef]
  7. Miyaki, M., Konishi, M., Muraoka, M., Kikuchi-Yanoshita, R., Tanaka, K., Iwama, T., Mori, T., Koike, M., Ushio, K., Chiba, M., Nomizu, S., and Utsunomiya, J. (1995) J. Mol. Med. 73, 515-520 [Medline] [Order article via Infotrieve]
  8. Mulligan, L. M., Kwok, J. B. J., Healey, C. S., Elsdon, M. J., Eng, C., Gardner, E., Love, D. R., Mole, S. E., Moore, J. K., Papi, L., Ponder, M. A., Teleius, H., Tunnacliffe, A., and Ponder, B. A. J. (1993) Nature 363, 458-460 [CrossRef][Medline] [Order article via Infotrieve]
  9. Donis-Keller, H., Dou, S., Chi, D., Carlson, K. M., Toshima, K., Lairmore, T. C., Howe, J. R., Moley, J. F., Goodfellow, P., and Wells, S. A., Jr. (1993) Hum. Mol. Genet. 2, 851-856 [Abstract/Free Full Text]
  10. Peleg, S., Cote, G. J., and Gagel, R. F. (1993) in Cellular and Molecular Biology of Bone (Noda, M., ed), pp. 343-373, Academic Press, San Diego
  11. Sluyser, M. (1994) Crit. Rev. Oncog. 5, 539-554 [Medline] [Order article via Infotrieve]
  12. Daffada, A. A., Johnston, S. R., Smith, I. E., Detre, S., King, N., and Dowsett, M. (1995) Cancer Res. 55, 288-293 [Abstract/Free Full Text]
  13. Gotteland, M., Desauty, G., Delarue, J. C., Liu, L., and May, E. (1995) Mol. Cell. Endocrinol. 112, 1-13 [CrossRef][Medline] [Order article via Infotrieve]
  14. Cooper, D. L., and Dougherty, G. J. (1995) Nat. Med. 1, 635-637 [CrossRef][Medline] [Order article via Infotrieve]
  15. Tanabe, K. K., and Saya, H. (1994) Crit. Rev. Oncog. 5, 201-212 [Medline] [Order article via Infotrieve]
  16. Burger, P. C., Scheithaner, B. W., and Vogel, F. S. (1991) Surgical Pathology of the Nervous System and Its Coverings, 3rd Ed., pp. 193-437, Churchill Livingstone, New York
  17. Takahashi, J. A., Mori, H., Fukumoto, M., Igarashi, K., Jaye, M., Oda, Y., Kikuchi, H., and Hatanaka, M. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 5710-5714 [Free Full Text]
  18. Morrison, R. S., Yamaguchi, F., Saya, H., Bruner, J. M., Yahanda, A. M., Donehower, L. A., and Berger, M. (1994) J. Neurooncol. 18, 207-216 [CrossRef][Medline] [Order article via Infotrieve]
  19. Stefanik, D. F., Rizakalla, L. R., Soi, A., Goldblatt, S. A., and Rizkalla, W. M. (1991) Cancer Res. 51, 5760-5765 [Abstract/Free Full Text]
  20. Wright, J. A., Turley, E. A., and Greenberg, A. H. (1993) Crit. Rev. Oncogen. 4, 473-492 [Medline] [Order article via Infotrieve]
  21. Fernig, D. G., and Gallagher, J. T. (1994) Prog. Growth Factor Res. 5, 353-377 [CrossRef][Medline] [Order article via Infotrieve]
  22. McKeehan, W. L., and Kan, M. (1994) Mol. Reprod. Dev. 39, 69-81 [CrossRef][Medline] [Order article via Infotrieve]
  23. Johnson, D. E., and Williams, L. T. (1993) Adv. Cancer. Res. 60, 1-41 [Medline] [Order article via Infotrieve]
  24. Hughes, S. E., and Hall, P. A. (1993) Lab. Invest. 69, 173-182 [Medline] [Order article via Infotrieve]
  25. Yazaki, N., Fujita, H., Ohta, M., Kawasaki, T., and Itoh, N. (1993) Biochim. Biophys. Acta 1172, 37-42 [Medline] [Order article via Infotrieve]
  26. Yamaguchi, F., Saya, H., Bruner, J. M., and Morrison, R. S. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 484-488 [Abstract/Free Full Text]
  27. Wang, F., Kan, M., Yan, G., Xu, J., and McKeehan, W. L. (1995) J. Biol. Chem. 270, 10231-10235 [Abstract/Free Full Text]
  28. Shi, E., Kan, M., Xu, J., Wang, F., Hou, J., and McKeehan, W. L. (1993) Mol. Cell. Biol. 13, 3907-3918 [Abstract/Free Full Text]
  29. Johnson, D. E., Lee, P. L., Lu, J., and Williams, L. T. (1990) Mol. Cell. Biol. 10, 4728-4736 [Abstract/Free Full Text]
  30. Lou, H., Cote, G. J., and Gagel, R. F. (1994) Mol. Endocrinol. 8, 1618-1626 [Abstract/Free Full Text]
  31. Lou, H., Yang, Y., Cote, G. J., Berget, S. M., and Gagel, R. F. (1995) Mol. Cell. Biol. 15, 7135-7142 [Abstract]
  32. Harada, T., and Saito, H. (1995) Biochem. Biophys. Res. Commun. 205, 1057-1063
  33. Mount, S. M. (1982) Nucleic Acids Res. 10, 459-472 [Abstract/Free Full Text]
  34. Johnson, D. E., Lu, J., Chen, H., Werner, S., and Williams, L. T. (1991) Mol. Cell. Biol. 11, 4627-4634 [Abstract/Free Full Text]
  35. Harada, Y., Nakamura, M., and Asano, A. (1995) J. Biochem. (Tokyo) 118, 780-790 [Abstract/Free Full Text]
  36. Nakamura, M., Sakanaka, C., Aoki, Y., Ogasawara, H., Tsuji, T., Kodama, H., Matsumoto, T., Shimizu, T., and Noma, M. (1995) J. Biol. Chem. 270, 30102-30110 [Abstract/Free Full Text]
  37. Miura, Y., Tam, T., Ido, A., Morinaga, T., Miki, T., Hashimoto, T., and Tamaoki, T. (1995) J. Biol. Chem. 270, 26840-26848 [Abstract/Free Full Text]
  38. Gross, N., Beck, D., Beretta, C., Jackson, D., and Perruisseau, G. (1995) Eur. J. Cancer. 31, 471-475 [CrossRef]
  39. Hou, J., Kan, M., McKeehan, K., McBride, G., Adams, P., and McKeehan, W. L. (1991) Science 251, 665-668 [Abstract/Free Full Text]
  40. Wang, F., Kan, M., Xu, J., Yan, G., and McKeehan, W. L. (1995) J. Biol. Chem. 270, 10222-10230 [Abstract/Free Full Text]
  41. Del Gatto, F., and Breathnach, R. (1995) Mol. Cell. Biol. 15, 4825-4834 [Abstract]
  42. Gilbert, E., Del Gatto, F., Champion-Arnaud, P., Gesnel, M.-C., and Breathnach, R. (1993) Mol. Cell. Biol. 13, 5461-5468 [Abstract/Free Full Text]
  43. Kawagishi, J., Kumabe, T., Yoshimoto, T., and Yamamoto, T. (1995) Genomics 30, 224-232 [CrossRef][Medline] [Order article via Infotrieve]
  44. Black, D. L. (1995) RNA 1, 763-771 [Medline] [Order article via Infotrieve]
  45. Fu, X. (1995) RNA 1, 663-680 [Medline] [Order article via Infotrieve]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
N. A. Patel, H. S. Apostolatos, K. Mebert, C. E. Chalfant, J. E. Watson, T. S. Pillay, J. Sparks, and D. R. Cooper
Insulin Regulates Protein Kinase C{beta}II Alternative Splicing in Multiple Target Tissues: Development of a Hormonally Responsive Heterologous Minigene
Mol. Endocrinol., April 1, 2004; 18(4): 899 - 911.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
H. Lou and R. F. Gagel
Alternative Ribonucleic Acid Processing in Endocrine Systems
Endocr. Rev., April 1, 2001; 22(2): 205 - 225.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
W. Jin, I. E. McCutcheon, G. N. Fuller, E. S-C. Huang, and G. J. Cote
Fibroblast Growth Factor Receptor-1 {{alpha}}-Exon Exclusion and Polypyrimidine Tract-binding Protein in Glioblastoma Multiforme Tumors
Cancer Res., March 1, 2000; 60(5): 1221 - 1224.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Cell Physiol.Home page
W. P. Dirksen, F. Vladic, and S. A. Fisher
A myosin phosphatase targeting subunit isoform transition defines a smooth muscle developmental phenotypic switch
Am J Physiol Cell Physiol, March 1, 2000; 278(3): C589 - C600.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Jin, E. S.-C. Huang, W. Bi, and G. J. Cote
Redundant Intronic Repressors Function to Inhibit Fibroblast Growth Factor Receptor-1 alpha -Exon Recognition in Glioblastoma Cells
J. Biol. Chem., September 24, 1999; 274(39): 28035 - 28041.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
W. Jin, W. Bi, E. S-C. Huang, and G. J. Cote
Glioblastoma Cell-specific Expression of Fibroblast Growth Factor Receptor-1{beta} Requires an Intronic Repressor of RNA Splicing
Cancer Res., January 1, 1999; 59(2): 316 - 319.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Yang, L. J. Embree, S. Tsai, and D. D. Hickstein
Oncoprotein TLS Interacts with Serine-Arginine Proteins Involved in RNA Splicing
J. Biol. Chem., October 23, 1998; 273(43): 27761 - 27764.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Jin, E. S.-C. Huang, W. Bi, and G. J. Cote
Exon Sequence Is Required for Regulated RNA Splicing of the Human Fibroblast Growth Factor Receptor-1 alpha -Exon
J. Biol. Chem., June 26, 1998; 273(26): 16170 - 16176.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. E. Lopez and M. Korc
A Novel Type I Fibroblast Growth Factor Receptor Activates Mitogenic Signaling in the Absence of Detectable Tyrosine Phosphorylation of FRS2
J. Biol. Chem., May 19, 2000; 275(21): 15933 - 15939.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cote, G. J.
Right arrow Articles by Morrison, R. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cote, G. J.
Right arrow Articles by Morrison, R. S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement