Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leung, H.-C. E.
Right arrow Articles by Winkler, M. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Leung, H.-C. E.
Right arrow Articles by Winkler, M. E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


Volume 272, Number 20, Issue of May 16, 1997 pp. 13073-13083
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Regulation of Substrate Recognition by the MiaA tRNA Prenyltransferase Modification Enzyme of Escherichia coli K-12*

(Received for publication, January 6, 1997, and in revised form, February 18, 1997)

Hon-Chiu Eastwood Leung , Yuqing Chen and Malcolm E. Winkler Dagger

From the Department of Microbiology and Molecular Genetics, University of Texas Houston Medical School, Houston, Texas 77030-1501

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
Note Added in Proof
REFERENCES


ABSTRACT

We purified polyhistidine (His6)-tagged and native Escherichia coli MiaA tRNA prenyltransferase, which uses dimethylallyl diphosphate (DMAPP) to isopentenylate A residues adjacent to the anticodons of most tRNA species that read codons starting with U residues. Kinetic and binding studies of purified MiaA were performed with several substrates, including synthetic wild-type tRNAPhe, the anticodon stem-loop (ACSLPhe) of tRNAPhe, and bulk tRNA isolated from a miaA mutant. Gel filtration shift and steady-state kinetic determinations showed that affinity-purified MiaA had the same properties as native MiaA and was completely active for tRNAPhe binding. MiaA had a Kmapp (tRNA substrates) approx 3 nM, which is orders of magnitude lower than that of other purified tRNA modification enzymes, a Kmapp (DMAPP) = 632 nM, and a kcatapp = 0.44 s-1. MiaA activity was minimally affected by other modifications or nonsubstrate tRNA species present in bulk tRNA isolated from a miaA mutant. MiaA modified ACSLPhe with a kcatapp/Kmapp substrate specificity about 17-fold lower than that for intact tRNAPhe, mostly due to a decrease in apparent substrate binding affinity. Quantitative Western immunoblotting showed that MiaA is an abundant protein in exponentially growing bacteria (660 monomers per cell; 1.0 µM concentration) and is present in a catalytic excess. However, MiaA activity was strongly competitively inhibited for DMAPP by ATP and ADP (Kiapp = 0.06 µM), suggesting that MiaA activity is inhibited substantially in vivo and that DMAPP may bind to a conserved P-loop motif in this class of prenyltransferases. Band shift, filter binding, and gel filtration shift experiments support a model in which MiaA tRNA substrates are recognized by binding tightly to MiaA multimers possibly in a positively cooperative way (Kdapp approx 0.07 µM).


INTRODUCTION

The tRNA prenyltransferase (EC 2.5.1.8) encoded by the miaA gene of Escherichia coli catalyzes the addition of a Delta 2-isopentenyl group from dimethylallyl diphosphate (DMAPP)1 to the N6-nitrogen of adenosine adjacent to the anticodon at position 37 of 10 of 46 E. coli tRNA species (i6A37, see Fig. 1 and Refs. 1-4). On the basis of a theoretical model of yeast tRNASer structure, the N6-nitrogen of A37 in tRNA substrates of MiaA is recessed and points inward toward the center of the anticodon loop (5). In E. coli, the i6A37 tRNA modification is further methylthiolated by the action of the MiaB and MiaC enzyme activities to form ms2i6A37 (Fig. 1), except for tRNASec (6). ms2i6A37-modified tRNA species read codons starting with U residues and include tRNAPhe, tRNATrp, tRNATyr (I and II), tRNACys, tRNALeu (IV and V), and tRNASer (II and III) but not tRNASer (I and V) (7, 8).


Fig. 1. Biosynthesis of i6A37 in tRNA molecules by the E. coli MiaA tRNA prenyltransferase. The MiaA substrate DMAPP is not derived in E. coli directly from mevalonic acid as it is in many other organisms (69). The i6A37 modified base is further methylthiolated to ms2i6A37 by the MiaB and MiaC activities, which are not yet characterized (3, 6). SAM, S-adenosylmethionine; Cys, cysteine; SAH, S-adenosylhomocysteine.
[View Larger Version of this Image (21K GIF file)]

The E. coli MiaA prenyltransferase is an excellent model to study fundamental aspects of the modification process. Unlike many modifications, the function of ms2i6A37 in translation has been studied extensively in vivo and in vitro (reviewed in Refs. 3, 4, and 9). The ms2i6A37 tRNA modification is thought to stabilize tRNA-mRNA interactions by improving intrastrand stacking within tRNA anticodon loops and interstrand stacking between codons and anticodons (10, 11). ms2i6A37 also seems to influence the conformation of the tRNA anticodon loop and thereby affect interstrand stacking interactions between wobble bases at position 34 in tRNA and bases immediately 3' to codons (4, 10). Lack of ms2i6A37 in the tRNA of miaA mutants of E. coli and Salmonella typhimurium results in multiple defects in translation efficiency, codon context sensitivity, and fidelity (10-21). These translation defects impart broadly pleiotropic phenotypes to miaA mutants that contain A37 instead of ms2i6A37 in their tRNA (Fig. 1) (3, 4), including decreased growth rate and yield (12, 13), altered sensitivity to amino acid analogs (12), increased oxidation of certain amino acids, and tricarboxylic acid cycle intermediates (22), altered utilization of primary carbon sources (22), moderately increased GC right-arrow TA transversion frequency in nutritionally limited cells (19, 23), suppression of Tet(M)-protein-induced tetracycline resistance (24), decreased DNA oxidation damage in exponentially growing cells,2 and temperature sensitivity for colony formation at 45 °C (25). Lack of ms2i6A37 does not seem to affect the aminoacylation of tRNA (21, 26, 27) or amino acid-tRNA-EFTu·GTP selection (4). Many of these miaA phenotypes may be caused by disruptions in translational control mechanisms, such as the ones that regulate expression of the tryptophan (trp) (28, 29) and the tryptophanase (tna) (30, 31) operons.

The E. coli miaA gene was cloned (23, 32), sequenced (19), and found to be a member of a superoperon with unusual structure and complex modes of regulation (22, 25, 33). Homologs of E. coli miaA have also been sequenced in several other organisms (34, 35). Notably, the miaA homolog of yeast, designated MOD5, has been developed into an important system to study subcellular localization of proteins (36). Over 20 years ago, Rosenbaum and Gefter (37) and Söll and co-workers (38) partially purified E. coli MiaA. These pioneering studies demonstrated the substrates and some of the conditions required for MiaA activity and established the sequential pathway for ms2i6A37 biosynthesis in tRNA (Fig. 1; reviewed in Refs. 3 and 4). In this paper, we report rapid methods of MiaA purification and analyses of MiaA steady-state kinetics and tRNA substrate utilization and binding. We also present direct quantitation of the cellular amount of the MiaA tRNA modification enzyme. Our results show that MiaA substrate selection is complicated and likely regulated by several mechanisms.


EXPERIMENTAL PROCEDURES

Materials

[alpha -32P]CTP (10 mCi per ml, >400 Ci per mmol) was purchased from Amersham Corp. [1-3H]DMAPP (0.5 mCi per ml; 15 Ci per mmol) and cold DMAPP were from American Radiolabeled Chemicals. Restriction enzymes, polynucleotide kinase, T4 DNA ligase, and Riboprobe and Ribomax RNA synthesis systems were purchased from Promega. BstN1 and strain JM105 were obtained from New England Biolabs. Plasmid pET-15b, E. coli strain HMS174, and biotinylated thrombin were obtained from Novagen. Plasmid pKK223-3, a Superose 12 HR 10/30 column, and PD-10 columns were from Pharmacia Biotech Inc. W-POREX DEAE columns (250 × 4.6 mm) were from Phenomenex. DEAE-cellulose (DE-52) was from Whatman. ATP, ADP, and other biochemicals were purchased from Sigma. A protein isolation kit for sorbent identification (PIKSI) was purchased from American International Chemical. Bradford and DC protein assay reagents were bought from Bio-Rad.

Construction of Expression Vectors pTX439 and pTX440

Cloning and other molecular biological procedures were done by standard methods (39), unless indicated otherwise. A his6-tag-miaA+ gene fusion under the control of the T7-phage promoter was constructed in vector pET-15b by ligating together the following three fragments: (i) a 5.7-kilobase fragment of pET-15b digested with NdeI and BamHI; (ii) a 519-bp NdeI-MslI fragment generated by polymerase chain reaction with primers UMiaA and LMiaA (Table I) containing the amino-terminal segment of miaA with an NdeI site added at the miaA start codon; and (iii) a 579-bp MslI-BstYI fragment containing the carboxyl-terminal segment of miaA+ obtained from plasmid pTX312 (22). This strategy limited the length of polymerase chain reaction-amplified DNA fragments used in the construction. Ligation mixtures were transformed into strain JM105, and the desired construct, designated pTX439, was identified by restriction digestion patterns of purified plasmid DNA, DNA sequencing of the miaA segment generated by polymerase chain reaction amplification, and complementation of a miaA::Tn10 null mutation in E. coli strain DEV15 (14, 19). pTX439 was transformed into E. coli strain HMS174 to give strain TX3371, in which the His6-MiaA protein was overexpressed (see Ref. 40).

Table I. Oligonucleotides used to construct synthetic genes transcribed into tRNAPhe(wt), ACSLPhe(wt), and mutant variants

See "Experimental Procedures" for construction of synthetic genes and in vitro transcription to produce RNA molecules. See "Experimental Procedures" for construction of synthetic genes and in vitro transcription to produce RNA molecules.

Oligonucleotide designation Sequence (5' to 3')

UMiaA (26-mer) ATAAAAGCCCTGACATATGAGTGATA
LMiaA (22-mer) AAGCCTTTGTGGATCATTTGGA
tRNAphe1 (32-mer) TCGACTAATACGACTCACTATAGCCCGGATAG
tRNAphe2 (33-mer) CTCAGTCGGTAGAGCAGGGGATTGAAAATCCCC
tRNAphe3 (34-mer) GTGTCCTTGGTTCGATTCCGAGTCCGGGCACCAG
tRNAphe4 (30-mer) GATCCTGGTGCCCGGACTCGGAATCGAACC
tRNAphe5 (33-mer) AAGGACACGGGGATTTTCAATCCCCTGCTCTAC
tRNAphe6 (36-mer) CGACTGAGCTATCCGGGCTATAGTGAGTCGTATTAG
U60C-forward (34-mer) GTGTCCTTGGTTCGATCCCGAGTCCGGGCACCAG
U60C-reverse (30-mer) GATCCTGGTGCCCGGACTCGGGATCGAACC
A37G-forward (33-mer) CTCAGTCGGTAGAGCAGGGGATTGAAGATCCCC
A37G-reverse (33-mer) AAGGACACGGGGATCTTCAATCCCCTGCTCTAC
SL1 (39-mer) AATTCTAATACGACTCACTATAGGGGATTGAAAATCCCC
SL2 (35-mer) GGGGATTTTCAATCCCCTATAGTGAGTCGTATTAG
SL-A37G1 (39-mer) AATTCTAATACGACTCACTATAGGGGATTGAAGATCCCC
SL-A37G2 (35-mer) GGGGATCTTCAATCCCCTATAGTGAGTCGTAGTAG

The native MiaA protein was overexpressed from plasmid pTX440, which was constructed by ligating a 1.1-kilobase FspI-ScaI fragment containing the intact miaA+ gene from pTX312 (22) downstream of the Ptac promoter in plasmid pKK223-3. Ligation mixtures were transformed into strain JM105 to give strain TX3367. The orientation of the miaA+ fragment in purified pTX440 plasmid was confirmed by restriction digestion patterns and DNA sequencing.

Overexpression and Purification of His6-MiaA

960-ml cultures of strain TX3371 were grown in LB medium containing 50 µg of carbenicillin per ml and induced with 1 mM IPTG as described before (40). His6-MiaA protein was purified by one-step batchwise Ni2+-chelation affinity chromatography as described previously (40), except that the wash buffer contained 40 mM imidazole instead of 60 mM imidazole. Eluted His6-MiaA was desalted on PD-10 columns into 2 × TMD buffer (60 mM Tris-HCl (pH 7.5 at 24 °C), 20 mM MgCl2, and 2 mM dithiothreitol (DTT)). Similar MiaA concentrations were found using the Bradford and DC(Lowry) protein assays with bovine serum albumin (BSA) as the standard. After desalting, an equal volume of 72% (v/v) glycerol was added to the His6-MiaA preparation, and the protein solutions were divided into small volumes and stored at -70 °C. His6-MiaA samples were thawed only once and used immediately.

The His6-tag was cleaved from 50 µg of His6-MiaA by digesting at room temperature for 3 h with 1 unit of biotinylated thrombin in the buffer provided by the manufacturer. The resulting protein mixture was used immediately for enzyme assays and binding studies without further purification. His6-MiaA purity and the extent of thrombin cleavage were determined by SDS, 15% PAGE (5.6% stacking) as described before (41).

Purification of Native MiaA Protein by Mimetic Dye Chromatography

Six 400-ml cultures of E. coli strain TX3367 were grown in LB medium containing 50 µg of ampicillin per ml at 37 °C with shaking (300 rpm) until they reached a turbidity of 50 Klett (660 nm) units, upon which IPTG was added to a final concentration of 1 mM. Cultures were incubated at 37 °C with shaking for 3 h longer, after which they were chilled on ice. All subsequent steps were carried out at 4 °C, unless noted otherwise. Cells were collected by centrifugation (5000 × g) for 15 min, and pellets were suspended in 300 ml of TMD buffer (30 mM Tris-HCl (pH 7.5 at 24 °C), 10 mM MgCl2, and 1 mM DTT). Cells were collected again by centrifugation (5000 × g) for 15 min, and pellets were suspended in 18 ml of TMD buffer. The cell suspension was passed twice through a chilled French pressure cell at 20,000 p.s.i. Cell lysates were centrifuged at 150,000 × g for 60 min, and supernates were filtered through 0.22-µm acetate filters (Micron Separations). 60 mg of protein extract was loaded by gravity flow onto each of the 10 different mimetic dye PIKSI-kit columns, which had been equilibrated with TMD buffer. Each column was washed by gravity flow with 5 ml of TMD buffer containing 0.05 M KCl. Proteins were eluted by two consecutive 5-ml washes of TMD buffer containing 0.2 M KCl followed by 0.8 M KCl. 100-µl drops of the eluants from each column were placed on Type VS filter disks (0.025 µm, Millipore), which had been floated on TMD buffer, and the eluants were dialyzed against TMD buffer at 4 °C for 30 min. 15 µg and 5 ng of the dialyzed eluants from each column were analyzed by SDS-PAGE and assayed for MiaA prenyltransferase activity (below), respectively. The samples eluted with 0.8 M KCl from the Mimetic RedTM2 A6XL and Mimetic OrangeTM1 A6XL columns had the most MiaA activity and fewest other contaminating bands (data not shown). The eluant from the Mimetic Red column was pumped (0.3 ml per min) onto a room temperature Superose 12 HR 10/30 column, which was equilibrated and eluted with TMD buffer. Fractions were collected into chilled tubes and analyzed by SDS-PAGE and assayed for MiaA activity. The fractions that had a molecular mass of about 35 kDa and maximum MiaA enzyme activity were pooled, diluted with an equal volume of 72% (v/v) glycerol, distributed into small volumes, and stored at -70 °C.

Construction of Plasmids for in Vitro Synthesis of tRNAPhe, Anticodon Stem-Loop of tRNAPhe (ACSLPhe), and Mutant Variants

A synthetic E. coli pheU gene encoding wild-type tRNAPhe (Fig. 2A, see "Results") was constructed by ligating together six oligonucleotides (tRNAphe1 to tRNAphe6; Table I) to form an upstream SalI restriction sequence, a T7-phage RNA polymerase promoter preceding the 76-base pair (bp) pheU gene, and downstream BstNI and BamHI restriction sites (42). Positive strand oligomers tRNAphe1, tRNAphe2, and tRNAphe3 and negative strand oligomers tRNAphe4, tRNAphe5, and tRNAphe6 were phosphorylated with T4-phage polynucleotide kinase and annealed together in T(0.1)E buffer (10 mM Tris-HCl (pH 8), 0.1 mM EDTA) by heating at 90 °C for 5 min followed by slow cooling to room temperature. The annealed oligomers were ligated with an equal amount of pUC18 DNA that had been digested with SalI and BamHI, and the ligation mixture was transformed into strain JM105. The desired plasmid, designated pTX442, was identified by restriction digestion patterns, which were confirmed by DNA sequencing of the entire synthetic pheU gene.


Fig. 2. tRNAPhe derivatives and microhelices based on tRNAPhe molecules synthesized in vitro for this study (see "Experimental Procedures"). A, cloverleaf depictions of tRNAPhe(wt), tRNAPhe(U60C), and tRNAPhe(A37G). B, ACSLPhe(wt) and ACSLPhe(A11G) microhelices. The A residue isopentenylated by MiaA is underlined.
[View Larger Version of this Image (20K GIF file)]

A synthetic mutant pheU gene specifying tRNAPhe(U60C) (Fig. 2A, see "Results") was constructed by replacing tRNAphe3 and tRNAphe4 with U60C-forward and U60C-reverse (Table I) in the above cloning strategy to give plasmid pTX476. A synthetic mutant pheU gene specifying tRNAPhe(A37G) (Fig. 2A, see "Results") was constructed by replacing tRNAphe2 and tRNAphe5 with A37G-forward and A37G-reverse (Table I) to give plasmid pTX475. A synthetic gene specifying wild-type ACSLPhe (Fig. 2B, see "Results") was constructed by annealing together SL1 and SL2, which provided an upstream HindIII site, a T7-phage polymerase promoter abutting the 17-bp ACSLPhe gene, and downstream SmaI and BamHI sites. The two oligomers were phosphorylated and annealed as described above and ligated into pUC18 cut with HindIII and BamHI to give plasmid pTX539. A mutant variant, ACSLPhe(A11G) (Fig. 2B, see "Results"), was constructed in the same way by replacing SL1 and SL2 with SL-A37G1 and SL-A37G2 to give plasmid pTX540.

In Vitro Synthesis and Purification of tRNAPhe, ACSLPhe, and Mutant Variants

Plasmids pTX442, pTX475, pTX476, pTX539, and pTX540 were purified using a MidiPrep kit (Qiagen). Purified plasmids pTX442, pTX475, and pTX476 or pTX539 and pTX540 were digested to completion with BstNI or SmaI, respectively, which ultimately give the correct 3'-ends in the transcribed products (Fig. 2, A and B, respectively) (43). Digestion mixtures were extracted once with an equal volume of TM (30 mM Tris-HCl (pH 7.5 at 24 °C) 10 mM MgCl2)-saturated phenol:chloroform (1:1) and four times with ethyl ether before being precipitated with ethanol (39). Linearized DNA templates were transcribed in vitro by T7-phage RNA polymerase provided in the Riboprobe or Ribomax kits according to the manufacturer's instructions. Transcripts were labeled with 32P by adding 5 µl of [alpha -32P]CTP per 100-µl transcription reaction mixture. Transcription reaction mixtures were incubated at 37 °C overnight. DNA templates were removed by digestion with RQ1 DNase (1 unit per 1 µg of DNA) at 37 °C for 1 h. Digestion mixtures were extracted once with an equal volume of TM-saturated phenol:chloroform (1:1) and four times with ethyl ether before precipitation with ethanol. Pellets were collected by centrifugation in a microcentrifuge, dried, and suspended in T(0.1)E buffer.

tRNAPhe, ACSLPhe, and mutant variants were further purified from nucleotides and aborted transcripts by DEAE high performance liquid chromatography. Resuspended mixtures were applied at a flow rate of 1 ml per min to a W-POREX DEAE column equilibrated with 20 mM sodium phosphate buffer (pH 6.5). RNA molecules were eluted with a linear 0.2 to 1 M NaCl gradient (ramp = 60 min) in 20 mM sodium phosphate buffer (pH 6.5) (no urea) at room temperature. Intact tRNAPhe or ACSLPhe, which eluted at about 44 or 36 min, respectively, into the gradient, were pooled, precipitated with ethanol, and stored as dried pellets at -20 °C. Before use, the purified tRNAPhe and ACSLPhe preparations were suspended in T(0.1)E buffer, heated at 90 °C for 2 min, and cooled slowly to room temperature. Concentrations of the tRNAPhe and ACSLPhe molecules were determined by using A260 extinction coefficients calculated from base compositions by the Oligo 4.0 program (National Biosciences). The yield from the Riboprobe or Ribomax kit was 7.5 µg of tRNAPhe from 5 µg of linearized DNA in a 100-µl reaction mixture or 400 µg of tRNAPhe from 20 µg of linearized DNA in a 200-µl reaction mixture, respectively. tRNAPhe(wt) preparations analyzed by urea-20%-PAGE lacked detectable contamination by an (n + 1) tRNAPhe product, which contains an extra 3'-nucleotide (data not shown (43)).

Purification of Bulk tRNA from E. coli

Bulk tRNA was purified from 4 liters overnight LB cultures of strains NU398 (DEV15 miaA::Tn10) and NU394 (DEV15 miaA+) as described previously (23) with some modifications. Briefly, cultures were chilled and cells were collected by centrifugation (5000 × g) for 10 min and suspended in 20 ml of cold TMD buffer. All remaining steps were performed at 4 °C, unless noted otherwise. 20 ml of TM-saturated phenol was added to the suspended cells, and the mixture was agitated vigorously on a wrist shaker for 1 h. Lysed cells and phenol were removed by centrifugation (14,000 × g) for 30 min. The aqueous phases were loaded by gravity flow onto separate low pressure DEAE-cellulose columns (2.5 × 3 cm) equilibrated with TM buffer containing 0.02 M NaCl. The columns were washed with TM buffer + 0.02 M NaCl at a flow rate of 2 ml per min for 110 min and then eluted with a linear 0.02 M to 1 M NaCl gradient (ramp = 110 min) in TM buffer. Samples with A260 > 1 were pooled, precipitated with ethanol, and stored as dry pellets at -20 °C. For kinetic experiments, bulk tRNA was suspended in T(0.1)E buffer, heated at 90 °C for 2 min, and cooled slowly to room temperature. Concentrations of bulk tRNA were determined from A260 (extinction coefficient = 40 µg per A260 unit). The yield of bulk tRNA was 15-25 mg per 10 g of wet cells.

Gel Filtration Shift Assays

Binding reaction mixtures (200 µl) contained TMD buffer and 100 µg of BSA per ml, usually 3.3 to 16.4 µM of His6-MiaA protein, and up to 3.3 µM of tRNAPhe(wt) or tRNAPhe(A37G). Binding reaction mixtures were incubated at 24 °C for 30 min before being injected onto a Superose 12 HR 10/30 sizing column equilibrated with TMD buffer (flow rate = 0.3 ml per min at room temperature). Molecules were resolved in TMD buffer at the same flow rate and detected by A280. The column was calibrated with size standards (thyroglobulin, 669 kDa; beta -amylase, 200 kDa; BSA, 66 kDa; chicken bovine albumin, 35 kDa; carbonic anhydrase, 29 kDa; and cytochrome c, 12.4 kDa) between runs of different samples.

Steady-state Kinetic Determinations

Reactions were optimized by checking several conditions (see below). Standard reaction mixtures (50 µl) contained TMD buffer and 100 µg of BSA per ml. DMAPP excess reactions contained 4.0 µM (0.105 Ci/mmol) [1-3H]DMAPP (approx 7 × Kmapp), and the tRNAPhe, bulk tRNA from a miaA mutant, or ACSLPhe concentration was varied from 0.004 to 0.16 µM (24 or 37 °C), 0.04 to 0.4 µM (37 °C), and 0.04 to 0.4 µM (24 °C), respectively. tRNAPhe excess reactions contained 0.08 µM of wild-type tRNAPhe (approx 35 × Kmapp), and [1-3H]DMAPP (0.105 Ci/mmol) was varied from 0.1 to 10 µM. Reactions were started by adding 5 ng of MiaA enzyme preparations, which had been diluted from storage buffer into cold TMD buffer immediately before use. Reactions were stopped at various times by adding 0.5 ml of cold 10% (w/v) trichloroacetic acid. Precipitates were collected onto 25-mm Whatman GF/C filters, which were washed with 10 ml of cold 10% trichloroacetic acid and then 10 ml of cold 100% ethanol. The filters were dried for 10 min under an infrared heat lamp and counted in 3.5 ml of Ultima Gold XR scintillation mixture (Packard). Product formation was linear with time for at least 8 min at the highest and lowest concentrations of substrates used, and initial velocities were usually determined from 2-min reactions for intermediate substrate concentrations. ATP or ADP concentrations between 30 nM and 10 µM were added to tRNAPhe excess reactions to test inhibition of MiaA for DMAPP. Kinetic parameters were calculated by using the Enzfitter nonlinear regression data analysis program (Biosoft).

As noted previously for partially purified preparations (37), the activity of purified His6-MiaA was strongly reduced in reaction mixtures at pH values below 6 and above 10, containing 50 mM NaPO4 buffer (pH 7.5) instead of Tris-HCl (pH 7.5), and lacking reducing agent, such as DTT (data not shown) (37, 38). Omission of BSA from reaction mixtures reduced His6-MiaA activity by 42%, and plots of (product formation) versus (enzyme concentration) × (assay time) (44) indicated that BSA stabilized His6-MiaA in reaction mixtures at 37 °C (data not shown). His6-MiaA activity was maximal in reaction mixtures containing DTT, BSA, and 10 mM MgCl2 or 1 mM MnCl2, but was reduced to 53, 43, 6, or <1% when 10 mM MgCl2 was replaced by 20 mM MgCl2, 10 mM MgSO4, 10 mM MnCl2, or 10 mM ZnSO4 or 1 mM EDTA (data not shown). His6-MiaA (5 ng) diluted into TMD containing 100 µg of BSA per ml was thermally stable at 24 to 37 °C for at least 15 min but was rapidly inactivated by incubation at temperatures above 45 °C (data not shown).

Quantitative Western Immunoblotting Blotting

We used purified His6-MiaA as an antigen for the production of anti-MiaA polyclonal antibodies in rabbits (see Ref. 41). E. coli strains TX2494 (CC104 miaA+) and TX2590 (CC104 miaA::Omega Kmr) were grown in 400 ml of Vogel-Bonner (1 × E) minimal salts medium supplemented with 0.4% glucose and enriched with 0.5% acid casein hydrolysate (Difco) (25). Subsequent steps was carried out as described previously (45), except that His6-MiaA or thrombin-treated His6-MiaA were used as standards. Air-dried immunoblots were scanned on a Hewlett-Packard ScanJet 4C scanner, and bands were quantitated by using SigmaScan software (Jandel).

Band Shift Assays

The binding reaction mixture (50 µl) contained TMD and 100 µg of BSA per ml. In protein excess titrations (46-48), the concentration of 32P-labeled tRNAPhe or ACSLPhe molecules was fixed at 0.8 or 3.6 nM, respectively, and the concentration of His6-MiaA protein was varied between 5.8 nM and 14.2 µM. In ligand excess titrations (46-48), the concentration of His6-MiaA protein was fixed in the range of 0.5 to 1.3 µM, and the concentration of 32P-labeled tRNAPhe or ACSLPhe molecules was varied from 0.1 to 1.6 µM or 0.1 to 10 µM, respectively. Binding reaction mixtures were incubated for 30 min at room temperature. RNA-protein complexes were resolved from free RNA molecules by electrophoresis through native 6% (w/v) polyacrylamide gels (29:1 acrylamide:bisacrylamide) containing 10 mM Tris acetate (pH 8.0), 0.1 mM EDTA, and 1 mM DTT. Gels were prerun at 200 V at 4 °C for 2 h immediately before use. 30 µl of 40% sucrose was added to samples before loading them onto gels. Gels were run at 200 V at 4 °C for 2 h. Radioactive bands were visualized by autoradiography of dried gels and were quantitated by direct counting in an Instant Imager (Packard).

Nitrocellulose Filter Retention Assays

Triplicate binding reactions were carried out in 100 µl of TMD containing 100 µg of BSA per ml. In protein excess titrations, the concentration of 32P-labeled tRNAPhe or ACSLPhe molecules was fixed at 20 pM or 1.8 nM, respectively, and the concentration of His6-MiaA protein was varied between 0.56 nM to 15.9 µM. In some protein excess titrations, 100 µg of BSA per ml was added to filter soaking and washing solutions (48). In ligand excess titrations, the concentration of His6-MiaA protein was fixed in the range from 1.8 to 2.2 µM, and the concentration of 32P-labeled tRNAPhe or ACSLPhe molecules was varied from 10 nM to 5.0 µM. BSA was omitted from the filter soaking and washing solutions used for ligand excess titrations, because we found that the saturation level for MiaA·tRNAPhe complex formation was about 2-fold higher when BSA was omitted. Binding reaction mixtures were incubated for 30 min at room temperature and passed through soaked (TMD buffer for at least 1 h) nitrocellulose filters (13 diameter, 0.45 µm pore size; Schleicher & Schuell) filters contained in a manifold (Hoefer Scientific) connected to house vacuum (15-20 in Hg). Filters were washed twice with 300 µl of cold TMD buffer, dried briefly on the manifold, and counted in Ultima Gold XR scintillation mixture (Packard). The background dpm of control reactions lacking His6-MiaA was less than 10% of the input radioactivity and was subtracted in all cases. The retention efficiency of MiaA·tRNAPhe(wt) complexes ranged from about 65% to about 85% at saturation in protein excess titrations when BSA was added or omitted, respectively, from soaking and washing solutions. The retention efficiency of MiaA·ACSLPhe(A11G) complexes was about 40% at saturation in protein excess titrations when BSA was omitted from soaking and washing solutions. MiaA·ACSLPhe(wt) complexes were not detected by the filter binding assay.


RESULTS

Purification of MiaA Protein

We set up rapid methods to purify large amounts of active MiaA protein for kinetic and binding studies. We constructed an in-frame translation fusion between the His6-containing leader peptide encoded by vector pET15b and the presumed translation start codon of MiaA (see "Experimental Procedures" (19)). IPTG induction of the T7-phage promoter driving the fusion caused 1,340-fold overexpression of His6-MiaA in crude extracts as measured by quantitative Western immunoblotting (Fig. 3, lanes 2 and 3; "Experimental Procedures"). Single-step, batchwise, metal ion affinity chromatography on activated Ni2+ resin resulted in electrophoretically pure His6-MiaA (Fig. 3, lane 4). The yield of His6-MiaA from 960 ml of bacterial culture was 6 mg with a specific activity of 700 nmol of i6A formed per min per mg of protein using synthetic tRNAPhe(wt) as a substrate (see below, and see "Experimental Procedures"). The His6-affinity tag could be completely cleaved from the fusion protein by thrombin protease (Fig. 3, lane 5; "Experimental Procedures"). Gel filtration analyses indicated that the cleaved His6-affinity tag was likely released from the MiaA protein (below).


Fig. 3. SDS-PAGE analysis of samples from different stages of purification of His6-MiaA protein from strain TX3371. Affinity purification of His6-MiaA and thrombin cleavage to remove the His6-tag are described under "Experimental Procedures." The gel was stained with Coomassie Brilliant Blue dye (41). Lane 1, polypeptide molecular mass markers (2 µg each); lane 2, 60 µg of crude extract from an uninduced culture; lane 3, 60 µg of crude extract from a culture induced for His6-MiaA overexpression with 1 mM IPTG for 3 h; lane 4, 3 µg of single-step affinity-purified His6-MiaA; lane 5, 2 µg of thrombin-treated MiaA lacking the His6-tag.
[View Larger Version of this Image (72K GIF file)]

We also devised a two-step purification of small amounts of native MiaA to allow comparisons with the kinetic properties of His6-MiaA and thrombin-treated MiaA. We overexpressed native MiaA by IPTG induction of the Ptac promoter of plasmid pTX440 (see "Experimental Procedures"). The MiaA protein was purified by step-elution off a mimetic red dye column followed by gel filtration (see "Experimental Procedures"). The purified preparation contained approximately equal amounts of one 46-kDa contaminant band and the 35-kDa MiaA band on Coomassie-stained SDS-polyacrylamide gels (data not shown). The yield of native MiaA from 2.4 liters of bacterial culture was 0.02 mg with a specific activity of 440 nmol of i6A formed per min per mg of protein using synthetic tRNAPhe(wt) as a substrate (see below and see "Experimental Procedures").

Number of MiaA Molecules Per Cell

We performed quantitative Western immunoblot analyses to determine the average number of MiaA molecules present in an E. coli cell growing exponentially in enriched minimal salts/glucose medium at 37 °C ((Fig. 4; see "Experimental Procedures") (45). As standards for these analyses, we added known amounts of purified thrombin-treated MiaA to crude extracts of a miaA null mutant (Fig. 4, lanes 4-9). We then loaded amounts of crude extract from miaA+ cells so that the MiaA detected was within the linear range of the standards (Fig. 4, lanes 1-3). By this analysis, we found about 4.0 ng of MiaA protein was present in 100 µg of extract of E. coli K-12 growing exponentially in enriched minimal salts/glucose medium at 37 °C. This amount corresponds to about 660 monomers of MiaA per cell and a cellular MiaA concentration of about 1.0 µM, where the volume of an E. coli cell was taken as 1.0 × 10-12 ml (45). The spreading of MiaA standard bands on gels (Fig. 4, lanes 5-9) was caused by salt from the thrombin cleavage reaction. Similar quantitative results were obtained when His6-MiaA instead of thrombin-treated MiaA was used as a standard, in which case the standard bands were as tight as those from the wild-type extracts (data not shown). Finally, the cellular amount of MiaA dropped about 3-fold in cells in stationary phase (Fig. 4, lanes 1 and 2) compared with exponential phase (Fig. 4, lane 3).


Fig. 4. Quantitative Western immunoblotting to determine the amount of MiaA in E. coli cells growing exponentially or in stationary phase in enriched minimal salts/glucose medium at 37 °C. MiaA in 100 µg of total protein extract are shown as follows: lane 1, a miaA+ culture grown for 24 h after reaching early stationary phase; lane 2, a miaA+ culture at early stationary phase (280 Klett (660 nm) units); lane 3, a miaA+ culture growing exponentially (50 Klett (660 nm) units); and lane 4, a miaA::Omega (Kmr) null mutant grown for 24 h after reaching early stationary phase. Lanes 5-9, standards containing the same extract as in lane 4 and 32, 16, 8, 4, or 2 ng of added thrombin-treated MiaA, respectively. The gel was scanned, and MiaA bands were quantitated as described under "Experimental Procedures." The entire experiment was performed four times totally. The extra bands below MiaA are cross-reacting proteins to the anti-MiaA antibody, which was not extensively purified, and served as controls for loading.
[View Larger Version of this Image (23K GIF file)]

Preparation of RNA Substrates

Seven RNA substrates were purified for this study of MiaA enzymology. We chose wild-type E. coli tRNAPhe (Fig. 2A) as a model synthetic substrate for MiaA, because it had been characterized previously by Uhlenbeck and co-workers (49) in their analyses of aminoacyl-tRNAPhe synthetase. We synthesized tRNAPhe(wt) in vitro by using T7-phage RNA polymerase and purified the tRNAPhe(wt) away from aborted transcripts and nucleotides by DEAE high performance liquid chromatography (see "Experimental Procedures"). The synthetic tRNAPhe(wt) differed from native tRNAPhe in that it contained a 5'-triphosphate instead of a 5'-monophosphate and was fully unmodified at all positions (Fig. 2A).

We also constructed and synthesized four mutant variants of tRNAPhe(wt) and purified bulk tRNA from an E. coli miaA mutant and its miaA+ parent strain. Mutant tRNAPhe(U60C) (in which U at position 60 is replaced by C; Fig. 2A) is readily cleavable by lead ions if the tRNA molecule folds properly (49). tRNAPhe(U60C) was synthesized in case tRNAPhe(wt) was not fully available as a substrate for MiaA. Mutant tRNAPhe(A37G) (Fig. 2A) was synthesized as a specificity control and was not expected to be isopentenylated by MiaA. The synthetic ACSLPhe(wt) and its corresponding (A11G) mutant (Fig. 2B) were synthesized to test whether the determinants for i6A formation were contained in the ACSLPhe. High performance liquid chromatography analyses indicate that bulk tRNA isolated from miaA mutants seems to contain all RNA base modifications except for ms2i6A37 (23). Bulk tRNA from a miaA mutant also contains the majority of tRNA species that are not substrates for MiaA. tRNA isolated from the miaA+ strain should be fully modified, including with ms2i6A37, and was not expected to be a substrate for purified MiaA.

Binding Activity of His6-MiaA to Synthetic tRNAPhe(wt), ACSLPhe(wt), and tRNAPhe(A37G)

We determined whether the purified His6-MiaA was fully active for binding to tRNAPhe(wt) and vice versa by using a gel filtration shift assay (Fig. 5). tRNAPhe(wt) and bulk tRNA from a miaA mutant ran anomalously with an apparent molecular mass of 78 kDa instead of 25 kDa on a calibrated Superose 12 HR 10/30 sizing column (Fig. 5A). Purified His6-MiaA and thrombin-treated MiaA (23 µg) had apparent molecular masses of about 34 kDa (Fig. 5B) and 37 kDa, respectively, which approximated the 34-kDa monomer molecular mass predicted for MiaA from its amino acid sequence (19). The slightly lower mobility of His6-MiaA compared with thrombin-treated MiaA may have been caused by interaction between the His6-tag and the column matrix. A relatively large amount of crude extract (6 mg) from wild-type cells produced a single peak of MiaA activity with a molecular mass of about 45 kDa on the same column (data not shown). Thus, His6-MiaA, thrombin-treated MiaA, and native MiaA behaved as monomers under the experimental conditions used here.


Fig. 5. Gel filtration chromatographs of MiaA and complexes formed with synthetic tRNAPhe(wt) and tRNAPhe(A37G). The curves represent A280 plotted against elution times (earlier to later from left to right) from a Superose 12 HR 10/30 sizing column eluted isocratically with TMD buffer (flow rate = 0.3 ml per min at room temperature; see "Experimental Procedures"). Binding mixtures contained the following: 3.3 µM of tRNAPhe(wt) alone (A); 3.3 µM of purified His6-MiaA alone (B); equimolar amounts (3.3 µM) of His6-MiaA and tRNAPhe(wt) (C); 10-fold molar excess of His6-MiaA (16.5 µM) over tRNAPhe(wt) (1.65 µM) (D); equimolar amounts (3.3 µM) of His6-MiaA and tRNAPhe(A37G) (E), shown at half the amplitude as C. The experiments in each panel were repeated at least one time.
[View Larger Version of this Image (6K GIF file)]

Addition of an equimolar amount of tRNAPhe(wt) to His6-MiaA caused complete disappearance of the 34-kDa His6-MiaA monomer peak, about a 50% reduction in the free tRNAPhe(wt) peak, and the appearance of a new 110-kDa leading peak containing the His6-MiaA·tRNAPhe(wt) complex (Fig. 5C). This result showed that the purified His6-MiaA was fully active for binding to tRNAPhe(wt). Similar results were obtained for thrombin-treated MiaA (data not shown). Addition of His6-MiaA in a 10-fold molar excess over tRNAPhe(wt) caused the free tRNAPhe(wt) peak to disappear completely with a corresponding increase in the 110-kDa peak containing the His6-MiaA·tRNAPhe(wt) complex (Fig. 5D). This result showed that the tRNAPhe(wt) substrate was fully capable of binding to the His6-MiaA enzyme. The above conclusions were confirmed by kinetic and quantitative binding studies (below).

Gel filtration shift assays were also performed with mixtures of His6-MiaA and the ACSLPhe(wt) microhelix (Fig. 2B) or mutant tRNAPhe(A37G) (Fig. 2A). Free ACSLPhe(wt) ran anomalously with an apparent molecular mass of 25 kDa instead of 5 kDa on the Superose 12 HR 10/30 column (data not shown). All of the ACSLPhe(wt) could be shifted into a His6-MiaA·ACSLPhe(wt) complex with an apparent molecular mass of about 45 kDa (data not shown), which approximated the sum of the predicted monomer molecular masses of His6-MiaA (36 kDa) and ACSLPhe(wt) (5 kDa). The free His6-MiaA peak also disappeared completely from binding mixtures containing equimolar amounts of tRNAPhe(A37G) and His6-MiaA (Fig. 5E). However, the resulting complex had an apparent molecular mass of about 63 kDa, which approximated the sum of the predicted monomer molecular masses of His6-MiaA (36 kDa) and tRNAPhe(A37G) (25 kDa). Thus, on the basis of complex size, His6-MiaA bound to the ACSLPhe(wt) microhelix and mutant tRNAPhe(A37G) in an apparent 1:1 molar ratio, whereas His6-MiaA and thrombin-treated MiaA seemed to form a larger, comparatively stable 110-kDa complex with tRNAPhe(wt). The stoichiometry of tRNAPhe(wt) binding is considered below.

MiaA Enzyme Kinetics

We optimized an assay for determining initial rates of [3H]DMA transfer to unlabeled RNA substrates at 24 and 37 °C (see "Experimental Procedures"). [3H]i6A-modified RNA was recovered by precipitation with trichloroacetic acid. Typical Lineweaver-Burk plots of His6-MiaA with tRNAPhe(wt) and DMAPP are shown in Fig. 6, A and B, respectively, and steady-state kinetic data for various RNA substrates and MiaA preparations are compiled in Table II. The apparent substrate inhibition of His6-MiaA by tRNAPhe(wt) (Fig. 6A) was also observed for bulk tRNA from a miaA mutant (data not shown). Since the synthetic tRNAPhe(wt) substrate and bulk tRNA were prepared by different methods (see "Experimental Procedures"), it seems unlikely that this substrate inhibition (Fig. 6A) was caused by a low level contaminant in the synthetic tRNAPhe(wt) preparations. tRNAPhe(A37G) and bulk tRNA from a miaA+ strain were not modified by MiaA, confirming the specificity of the in vitro i6A37 modification reaction (data not shown).


Fig. 6. Representative Lineweaver-Burk plots of initial rate steady-state kinetic data for MiaA and its tRNAPhe(wt) and DMAPP substrates. A, tRNAPhe(wt) was varied in the presence of excess (4 µM) DMAPP. B, DMAPP was varied in the presence of excess (0.08 µM) tRNAPhe(wt). See "Experimental Procedures" for assay conditions and data analysis.
[View Larger Version of this Image (12K GIF file)]

Table II. Kinetic parameters of His6-MiaA, thrombin-treated MiaA, and native MiaA

Initial rates of RNA prenylation by [3H]DMAPP were measured and kinetic parameters were calculated by nonlinear regression analysis as described under "Experimental Procedures." Averages from several independent determinations are shown with S.E. Initial rates of RNA prenylation by [3H]DMAPP were measured and kinetic parameters were calculated by nonlinear regression analysis as described under "Experimental Procedures." Averages from several independent determinations are shown with S.E.

Protein preparation and substrate Kmapp Vmaxapp kcatappa kcatapp/Kmappa

nM µmol/min/mg s-1 nM-1s-1
37 °C
  His6-MiaA
    tRNAPhe(wt) 2.27  ± 0.5 0.68  ± 0.08 0.39 0.17
    tRNAPhe(U60C) 2.04  ± 0.5 0.75  ± 0.03 0.44 0.21
    Bulk tRNA from miaA mutant 4.26  ± 0.2 0.56  ± 0.02 0.33 0.08
    DMAPP 632  ± 131 0.82  ± 0.02 0.48 0.001
  Thrombin-treated His6-MiaA
    tRNAPhe(wt) 4.9  ± 0.6 0.54  ± 0.02 0.32 0.06
  Native MiaA
    tRNAPhe(wt) 2.85  ± 0.4 0.53  ± 0.03 0.31 0.11
24 °C
  His6-MiaA
    tRNAPhe(wt) 5.7  ± 3 0.51  ± 0.1 0.3 0.05
    ACSLPhe(wt) 45.4  ± 15 0.23  ± 0.01 0.14 0.003

a Calculation of kcatapp and kcatapp/Kmapp assumed that MiaA was fully active as a monomer for both tRNA and ACSLPhe substrates. The assumption of full activity was a first approximation based on the finding that MiaA was completely active for tRNAPhe and ACSLPhe binding (Fig. 5). If MiaA acts catalytically as a dimer for tRNA substrates and a monomer for ACSLPhe substrates as implied by binding studies (see "Discussion"), then kcatapp and kcatapp/Kmapp values will be doubled, except for the ACSLPhe(wt) substrate.

The Kmapp and kcatapp for tRNAPhe(wt) were the same within experimental error for His6-MiaA, thrombin-treated MiaA, and native MiaA (Table II, lines 1, 5, and 6). Thus, the presence of the His6-tag did not appreciably affect the association state (above) or the kinetic properties (Table II) of the MiaA prenyltransferase. Consequently, His6-MiaA was used in most subsequent experiments and will be referred to simply as MiaA hereafter. tRNAPhe(wt) and tRNAPhe(U60C) showed equivalent kinetic properties (Table II, lines 1 and 2), implying that both substrates were folded correctly enough to act as substrates for MiaA. Consistent with this interpretation, prolonged incubation of reaction mixtures containing excess MiaA resulted in complete i6A modification of tRNAPhe(wt) as judged by the molar amount of [3H]DMA incorporated (data not shown). MiaA had nearly the same Kmapp and kcatapp for tRNAPhe(wt) and bulk tRNA isolated from a miaA mutant (Table II, lines 1 and 3). To make this comparison, the concentration of MiaA substrates was taken as 12.9% of all tRNA species in the bulk tRNA isolated from a miaA mutant grown in LB medium at a rate of 2.5 doublings per h (7).

The ACSLPhe(wt) microhelix (Fig. 2B) was also a substrate for the MiaA enzymes (Table II, line 8). These reactions were carried out at 24 °C to prevent melting of the GC-rich ACSLPhe(wt) (predicted Tm approx 63 °C from the Oligo 4.0 program (National Biosciences)). Control experiments showed that prolonged incubation with excess MiaA led to complete i6A modification of ACSLPhe(wt) and that mutant ACSLPhe(A11G) was not modified by MiaA (data not shown). The kcatapp/Kmapp substrate specificity constant was about 17-fold lower for ACSLPhe(wt) than for tRNAPhe(wt) due primarily to an 8-fold reduction in Kmapp (lines 7 and 8).

Competitive Inhibition of MiaA Activity by Nucleotide Di- and Triphosphates and by tRNAPhe(A37G)

MiaA homologs have been sequenced from several organisms and share an ATP/GTP P-loop binding motif (50). Hence, we checked whether ATP, ADP, and other nucleotide di- and triphosphates (NDPs and NTPs) affected MiaA enzyme activity in vitro. We found that MiaA activity was strongly inhibited by ADP (Fig. 7A) and ATP (Fig. 7B). The inhibition was classically competitive with respect to the DMAPP substrate with Kiapp(ATP) = 0.07 µM and Kiapp(ADP) = 0.05 µM. We tested other NTPs, such as GTP and CTP, and found similar inhibition as with ATP (data not shown). Thrombin-treated MiaA lacking the His6-tag was inhibited by ATP or ADP to the same extent as His6-MiaA (data not shown). Last, we found that mutant tRNAPhe(A37G) acts as a strong competitive inhibitor of i6A-37 modification in tRNAPhe(wt) (Kiapp = 4.23 nM (Fig. 7C)). This finding is consistent with the results from gel filtration (Fig. 5E) and binding studies (below).


Fig. 7. Competitive inhibition of MiaA activity by ADP, ATP, and tRNAPhe(A37G). A and B, inhibition of MiaA for DMAPP by ADP and ATP, respectively, in the presence of excess (0.08 µM) tRNAPhe(wt). ADP (open symbols) or ATP (closed symbols) were added at the following concentrations: crosses, none; triangles, 30 nM; circles, 100 nM; diamonds, 1 µM; squares, 10 µM. Each point is an average of two separate determinations. C, inhibition of MiaA for tRNAPhe(wt) by tRNAPhe(A37G) in the presence of excess (4.0 µM) DMAPP. tRNAPhe(A37G) was added at the following concentrations: crosses, none; triangles, 10 nM; circles, 50 nM; diamonds, 200 nM.
[View Larger Version of this Image (20K GIF file)]

Stoichiometry of MiaA Binding to RNA Substrates

We further investigated the composition of complexes formed between MiaA and synthetic tRNAPhe or ACSLPhe molecules by performing band shift and filter binding assays (Figs. 8, 9, 10; see "Experimental Procedures"). For both kinds of assays, we performed protein excess titrations, in which the tRNAPhe(wt) concentration was held constant far below the estimated Kdapp, and the MiaA concentration was varied (Figs. 8A and 10). We also performed ligand excess titrations, in which the MiaA concentration was held constant near its estimated cellular concentration (approx 1.0 µM; see above), and the tRNAPhe and ACSLPhe concentrations were varied (Figs. 8B and 9).


Fig. 8. Representative protein excess and ligand excess titrations of His6-MiaA binding to 32P-labeled tRNAPhe(wt). Band shift assays were performed as described under "Experimental Procedures." A, protein excess titration containing 0.8 nM of 32P-labeled tRNAPhe(wt) and the indicated amounts of His6-MiaA. B, ligand excess titration containing 1.3 µM of His6-MiaA and the indicated amounts of 32P-labeled tRNAPhe(wt). The areas counted as tRNAPhe(wt)·MiaA protein complexes and free tRNAPhe(wt) are indicated.
[View Larger Version of this Image (56K GIF file)]


Fig. 9. Stoichiometry of MiaA binding to tRNAPhe and ACSLPhe molecules at saturation. A, ligand excess titrations of band shift assays containing 1.3 or 0.8 µM of His6-MiaA and the indicated amounts of tRNAPhe(wt) (closed circles) and tRNAPhe(A37G) (open circles) or ACSLPhe(wt) (closed triangles) and ACSLPhe(A11G) (open triangles), respectively. Averages from several independent experiments are shown with standard errors of the mean (S.E.). B, ligand excess titrations of filter binding assays containing 1.8 or 2.2 µM of His6-MiaA and the indicated amounts of tRNAPhe(wt) (closed circles) or ACSLPhe(A11G) (open triangles), respectively. Binding amounts were corrected using retention efficiencies (approx 85 or 40% for tRNAPhe(wt) or ACSLPhe(A11G), respectively) determined from protein excess titrations (Fig. 10; see "Experimental Procedures") (46-48). BSA was omitted from filter soaking and wash solutions. Averages of two or more experiments are shown with standard errors.
[View Larger Version of this Image (13K GIF file)]


Fig. 10. Protein excess titrations of filter binding assays containing 20 pM 32P-labeled tRNAPhe(wt) and the indicated amounts of His6-MiaA. Filter soaking and wash solutions either lacked (open diamonds) or contained 100 µg of BSA per ml (closed diamonds, see "Experimental Procedures"). Averages from several independent experiments are shown with standard errors.
[View Larger Version of this Image (18K GIF file)]

Unexpectedly, the molar ratio of tRNAPhe(wt) or tRNAPhe(A37G) bound per MiaA at saturation was 0.5 for both types of binding assays (Fig. 9, A and B). Given that the MiaA preparations were completely active for binding (Fig. 5), this result showed that a MiaA dimer, rather than a monomer, bound to each intact tRNA molecule at saturation. Consistent with this interpretation, the predicted molecular mass of a MiaA2·tRNAPhe(wt) complex (100 kDa) matched the 110-kDa molecular mass observed during gel filtration (Fig. 5C). The discrepancy between the predicted molecular mass of a MiaA2·tRNAPhe(A37G) complex (100 kDa) and the 63-kDa complex observed during gel filtration (Fig. 5E) may indicate dissociation of the MiaA2·tRNAPhe(A37G) complex upon dilution during gel filtration. In contrast to tRNAPhe(wt) binding, ACSLPhe(wt) or ACSLPhe(A11G) bound MiaA in a 1:1 molar ratio at saturation (Fig. 9, A and B), suggesting that MiaA bound ACSLPhe microhelices as a monomer. This result confirmed the conclusion that the MiaA enzyme preparations were completely active for binding. The predicted molecular mass of a MiaA·ACSLPhe complex (41 kDa) was near that of the 45-kDa complex observed during gel filtration (above).

Examination of the gels used for the band shift assays further confirmed a difference in the way tRNAPhe(wt) and tRNAPhe(A37G) bound to MiaA. In ligand excess titrations, the MiaA·tRNAPhe(wt) complex formed at lower tRNAPhe(wt) concentrations (Complex 1, Fig. 8B) had a lower mobility and was possibly larger than the complex formed at saturation, which contained a 2:1 molar ratio of MiaA to tRNAPhe(wt) (Complex 2; Fig. 8B and Fig. 9). In contrast, Complex 1 predominated at tRNAPhe(A37G) concentrations as high as 0.5 µM in ligand excess titrations, whereas Complex 2 appeared and predominated at tRNAPhe(A37G) concentration near saturation (data not shown).

Last, we used the concentration of MiaA at half-saturation in protein excess titrations of filter binding assays (Fig. 10) to estimate Kdapp approx 0.07 µM for MiaA binding to tRNAPhe(wt) (46, 47, 51). Because of MiaA's complicated binding behavior (above), this Kdapp(tRNAPhe(wt)) is probably not a simple dissociation constant but rather a function of several binding constants (e.g. see Ref. 51). Protein excess titrations of band shift assays (Fig. 8A) gave a Kdapp(tRNAPhe(wt)) approx 1.0 µM, which was about 10-fold greater than that obtained by filter binding. This higher Kdapp(tRNAPhe(wt)) may reflect dissociation of complexes during electrophoresis. Since MiaA bound ACSLPhe(A11G) by an apparently simple (R·P right-arrow R + P) mechanism, we estimated Kd(ACSLPhe(A11G)) = 1.1 µM from ligand excess titrations of filter binding assays (Fig. 9B) (46, 47). The filter binding method failed to detect binding between MiaA and the ACSLPhe(wt) microhelix, suggesting that ACSLPhe(wt) bound to MiaA with a lower affinity than 1.0 µM.


DISCUSSION

We report here steady-state kinetic and binding studies of the E. coli MiaA tRNA prenyltransferase modification enzyme. Only a limited number of tRNA and rRNA modification enzymes have been purified and studied to date, despite the fact that many different kinds and families of RNA modification enzymes are present in all cells (3, 4, 9). Biochemical studies of these RNA modification enzymes are aimed at understanding the mechanisms of RNA-protein recognition and catalysis and the functions and regulation of RNA modification in cells. The properties of the MiaA enzyme show similarities and noteworthy differences compared with other purified tRNA modification enzymes, including the E. coli TrmA m5U54-methyltransferase (51-53), the E. coli TrmD m1G-methyltransferase (54, 55), the E. coli HisT pseudouridine synthase I (56), and the E. coli and Zymomonas mobilis Tgt tRNA-guanine transglycosylases (57-60).

Similar to the TrmA and Tgt enzymes (51, 58), MiaA can modify a 17-mer synthetic microhelix stem-loop substrate, in this case corresponding to the ACSL of tRNAPhe(wt) (Table II). Thus, the minimal recognition elements for the MiaA tRNA prenyl transfer reside in this limited ACSL structure. However, the kcatapp/Kmapp substrate specificity is reduced significantly by about 17-fold for the ACSLPhe(wt) microhelix compared with intact tRNA molecules (Table II) (or 34-fold if MiaA is catalytically active as a dimer for tRNA and as a monomer for ACSLPhe(wt) (below; see Table II)). In this regard, MiaA resembles the Tgt transglycosylases, whose Vmaxapp/Kmapp is 5-10-fold lower for an ACSLTyr microhelix compared with an intact tRNATyr substrate (58). In contrast, the TrmA methyltransferase uses a T-loop microhelix as a substrate almost as well as intact tRNA molecules (reduction of kcatapp/Kmapp approx 2.5-fold; (51)). At the other extreme, the TrmD methyltransferase depends strongly on intact tRNA tertiary structures and does not efficiently modify an ACSL microhelix (reduction of Vmaxapp/Kmapp approx 300-fold (54)).

Recently, an attempt was made to classify tRNA modification enzymes into two families (61). The TrmA methyltransferase and other enzymes that modify the amino acid-accepting minihelix, which is composed of the acceptor and T-loop microhelices, generally do not depend on overall tRNA tertiary structure for their activities (61). In contrast, TrmD methyltransferase and other enzymes that modify the anticodon minihelix, which is composed of the anticodon and D-loop microhelices, have been found to strongly depend on intact tRNA three-dimensional structure (see Ref. 61). The exception to this classification scheme is bacterial Tgt transglycosylases, which modify ACSL microhelices moderately efficiently (see above) (58, 62) and interact strongly, but not exclusively, with the ACSL region of substrate tRNA molecules (57, 63). MiaA also presents an exception to the strictest application of this classification scheme. However, the significantly reduced substrate specificity of MiaA for the ACSLPhe(wt) microhelix compared with intact tRNAPhe(wt) (Table II) suggests that interactions of MiaA with regions other than the ACSLPhe are important for optimal activity. This conclusion is further supported by binding studies discussed below. Compilations of the tRNA molecules that contain ms2i6A37 or i6A37 modifications led to a consensus ACSL that includes possible secondary structure and sequence-specific elements required for MiaA recognition and modification (1, 8). Recent experiments by Y. Motorin and H. Grosjean3 using tRNASer isoaccepting species confirm that optimal MiaA activity may depend on primary, secondary, and tertiary interactions within tRNA substrates. The kinetic, binding, and footprinting properties of these and other mutant RNA substrates are currently being determined.

One noteworthy difference between MiaA and other purified tRNA modification enzymes is its extremely low Kmapp for native and synthetic tRNA substrates (approx 3 nM; Table II). By comparison, the Kmapp of the Tgt transglycosylases, TrmD methyltransferase, and TrmA methyltransferase for synthetic tRNA substrates is 2.0, 3.3, and 2.8 µM, respectively (51, 54, 58), which are about 3 orders of magnitude higher than that of MiaA (Table II). Likewise, the kcatapp or Vmaxapp of MiaA is about 10-fold greater for synthetic tRNA substrates than that of the TrmA and Tgt enzymes (51, 58). Together, these results show that MiaA is a comparatively active enzyme with a high apparent affinity for its tRNA substrates. Consistent with this interpretation, the kinetic properties of MiaA for a synthetic, purified tRNAPhe(wt) substrate were very similar to those for bulk tRNA isolated from a miaA mutant (Table II). Thus, the presence of nonsubstrate, native tRNA molecules in the bulk tRNA preparations did not appreciably inhibit or affect MiaA substrate recognition or activity. This behavior contrasts with the purified HisT pseudouridine synthase (56) and TrmD methyltransferase,4 which are strongly inhibited by nonsubstrate tRNA species. Moreover, the constancy of kinetic properties of MiaA for synthetic, unmodified tRNAPhe(wt) and hypomodified bulk tRNA from a miaA mutant implies that the other modifications present in tRNA molecules do not significantly affect MiaA activity. Transparency to other base modifications in tRNA was also documented for the Tgt transglycosylase (62).

We used quantitative Western immunoblotting to determine that there are about 660 MiaA monomers per cell in bacteria growing exponentially in enriched minimal salts/glucose medium (Fig. 4). Previously, the cellular amounts of tRNA modification enzymes have been measured only indirectly by comparisons of specific activities (e.g. see Ref. 64), and these studies have led to the generalization that tRNA modification enzymes are present in few copies per cell (9). To the contrary, our results show that MiaA is a relatively abundant cellular protein compared with other biosynthetic enzymes (see Ref. 41). From the kcatapp of MiaA for tRNA (Table II) and the number of MiaA monomers per cell, we calculate that the rate of i6A37 synthesis can approach 15,400 modifications per min per cell. The equation for the rate of MiaA substrate tRNA synthesis in exponentially growing cells is (65): d(tRNA)/dt = ((ln2)/(cell doubling time)) × (number of MiaA substrate tRNA molecules per cell) = (ln2/54 min) × (198,000 total tRNA molecules × 12.9% MiaA substrates (7)) = 328 MiaA substrate tRNA molecules synthesized per min per cell. Thus, there is about a 47-fold excess (15,400/328) of MiaA catalytic capacity in vivo. This calculation makes a number of necessary simplifying assumptions, including that MiaA substrates are not limiting in vivo, that MiaA activity is not subjected to additional regulation (below), and that the in vitro kinetic properties of MiaA can be extrapolated to the in vivo situation. We estimate that the in vivo steady-state concentration of MiaA is about 1.0 µM in these exponentially growing bacteria (see "Results"). By comparison, the steady-state in vivo concentration of MiaA tRNA substrates can be calculated at about 42 µM, Kmapp(tRNA) of MiaA approx 3 nM (Table II), and Kdapp(tRNA) of MiaA approx 0.07 µM in the absence of DMAPP (below). Finally, we found that the cellular amount of MiaA was regulated and decreased about 3-fold as bacterial cells entered stationary phase (Fig. 4), which leads to a drop in the rate of tRNA synthesis (66).

Early work indicated that MiaA activity was strongly inhibited by unknown compounds in some substrate preparations (37). Overexpression of E. coli tRNAPhe(wt) in E. coli caused the accumulation of hypomodified tRNA species lacking the ms2i6A37 or i6A37 modifications (21), implying that MiaA activity can be saturated in vivo. We found that MiaA activity was strongly inhibited by ADP, ATP, and other NTPs (see "Results"; Fig. 7, A and B). This inhibition was classically competitive with the DMAPP substrate (Fig. 7) with a Kiapp of about 0.06 µM (Fig. 7, A and B).

The comparatively large cellular amount of MiaA and its high activity and substrate affinities are likely needed to overcome inhibition by NTPs and NDPs in vivo. We can estimate this inhibition by first recalling that the number of MiaA substrate tRNA molecules synthesized per min is about 328 (see above) approx 0.54 µM (see "Results"). The Kmapp(tRNA) of MiaA approx 3 nM (Table II), so MiaA is saturated for its tRNA substrates. The inhibition of MiaA catalytic capacity can be calculated from the standard enzyme inhibition equation (v Vmaxapp [S]/([S] + Kmapp (1 + ([I]/Kiapp))) and will depend on the MiaA kinetic parameters for DMAPP (Table II) and the free, but not total, intracellular concentrations of NTPs, NDPs, and DMAPP. To our knowledge, these free concentrations are not known with certainty for E. coli. Nevertheless, one estimate of [NTP]free is 50 µM, based on the Kmapp(ATP) of many kinases (67), and the fact that ATP is by far the most abundant nucleotide compound in enterobacterial cells (68). Assuming that [NTP]free + [NDP]free actually approaches 100 µM, then [DMAPP]free would only have to be about 25 µM to allow MiaA to fully modify newly synthesized tRNA substrate molecules. [DMAPP]free approx 25 µM seems reasonable, because DMAPP and isopentenyl diphosphate (IPP) are precursors to ubiquinone, which is abundant in E. coli (Fig. 1) (69). Moreover, 25 µM is near the Kmapp of IPP·DMAPP isomerases of yeast and other organisms (70). Thus, the amount and kinetic properties of MiaA and its inhibition by NTPs and NDPs seem balanced to just allow full tRNA substrate modification.

The competitive inhibition of MiaA by ATP or ADP likely indicates an important structure-function relationship for this class of prenyltransferases. MiaA homologs from several organisms lack significant amino acid similarities with other enzymes that use IPP and DMAPP as substrates, such as the Asp-Asp-Xaa-Xaa-Asp motif (71). MiaA homologs also lack conserved Cys and His residues positioned in possible metal binding motifs (e.g. Ref. 59). On the other hand, they do share an ATP/GTP P-loop binding motif, which is also present in Agrobacterium Ti-plasmid-encoded adenine isopentenyl-diphosphate transferases (ipt; tzs) that synthesize the free-base plant hormone i6A (cytokinin) (19, 34). The conservation of the P-loop motif and the competitive inhibition of DMAPP by NDPs and NTPs suggests that these families of tRNA and adenine prenyltransferases may use the P-loop motif to bind DMAPP instead of motifs used by other prenyltransferases (71, 72). This hypothesis will be tested in future studies. To our knowledge, MiaA is the first example of an RNA modification enzyme whose activity is regulated by compounds other than its substrates or products.

In the absence of the DMAPP substrate, MiaA bound to wild-type and mutant synthetic tRNAPhe and ACSLPhe substrates in a surprisingly complicated way (Figs. 8, 9, 10). The Kdapp(tRNAPhe(wt)) of MiaA approx 0.07 µM (see "Results"; Fig. 10), which was about 11-fold lower than the Kd(ACSLPhe(A11G)) (see "Results"). The stoichiometry of binding MiaA to intact tRNAPhe(wt) and tRNAPhe(A37G) was 2:1 at saturation (Fig. 9), whereas it was 1:1 for MiaA binding to ACSLPhe(wt) or ACSLPhe(A11G) (Fig. 9). With the exception of the nonphysiological mutant tRNAPhe(A37G), these molar binding ratios were consistent with complex sizes detected by gel filtration chromatography (see "Results"; Fig. 5). As expected tRNAPhe(A37G) and ACLS(A11G) were not modified by MiaA, but tRNAPhe(A37G) strongly and competitively inhibited MiaA for tRNAPhe(wt) with a Kiapp = 4.2 nM (Fig. 7C). Unexpectedly the complexes formed between MiaA and tRNAPhe(wt) or tRNAPhe(A37G) at low tRNA to protein ratios were larger (Complex 1; Fig. 8B) than the MiaA2·tRNA dimers formed at saturation (Complex 2; Fig. 8B and Fig. 9).

The results from gel filtration (Fig. 5), kinetic (Figs. 6 and 7), and binding (Figs. 8, 9, 10) experiments can be accounted for by a model in which MiaA binds to ACSLPhe structures as a monomer but binds to intact tRNA molecules as a multimer, either a dimer with half-site occupancy or a tetramer that dissociates into half-site occupied dimers. If intact tRNA molecules bind to the MiaA multimer preferentially and only bind to the monomer at higher tRNA concentrations, then apparent substrate inhibition of MiaA by tRNAPhe(wt) would result (Fig. 6A). One attractive feature of this model is that only the correct tRNA substrates may bind tightly and possibly in a positively cooperative way to MiaA multimers. Consequently, the association state of MiaA may contribute to the process of distinguishing between substrate and nonsubstrate tRNA molecules. Additional studies are needed to test features of this model directly, determine the kinetic order of the modification reaction, and learn whether DMAPP affects the MiaA association state.


FOOTNOTES

*   This work was supported by Grant MCB-9420416 from National Science Foundation.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Dagger    To whom correspondence should be addressed: Dept. of Microbiology and Molecular Genetics, University of Texas Houston Medical School, 6431 Fannin, JFB 1.765, Houston, TX 77030-1501. Tel.: 713-500-5461; Fax: 713-500-5499; E-mail: mwinkler{at}utmmg.med.uth.tmc.edu.
1   The abbreviations used are: DMAPP, dimethylallyl diphosphate; MiaA, tRNA dimethylallyl (Delta 2-isopentenyl) transferase of E. coli; IPP, isopentenyl diphosphate; DTT, dithiothreitol; BSA, bovine serum albumin; TMD buffer, 30 mM Tris-HCl (pH 7.5 at 24 °C), 10 mM MgCl2, 1 mM DTT); TM buffer, TMD lacking DTT; PAGE, polyacrylamide gel electrophoresis; ACSL, anticodon stem-loop; ACSLPhe, anticodon stem-loop of E. coli tRNAPhe; (wt), wild-type; T(0.1)E buffer, 10 mM Tris-HCl (pH 8.0), 0.1 mM EDTA; NDPs, nucleotide diphosphates; NTPs, nucleotide triphosphates; bp, base pair(s); IPTG, isopropyl-1-thio-beta -D-galactopyranoside.
2   H.-C. E. Leung and M. E. Winkler, manuscript in preparation.
3   Y. Motorin and H. Grosjean, personal communication.
4   W. M. Holmes, personal communication.

Note Added in Proof

After submission of this paper, J. A. Moore and C. D. Poulter published an independent purification and characterization of the E. coli MiaA tRNA prenyltransferase (Moore, J. A., and Poulter, C. D. (1997) Biochemistry 36, 604-614). Their paper, which largely complements the work reported here, shows that the order of substrate binding is tRNA then DMAPP. Apparent differences in the two studies in certain parameters, such as the Kmapp (tRNAPhe) of MiaA, will be resolved by futher experiments.


REFERENCES

  1. Tsang, T. H., Buck, M., and Ames, B. (1983) Biochim. Biophys. Acta 741, 180-196 [Medline] [Order article via Infotrieve]
  2. Sprinzl, M., Hartmann, T., Weber, J., Blank, J., and Zeidler, R. (1989) Nucleic Acids Res. 17, 1-172 [Abstract/Free Full Text]
  3. Björk, G. R. (1996) in Escherichia coli and Salmonella. Cellular and Molecular Biology (Neidhardt, F. C., Curtis, R., Ingraham, J. L., Resnikoff, W. S., Riley, M., Schaechter, M., and Umbarger, H. E., eds), Vol. 1, pp. 861-886, ASM Press, Washington, D. C.
  4. Björk, G. R. (1995) Prog. Nucleic Acid Res. Mol. Biol. 50, 263-338 [Medline] [Order article via Infotrieve]
  5. Dock-Bregeon, A. C., Westhof, E., Giege, R., and Moras, D. (1989) J. Mol. Biol. 206, 707-722 [CrossRef][Medline] [Order article via Infotrieve]
  6. Esberg, B., and Björk, G. R. (1995) J. Bacteriol. 177, 1967-1975 [Abstract/Free Full Text]
  7. Dong, H., Nilsson, L., and Kurland, C. G. (1996) J. Mol. Biol. 260, 649-663 [CrossRef][Medline] [Order article via Infotrieve]
  8. Grosjean, H., Nicoghosian, K., Haumont, E., Söll, D., and Cedergren, R. (1985) Nucleic Acid Res. 13(15), 5697-5706
  9. Björk, G. R. (1995) in tRNA: Structure, Biosynthesis, and Function (Söll, D., and RajBhandary, U., eds), pp. 165-205, ASM Press, Washington, D. C.
  10. Ericson, J. U., and Björk, G. R. (1991) J. Mol. Biol. 218, 509-516 [CrossRef][Medline] [Order article via Infotrieve]
  11. Vacher, J., Grosjean, H., Houssier, C., and Buckingham, R. H. (1984) J. Mol. Biol. 177, 329-342 [CrossRef][Medline] [Order article via Infotrieve]
  12. Ericson, J. U., and Björk, G. R. (1986) J. Bacteriol. 166, 1013-1021 [Abstract/Free Full Text]
  13. Mikkola, R., and Kurland, C. G. (1988) FEMS Microbiol. Lett. 56, 265-270 [CrossRef]
  14. Petrullo, L. A., Gallagher, P. J., and Elseviers, D. (1983) Mol. Gen. Genet. 190, 289-294 [CrossRef][Medline] [Order article via Infotrieve]
  15. Diaz, I., and Ehrenberg, M. (1991) J. Mol. Biol. 222, 1161-1171 [CrossRef][Medline] [Order article via Infotrieve]
  16. Hagervall, T. G., Ericson, J. U., Esberg, K. B., Li, J., and Björk, G. R. (1990) Biochim. Biophys. Acta 1050, 263-266 [Medline] [Order article via Infotrieve]
  17. Bouadloun, F., Srichaiyo, T., Isaksson, L. A., and Björk, G. R. (1986) J. Bacteriol. 166, 1022-1027 [Abstract/Free Full Text]
  18. Björnsson, A., and Isaksson, L. A. (1993) J. Mol. Biol. 232, 1017-1029 [CrossRef][Medline] [Order article via Infotrieve]
  19. Connolly, D. M., and Winkler, M. E. (1991) J. Bacteriol. 173, 1711-1721 [Abstract/Free Full Text]
  20. Harrington, K. M., Nazarenko, I. A., Dix, D. B., Thompson, R. C., and Uhlenbeck, O. C. (1993) Biochemistry 32, 7617-7622 [CrossRef][Medline] [Order article via Infotrieve]
  21. Wilson, R. K., and Roe, B. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 409-413 [Abstract/Free Full Text]
  22. Tsui, H. C. T., Leung, H. C. E., and Winkler, M. E. (1994) Mol. Microbiol. 13, 35-49 [Medline] [Order article via Infotrieve]
  23. Connolly, D. M., and Winkler, M. E. (1989) J. Bacteriol. 171, 3233-3246 [Abstract/Free Full Text]
  24. Burdett, V. (1993) J. Bacteriol. 175, 7209-7215 [Abstract/Free Full Text]
  25. Tsui, H.-C. T., Feng, G., and Winkler, M. E. (1996) J. Bacteriol. 178, 5719-5731 [Abstract/Free Full Text]
  26. Buck, M., and Griffiths (1982) Nucleic Acids Res. 10, 1609-2624
  27. Gefter, M. L., and Russell, R. L. (1969) J. Mol. Biol. 39, 145-157 [CrossRef][Medline] [Order article via Infotrieve]
  28. Yanofsky, C., and Soll, L. (1977) J. Mol. Biol. 113, 663-677 [CrossRef][Medline] [Order article via Infotrieve]
  29. Eisenberg, S. P., Yarus, M., and Soll, L. (1979) J. Mol. Biol. 135, 111-126 [CrossRef][Medline] [Order article via Infotrieve]
  30. Gollnick, P., and Yanofsky, C. (1990) J. Bacteriol. 172, 3100-3107 [Abstract/Free Full Text]
  31. Landick, R., Yanofsky, C., Choo, K., and Phung, L. (1990) J. Mol. Biol. 216, 25-37 [CrossRef][Medline] [Order article via Infotrieve]
  32. Caillet, J., and Droogmans, L. (1988) J. Bacteriol. 170, 4147-4152 [Abstract/Free Full Text]
  33. Tsui, H.-C. T., and Winkler, M. E. (1994) Biochimie (Paris) 76, 1168-1177 [Medline] [Order article via Infotrieve]
  34. Gray, J., Wang, J., and Gelvin, S. B. (1992) J. Bacteriol. 174, 1086-1098 [Abstract/Free Full Text]
  35. Dihanich, M. E., Najarian, D., Clark, R., Gillman, E. C., Martin, N. C., and Hopper, A. K. (1987) Mol. Cell. Biol 7, 177-184 [Abstract/Free Full Text]
  36. Zoladek, T., Vaduva, G., Hunter, L. A., Boguta, M., Go, B. D., Martin, N. C., and Hopper, A. K. (1995) Mol. Cell. Biol. 15, 6884-6894 [Abstract]
  37. Rosenbaum, N., and Gefter, M. L. (1972) J. Biol. Chem. 247, 5675-5680 [Abstract/Free Full Text]
  38. Bartz, J. K., Kline, L. K., and Soll, D. (1970) Biochem. Biophys. Res. Commun. 40, 1481-1487 [Medline] [Order article via Infotrieve]
  39. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (eds) (1996) Current Protocols in Molecular Biology, John Wiley and Sons, New York
  40. Feng, G., and Winkler, M. E. (1995) Biotechniques 19, 956-965 [Medline] [Order article via Infotrieve]
  41. Zhao, G., and Winkler, M. E. (1995) J. Bacteriol. 177, 883-891 [Abstract/Free Full Text]
  42. Sampson, J. R., and Uhlenbeck, O. C. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 1033-1037 [Abstract/Free Full Text]
  43. Milligan, J. F., and Uhlenbeck, O. C. (1989) Methods Enzymol. 180, 51-62 [Medline] [Order article via Infotrieve]
  44. Tipton, K. F. (1992) in Enzyme Assays. A Practical Approach (Eisenthal, R., and Danson, M. J., eds), pp. 1-58, IRL Press, Oxford
  45. Feng, G., Tsui, H. C. T., and Winkler, M. E. (1996) J. Bacteriol. 178, 2388-2396 [Abstract/Free Full Text]
  46. Riggs, A. D., Suzuki, H., and Bourgeois, S. (1970) J. Mol. Biol. 48, 67-83 [CrossRef][Medline] [Order article via Infotrieve]
  47. Klig, L. S., Crawford, I. P., and Yanofsky, C. (1987) Nucleic Acids Res. 15, 5339-5351 [Abstract/Free Full Text]
  48. Witherell, G. W., and Uhlenbeck, O. C. (1989) Biochemistry 28, 71-76 [CrossRef][Medline] [Order article via Infotrieve]
  49. Peterson, E. T., and Uhlenbeck, O. C. (1992) Biochemistry 31, 10380-10389 [CrossRef][Medline] [Order article via Infotrieve]
  50. Saraste, M., Sibbald, P. R., and Wittinghofer, A. (1990) Trends Biochem. Sci. 15, 430-434 [CrossRef][Medline] [Order article via Infotrieve]
  51. Gu, D., Ivanetich, K. M., and Santi, D. V. (1996) Biochemistry 35, 11652-11659 [CrossRef][Medline] [Order article via Infotrieve]
  52. Gu, X., and Santi, D. V. (1991) Biochemistry 30, 2999-3002 [CrossRef][Medline] [Order article via Infotrieve]
  53. Kealey, J. T., and Santi, D. V. (1995) Biochemistry 34, 2441-2446 [CrossRef][Medline] [Order article via Infotrieve]
  54. Holmes, W. M., Andraos-Selim, C., Roberts, I., and Wahab, S. Z. (1992) J. Biol. Chem. 267, 13440-13445 [Abstract/Free Full Text]
  55. Holmes, W. M., Andraos-Selim, C., and Redlak, M. (1995) Biochimie (Paris) 77, 62-65 [Medline] [Order article via Infotrieve]
  56. Kammen, H. O., Marvel, C. C., Hardy, L., and Penhoet, E. E. (1988) J. Biol. Chem. 263, 2255-2263 [Abstract/Free Full Text]
  57. Romier, C., Reuter, K., Suck, D., and Ficner, R. (1996) EMBO J. 15, 2850-2857 [Medline] [Order article via Infotrieve]
  58. Curnow, A. W., and Garcia, G. A. (1995) J. Biol. Chem. 270, 17264-17267 [Abstract/Free Full Text]
  59. Chong, S., Curnow, A. W., Huston, T. J., and Garcia, G. A. (1995) Biochemistry 34, 3697-3701
  60. Garcia, G. A., Koch, K. A., and Chong, S. (1993) J. Mol. Biol. 231, 489-497 [CrossRef][Medline] [Order article via Infotrieve]
  61. Grosjean, H., Edqvist, J., Straby, K. B., and Giege, R. (1996) J. Mol. Biol. 255, 67-85 [CrossRef][Medline] [Order article via Infotrieve]
  62. Curnow, A. W., Kung, F., Koch, K. A., and Garcia, G. A. (1993) Biochemistry 32, 5239-5346 [CrossRef][Medline] [Order article via Infotrieve]
  63. Mueller, S. O., and Slany, R. K. (1995) FEBS Lett. 361, 259-264 [CrossRef][Medline] [Order article via Infotrieve]
  64. Hjalmarsson, K. J., Byström, A. S., and Björk, G. R. (1983) J. Biol. Chem. 258, 1343-1351 [Abstract/Free Full Text]
  65. Bremer, H., and Dennis, P. P. (1987) in Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology (Neidhardt, F. C., Ingraham, J. L., Low, K. B., Magasanik, B., Schaechter, M., and Umbarger, H. E., eds), pp. 1527-1542, ASM Press, Washington, D. C.
  66. Huisman, G. W., Siegle, D. A., Zambrano, M. M., and Kolter, R. (1996) in Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology (Neidhardt, F. C., Curtis, R., Ingraham, J. L., Lin, E. C. C., Low, K. B., Magasanik, B., Reznikoff, W. S., Riley, M., Schaechter, M., and Umbarger, H. E., eds), 2nd Ed., pp. 1672-1682, ASM press, Washington, D. C.
  67. Neidhardt, F. C., Curtis, R., Ingraham, J. L., Resnikoff, W. S., Riley, M., Schaechter, M., and Umbarger, H. E. (eds) (1996) Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology, 2nd Ed., ASM Press, Washington, D. C.
  68. Bochner, B. R., and Ames, B. N. (1982) J. Biol. Chem. 257, 9759-9769 [Abstract/Free Full Text]
  69. White, R. H. (1996) in Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology (Neidhardt, F. C., Curtis, R., Ingraham, J. L., Lin, E. C. C., Low, K. B., Magasanik, B., Reznikoff, W. S., Riley, M., Schaechter, M., and Umbarger, H. E., eds), 2nd Ed., pp. 637-641, ASM Press, Washington, D. C.
  70. Street, I. P., and Poulter, C. D. (1990) Biochemistry 29, 7531-7538 [CrossRef][Medline] [Order article via Infotrieve]
  71. Song, L., and Poulter, C. D. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 3044-3048 [Abstract/Free Full Text]
  72. Tarshis, L. C., Yan, M., Poulter, C. D., and Sacchettini, J. C. (1994) Biochemistry 33, 10871-10877 [CrossRef][Medline] [Order article via Infotrieve]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
RNAHome page
T. Lee and A. L. Feig
The RNA binding protein Hfq interacts specifically with tRNAs
RNA, March 1, 2008; 14(3): 514 - 523.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Sakakibara, H. Kasahara, N. Ueda, M. Kojima, K. Takei, S. Hishiyama, T. Asami, K. Okada, Y. Kamiya, T. Yamaya, et al.
Agrobacterium tumefaciens increases cytokinin production in plastids by modifying the biosynthetic pathway in the host plant
PNAS, July 12, 2005; 102(28): 9972 - 9977.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Pierrel, T. Douki, M. Fontecave, and M. Atta
MiaB Protein Is a Bifunctional Radical-S-Adenosylmethionine Enzyme Involved in Thiolation and Methylation of tRNA
J. Biol. Chem., November 12, 2004; 279(46): 47555 - 47563.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
R. Leipuviene, Q. Qian, and G. R. Bjork
Formation of Thiolated Nucleosides Present in tRNA from Salmonella enterica serovar Typhimurium Occurs in Two Principally Distinct Pathways
J. Bacteriol., February 1, 2004; 186(3): 758 - 766.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Pierrel, H. L. Hernandez, M. K. Johnson, M. Fontecave, and M. Atta
MiaB Protein from Thermotoga maritima: CHARACTERIZATION OF AN EXTREMELY THERMOPHILIC tRNA-METHYLTHIOTRANSFERASE
J. Biol. Chem., August 8, 2003; 278(32): 29515 - 29524.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Yim, M. Martinez-Vicente, M. Villarroya, C. Aguado, E. Knecht, and M.-E. Armengod
The GTPase Activity and C-terminal Cysteine of the Escherichia coli MnmE Protein Are Essential for Its tRNA Modifying Function
J. Biol. Chem., August 1, 2003; 278(31): 28378 - 28387.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
I. G. Boneca, H. d. Reuse, J.-C. Epinat, M. Pupin, A. Labigne, and I. Moszer
A revised annotation and comparative analysis of Helicobacter pylori genomes
Nucleic Acids Res., March 15, 2003; 31(6): 1704 - 1714.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Pierrel, G. R. Bjork, M. Fontecave, and M. Atta
Enzymatic Modification of tRNAs. MiaB IS AN IRON-SULFUR PROTEIN
J. Biol. Chem., April 12, 2002; 277(16): 13367 - 13370.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
V. Anantharaman, E. V. Koonin, and L. Aravind
Comparative genomics and evolution of proteins involved in RNA metabolism
Nucleic Acids Res., April 1, 2002; 30(7): 1427 - 1464.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. Lemieux, B. Lakowski, A. Webb, Y. Meng, A. Ubach, F. Bussiere, T. Barnes, and S. Hekimi
Regulation of Physiological Rates in Caenorhabditis elegans by a tRNA-Modifying Enzyme in the Mitochondria
Genetics, September 1, 2001; 159(1): 147 - 157.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
I. Olekhnovich and G. N. Gussin
Effects of Mutations in the Pseudomonas putida miaA Gene: Regulation of the trpE and trpGDC Operons in P. putida by Attenuation
J. Bacteriol., May 15, 2001; 183(10): 3256 - 3260.
[Abstract] [Full Text]


Home page
J. Bacteriol.Home page
J. Zhao, H.-C. E. Leung, and M. E. Winkler
The miaA Mutator Phenotype of Escherichia coli K-12 Requires Recombination Functions
J. Bacteriol., March 1, 2001; 183(5): 1796 - 1800.
[Abstract] [Full Text]


Home page
J. Bacteriol.Home page
B. Esberg, H.-C. E. Leung, H.-C. T. Tsui, G. R. Björk, and M. E. Winkler
Identification of the miaB Gene, Involved in Methylthiolation of Isopentenylated A37 Derivatives in the tRNA of Salmonella typhimurium and Escherichia coli
J. Bacteriol., December 1, 1999; 181(23): 7256 - 7265.
[Abstract] [Full Text]


Home page
J. Bacteriol.Home page
B. C. Persson, O. Ólafsson, H. K. Lundgren, L. Hederstedt, and G. R. Björk

J. Bacteriol., June 15, 1998; 180(12): 3144 - 3151.
[Abstract]


Home page
J. Biol. Chem.Home page
K. Takei, H. Sakakibara, and T. Sugiyama
Identification of Genes Encoding Adenylate Isopentenyltransferase, a Cytokinin Biosynthesis Enzyme, in Arabidopsis thaliana
J. Biol. Chem., July 6, 2001; 276(28): 26405 - 26410.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leung, H.-C. E.
Right arrow Articles by Winkler, M. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Leung, H.-C. E.
Right arrow Articles by Winkler, M. E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement