![]()
|
|
||||||||
(Received for publication, October 28, 1996, and in revised form, March 10, 1997)
From the Institut für Biotechnologie 1 der Forschungszentrum
Jülich GmbH, D-52425 Jülich, Germany
Glucose-fructose oxidoreductase (GFOR, EC
1.1.1.99.-) from the Gram-negative bacterium Zymomonas
mobilis contains the tightly bound cofactor NADP. Based on the
revision of the gfo DNA sequence, the derived GFOR sequence
was aligned with enzymes catalyzing reactions with similar substrates.
A novel consensus motif (AGKHVXCEKP) for a class of
dehydrogenases was detected. From secondary structure analysis the
serine-116 residue of GFOR was predicted as part of a Rossmann-type
dinucleotide binding fold. An engineered mutant protein (S116D) was
purified and shown to have lost tight cofactor binding based on
(a) altered tryptophan fluorescence; (b) lack of NADP liberation through perchloric acid treatment of the protein; and (c) lack of GFOR enzyme activity. The S116D mutant
showed glucose dehydrogenase activity (3.6 ± 0.1 units/mg of
protein) with both NADP and NAD as coenzymes (Km
for NADP, 153 ± 9 µM; for NAD, 375 ± 32 µM). The single site mutation therefore altered GFOR,
which in the wild-type situation contains NADP as nondissociable redox
cofactor reacting in a ping-pong type mechanism, to a dehydrogenase
with dissociable NAD(P) as cosubstrate and a sequential reaction type.
After prolonged preincubation of the S116D mutant protein with excess
NADP (but not NAD), GFOR activity could be restored to 70 units/mg,
one-third of wild-type activity, whereas glucose dehydrogenase activity
decreased sharply. A second site mutant (S116D/K121A/K123Q/I124K)
showed no GFOR activity even after preincubation with NADP, but it
retained glucose dehydrogenase activity (4.2 ± 0.2 units/mg of
protein).
Glucose-fructose oxidoreductase
(GFOR1; EC 1.1.1.99.-) is a homotetrameric
enzyme from the Gram-negative bacterium Zymomonas mobilis
which catalyzes the oxidation of glucose to gluconolactone and the
reduction of fructose to sorbitol (Fig. 1) in a
ping-pong type mechanism (1, 2). Sorbitol is used as a compatible solute by Z. mobilis to counteract the detrimental osmotic
effects of high concentrations of sugars in the medium (3). The
apparent physiological role of GFOR is the production of sorbitol from the two sugar moieties of sucrose, a natural carbon source of the
bacterium which dwells in sugar-rich habitats (4). The enzyme is
synthesized as a precursor (pre-GFOR) with an NH2-terminal signal peptide of 52 amino acid residues (5) and is exported to the
periplasm, at least partially, via the Sec pathway (6). The mature
enzyme is located in the periplasm (7, 8). Stoichiometrically, one
molecule of the cofactor NADP is bound per monomer (1). Pre-GFOR was
shown to be enzymatically fully active and to bind NADP tightly (9). A
deletion of 15 mainly hydrophobic amino acid residues (
A special feature of GFOR is the tight binding of the cofactor NADP(H).
Treatment with perchloric acid removed the cofactor from the apoprotein
(1), suggesting that NADP(H) is bound in a noncovalent manner. During
protein purification, the cofactor is not removed from the enzyme (1,
6). The published DNA sequence and the amino acid sequence derived
thereof reveal that GFOR has little similarity to other enzymes (5).
This, together with the mode of tight cofactor binding, suggests a
novel dinucleotide binding mode. Although diffracting crystals have
been obtained from purified GFOR (10), the three-dimensional structure
of the enzyme had not been available while the present investigations were performed.
Using site-directed mutagenesis we wanted to analyze the tight binding
of cofactor to GFOR. Based on alignments and secondary structure
predictions, we mutated amino acid residues that are likely to be
involved in cofactor binding. As a striking result, a mutant GFOR with
a single amino acid substitution (S116D) behaved as glucose
dehydrogenase with dual coenzyme specificity for NADP and NAD.
Z.
mobilis strain ACM3963 (11) and its recombinant derivatives were
maintained and cultivated anaerobically as described previously (6).
For protein purifications, cells were grown in complex medium with 10%
glucose with isopropyl-1-thio- All manipulations of DNA, cloning,
and transformation were done according to standard procedures (12, 13).
DNA sequencing was performed by the chain termination method using
dideoxynucleotides (14) in conjunction with T7 DNA polymerase (15)
using the nonradioactive A.L.F. fluorescence detection method according to the manufacturer's protocols (Pharmacia LKB, Freiburg,
Germany).
Site-directed mutagenesis was
carried out on a derivative of M13mp18 (16) containing an internal 0.3 kb PstI/SphI fragment of the gfo gene
according to a standard procedure (17) with oligonucleotides
I, 5 Wild-type and mutant proteins
(GFOR
NH2-terminal peptide
sequencing was performed by limited Edman degradation in conjunction
with an Applied Biosystems Inc. 371 sequencer. Determination of the
COOH-terminal amino acid was done with carboxypeptidase Y (Boehringer
Mannheim) according to the manufacturer's protocol followed by
reversed phase HPLC as described elsewhere (20).
Tightly bound NADP(H) was
released from GFOR by acid denaturation and was subsequently detected
by HPLC analysis. The enzymes were equilibrated to sodium phosphate
buffer (200 mM, pH 5.0) by ultrafiltration and diluted to a
final concentration of approximately 4 mg protein/ml. 60 µl of
ice-cold perchloric acid (35%) was added to 60 µl of the enzyme
solution, mixed, and kept on ice for 15 min. The samples were
neutralized by the stepwise addition of 180 µl of KHCO3
(2 M), and insoluble material was spun down by centrifugation. An aliquot of the supernatant was submitted to HPLC on
an octadecyl-silica gel column (Hypersil ODS, 5 µm, CS Chromatography
Service, Langerwehe, Germany) that was eluted with a gradient of sodium
phosphate (200 mM, pH 5.0), acetonitrile at a flow rate of
0.3 ml/min at 40 °C. Retention times of NADP(H) and NAD(H) were
determined with standard solutions.
Enzyme activities were determined at
30 °C in a thermostatted cuvette holder of a Shimadzu UV160
spectrophotometer by the measurement of acidification (formation of
gluconic acid from glucose) according to a published method (1).
Gluconolactonase from Rhodotorula rubra was added in excess
to the reaction mixture (7). Glucose dehydrogenase activity was
measured by the increase of reduced NAD(P) at 340 nm. Reaction mixtures
contained 5 µg/ml purified protein (GFOR or mutant protein), 5 units/ml gluconolactonase, glucose (400 mM in 40 mM K-MES buffer, pH 6.4), and 1 mM NAD(P). To
determine Km for NAD(P), concentrations of coenzymes were varied from 2 to 1,000 µM. Km,
kcat, and standard deviations thereof were
calculated by the Enzfitter Program (Elsevier Biosoft, version 1.05).
Protein was determined by a dye binding method (21).
Fluorescence spectroscopy was
performed with an Aminco-Bowman Series 2 Spectrometer at 20 °C.
Prior to use, the enzyme solutions were equilibrated by ultrafiltration
to sodium phosphate buffer (50 mM, pH 6.4). Excitation and
emission slits were set to 4 nm. To minimize photodecomposition of the
enzymes, the shutter of the exciting beam was kept closed until the
measurement started. Fluorescence titrations were performed by the
stepwise addition of 2.5-5 µl of NADPH to 2 ml of an enzyme solution
with a concentration of 0.6 µM (tetramer). Dilution by
the addition of NADPH was kept to a maximum of 2.5%. Controls were
obtained following the same procedure without added enzyme. To minimize
inner filter effects of nucleotide fluorescence, the excitation
wavelength was set to 360 nm (22). Titration curves were fitted to a
quadratic equation relating the fluorescence change to the coenzyme
concentration for a second order binding process (23).
Volume 272, Number 20,
Issue of May 16, 1997
pp. 13126-13133
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
Asp)
Alters NADP-containing Glucose-Fructose Oxidoreductase of
Zymomonas mobilis into a Glucose Dehydrogenase with Dual
Coenzyme Specificity*

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
Addendum
REFERENCES
32-46) in
the signal peptide led to a cytosolic form of GFOR which could be
purified and showed characteristics similar to the wild-type enzyme (6)
in terms of reactivity and the mode of cofactor binding.
Fig. 1.
Scheme of the ping-pong type reaction
catalyzed by glucose-fructose oxidoreductase. NADP(H) as a redox
carrier remains tightly bound to the enzyme. Gluconolactone is
subsequently hydrolyzed to gluconic acid either spontaneously or by a
specific lactonase.
[View Larger Version of this Image (10K GIF file)]
Bacterial Strains, Plasmids, and Media
-D-galactopyranoside (1 mM) to induce gfo expression from derivatives of
plasmid pZY507 (CmR; Escherichia
coli/Z.mobilis shuttle vector with
lacIq/Ptac control; 6). E. coli cells were grown in LB medium with appropriate antibiotics
(12). Construction of plasmids pZY470, pZY470
32-46, and pZY570 is
described elsewhere (6).
-GCTTTTTCAGCGTTACCATCGACCAAAGCTTCGAT-3
(S116D); II,
5
-GACGCCATATTCAGCGGCAACTTTCTGAGCAGCTTCAGCGTTACCATCGACG-3
(S116D/K121A/K123Q/I124K); and III,
5
-TAAAATCTGGTTAAGACCATATTTACCCAGACC-3
(A95G); altered
base triplets are underlined. In a second round of mutagenesis, an M13
clone with the exchange A95G was used as template together with
oligonucleotides I and II to combine these
mutations. Base exchanges were checked by DNA sequencing. After
verification, the respective fragments were cloned into plasmid
pZY470
32-46, sequenced again, introduced into the shuttle vector
pZY507, and conjugated to Z. mobilis ACM3963 as described
elsewhere (6). To avoid any problems with the export of recombinant
GFOR proteins to the periplasm or related problems as stability
and cofactor incorporation (6), respective mutations were introduced
into a gfo allele that encodes a cytoplasmic form
(GFOR
32-46). This form had been shown earlier to bind NADP in the
same tight manner as wild-type GFOR and was enzymatically fully active
(6). Deletion mutagenesis was performed using a megaprimer method with
two steps of polymerase chain reaction (18). In the first round of
polymerase chain reaction, plasmid pZY470 DNA (6) served as a template
with the loop-out primer IV 5
-
ACGATCTTCCGGCATCGGGCGGATCAT
AATCCTTGTTTCTTTCTTAAC-3
(
2-74) and the M13/pUC universe sequencing primer;
denotes the site of deletion. The resulting 222-base
pair megaprimer was incubated with the M13/pUC universal and reverse
sequencing primers (Boehringer Mannheim, Germany) together with a
1.5-kb PvuII fragment of pZY470 as template in the second
polymerase chain reaction step. The 1.5-kb product was restricted with
EcoRI plus HindIII, and the 0.3-kb fragment was
ligated to plasmid pZY470 restricted with
EcoRI/HindIII. Clones were checked for the
desired deletion by restriction analysis and DNA sequencing. The
resulting plasmid (pZY470
2-74) was restricted with
EcoRI/HindIII, and the 0.3-kb fragment was cloned
into pZY470/S116D or pZY470/S116D/K121A/K123Q/I124K to combine
2-74
with these amino acid substitutions. All gfo alleles were
conjugated to Z. mobilis ACM3963 on plasmids derived from
pZY507 as described elsewhere (6).
32-46, GFOR
2-74, or derivatives) were purified from
derivatives of the GFOR-defective Z. mobilis strain ACM3963
(11) after growth in complex medium supplemented with
isopropyl-1-thio-
-D-galactopyranoside (1 mM). GFOR was purified using a coupled anion-cation
exchange chromatography as described elsewhere (6). A second cation
exchange step was omitted, as apparent purity was already achieved in
the first step (Fig. 2). As degradation was observed
with some mutant proteins, NADP (0.5 mM) was added to all
buffers during purification steps. Because of the lack of detectable
GFOR activity in most of the mutant proteins, GFOR-containing fractions
were identified by SDS-polyacrylamide gel electrophoresis and
subsequent Western blot analysis (19). Fractions were pooled,
equilibrated to 40 mM K-MES, 1 mM
dithiothreitol, pH 6.4, by ultrafiltration, mixed with the same volume
of glycerol (88%), and stored at
20 °C until further use.
Fig. 2.
SDS-polyacrylamide gel electrophoresis with
various purified GFOR mutant proteins. Lanes 1 and
10, molecular weight markers "combithek" (Boehringer
Mannheim), lane 2, GFOR
32-46; lanes 3-7,
mutant proteins A-E; lanes 8 and 14, purified
GFOR (wild-type); lane 9, fraction from purification of
mutant protein D, containing exclusively a degradation product
described in the text; lane 11, GFOR
2-74, lane
12, mutant F; lane 13, mutant G. Note the faint
degradation protein bands in lanes 6 and 7.
[View Larger Version of this Image (37K GIF file)]
where [E]0 and [S]0
represent the initial enzyme and NADPH concentrations, respectively;
F
(Eq. 1)
is the fluorescence intensity at saturating
NADPH concentration; FL is the fluorescence
intensity at a given NADPH concentration without enzyme; and
F is the fluorescence intensity at a given NADPH
concentration with enzyme.
During former rounds of subcloning and site-directed mutagenesis (6) we had already encountered several deviations from the published DNA sequence of the gfo gene (5). This prompted us to sequence the complete gfo gene again. In a comparison with the former sequence (5), several frameshifts were observed which resulted in a deviating amino acid sequence of GFOR comprising only 433 residues (instead of 439). According to our DNA sequencing, the COOH-terminal residue should be a tyrosine. We subjected purified GFOR to a carboxypeptidase Y treatment and found that, indeed, tyrosine appeared as the first residue (data not shown).
Using the corrected gfo sequence and the derived amino acid
sequence, we performed similarity searches with the HUSAR package provided by the European Molecular Biology Laboratory (EMBL,
Heidelberg) in all accessible data bases using the BLAST data base
search program. Several amino acid sequences, in some cases open
reading frames with putative enzyme functions, were found which showed significant similarities to the NH2-terminal half of GFOR
(Fig. 3); similar findings, using the uncorrected GFOR
sequence, have been reported by others (24). All of these proteins are
NAD(P)-dependent dehydrogenases displaying a possible
fingerprint motif of a classical Rossmann fold (25) at their immediate
NH2 termini. In the GFOR sequence, a possible fingerprint
motif could also be recognized, although it was preceded by the signal
sequence of 52 amino acid residues and a proline-rich sequence of
approximately 30 amino acid residues (Fig. 3). GFOR displays the
characteristic fingerprint of a NADP binding Rossmann fold,
i.e. the sequence Gly-X-Gly-X-X-Ala with alanine at position 95 and the absence of a negatively charged amino acid residue (Asp or Glu), which is typically found as the last
conserved residue of the fingerprint sequence in NAD-binding 

folds (25, 26). From the sequence alignment in Fig. 3, a highly
conserved motif with the consensus AGKHVXCEKP became apparent; this box is found around amino acid residues 170-185 of
GFOR. A data base search for this motif returned exclusively the
sequences listed in Fig. 3. All of the listed enzymes, with the
exception of biliverdin reductase, are known, or can be expected, to
react with substrates that are structurally similar to glucose. Therefore this motif may constitute a putative fingerprint for a novel
class of sugar dehydrogenases.
, basic or hydrophilic;
, small and
hydrophobic;
, glycine; -, acid. The secondary structure elements
of GFOR resulting from the PHD prediction (27) are shown as
gray (
-sheet) or open (
-helix)
boxes at the top of the sequences. The first
-helical region of GFOR (dotted box) results from a
separate secondary structure prediction on GFOR and was not yielded
with the prediction of all aligned enzymes. The processing site of the
GFOR presecretory protein between amino acid residues 52 and 53 is
marked by an arrow. MocA and ORF334, putative rhizopine dehydrogenases of Rhizobium meliloti
(24); DDP-DH, phtalic acid dehydrogenase from
Pseudomonas putida (45); GalDH, galactose
dehydrogenase from Pseudomonas fluorescens (46); StrI, putative protein in streptomycin biosynthesis from
Streptomyces griseus (47); BvRed, biliverdin
reductase from rat kidney (48); IDH, inositol dehydrogenase
from B. subtilis (36); LmbZ, putative gene
product of lmbZ of lincomycin biosynthesis from
Streptomyces lincolnensis (49).
A secondary structure prediction of GFOR was performed using the PHD
program (27), based on the multiple alignment shown in Fig. 3. The
amino-terminal half of GFOR, according to this prediction, consists of
six
-folds interspaced by
-helical elements, resembling the
structure of Rossmann-type NAD(P) binding sites (28). Taken together
with the possible fingerprint motif for NAD(P) binding sites, it could
be predicted that GFOR binds its cofactor NADP in a domain comprising
the NH2-terminal half (approximately amino acid residues
80-250) in a 

dinucleotide binding fold, resembling the
Rossmann fold of dehydrogenases.
Only a few amino
acid residues are highly conserved in Rossmann folds. These are 10-11
amino acid residues, termed the fingerprint sequence of 

dinucleotide binding folds, in the region of the first and second
-sheet (
a and
b) and the interspacing pyrophosphate binding
-helix (
b). From sequence and structural data and from mutational
analyses, it has been established that the fingerprint regions of
binding sites for NAD or NADP differ to some extent and that these
differences play a key role in determining the coenzyme specificity
(29-31). To analyze the mode of NADP binding in GFOR and to assess the
involvement of a possible Rossmann fold, we intended to weaken the
interaction of GFOR with its cofactor NADP by engineering an NAD
binding motif using site-directed mutagenesis.
The conserved Ala residue in NADP binding sites is known to induce a
hydrogen bond pattern that differs from that of NAD binding sites,
where Gly occupies this position (30, 32). To assay this for GFOR,
we changed Ala-95 of GFOR to Gly (A95G; mutant A, Fig.
4). Negatively charged amino acid residues (Glu or Asp) are invariably found at the end of the second
-sheet of NAD binding sites. The oxygen atoms of the side chain carboxyl group form hydrogen
bonds to the 2
- and 3
-OH groups of the adenine ribose moiety of NAD.
In contrast, NADP binding sites usually contain an uncharged amino acid
residue at this position, which is followed immediately by a positively
charged residue in many cases (29, 33). Our secondary structure
predictions suggested that Ser-116 at the end of the putative
B in
GFOR might be replaced by Asp (S116D; mutant B) to lower the affinity
for NADP and to combine mutations A and B (A95G/S116D; mutant C; Fig.
4), to complete disruption via the H bonding pattern.
32-46, mutant proteins A-E, GFOR
2-74, and mutant proteins
F and G. For the mutants, only deviating residues are shown.
Secondary structure predictions and symbols for the Rossmann
fingerprint are as in Fig. 3. Numbering of amino acid residues (above
the first sequence) refers to the wild-type sequence; only residues
71-130 are presented. For comparison, the sequence of the putative
Rossmann fold in inositol dehydrogenase (IDH) is given in
the bottom line.
Site-directed mutageneses were performed as described under "Materials and Methods." The resulting mutant alleles were introduced and expressed in the GFOR-defective strain Z. mobilis ACM3963 (6, 11). These and additional mutant proteins (see below) are listed in Fig. 4. Mutant proteins were purified to apparent homogeneity as judged by SDS-polyacrylamide gel electrophoresis (Fig. 2).
Mutant Enzymes A, B, and C Behave Differently as Judged by GFOR Activity and Fluorescence SpectroscopyOnly mutant A (A95G)
showed GFOR activity comparable to the GFOR
32-46 wild-type enzyme
(Table I). No GFOR activity could be detected by the
standard photometric GFOR enzyme assay (without addition of NADP) with
mutants B (S116D) and C (A95G/S116D). The loss of GFOR activity could
be due to the loss of the cofactor NADP(H). Proteins, therefore, were
analyzed by fluorescence spectroscopy. Fluorescence at 450 nm is a
sensitive proof of the presence of reduced NAD(P) (34). In addition,
shifts in tryptophan fluorescence at 330 nm may reveal conformational
differences between wild-type and mutant GFOR (35). GFOR
32-46, as
the control with tightly bound NADP, was preincubated with glucose to
reduce bound NADP. When fluoresence was excited at 295 nm, only weak
tryptophan fluorescence was observed, with a distinct peak of NADPH
fluorescence at 450 nm. Fluorescence spectra with the mutant enzyme B
(GFOR-deficient) at the same conditions showed clearly enhanced
tryptophan fluorescence compared with the wild-type enzyme, with the
same emission maximum at 330 nm (Fig. 5). However, no
NADPH fluorescence at 450 nm could be measured. Mutant A showed the
same fluorescence emission spectra as the wild-type GFOR
32-46, and
mutant C behaved similarly to mutant B (data not shown).
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||
32-46 (solid lines) and mutant B (dotted
lines) after preincubation with 400 mM glucose. Excitation was at 295 nm and emission was monitored in a range from 305 to 550 nm. The final concentration of the enzymes was 0.6 µM. 1, GFOR
32-46; 2,
GFOR
32-46 denaturated by treatment with 6 M guanidinium
hydrochloride; 3, mutant protein B; 4, mutant B
denaturated by treatment with 6 M guanidinium
hydrochloride. Fluorescence emission spectra of mutant A was the same
as with GFOR
32-46. Mutants C, D, E, GFOR
2-74, and mutants F and
G showed the same fluorescence emission spectra as mutant B (data not
shown).
To examine whether the differences in intensity of tryptophan fluorescence between wild-type GFOR and mutant B reflected differences in the native conformation, the respective enzymes were denaturated with 6 M guanidinium hydrochloride. In the denatured state, wild-type GFOR and mutant B showed the same intensity of tryptophan fluorescence and the NADPH fluorescence at 450 nm of wild-type GFOR vanished (Fig. 5). These results indicate that mutant B did not contain the tightly bound cofactor NADP(H). Moreover, in wild-type GFOR a quenching of tryptophan fluorescence energy occurred, most likely by a direct transfer of fluorescence energy from tryptophan residues to the 1,4-dihydronicotineamide ring of NADPH which does not absorb light at a wavelength of 295 nm.
To release any bound cofactor (oxidized or reduced forms of NADP or
NAD), protein from wild-type GFOR
32-46, mutant A, and mutant B was
denatured by perchloric acid, and the supernatants were analyzed for
NAD(P) by HPLC. NADP was detected with GFOR
32-46 and from mutant
protein A. No NADP appeared from mutant B. NAD was not detected from
any protein (data not shown). We deduce that a single amino acid
residue exchange (S116D) is sufficient to destroy tight cofactor
binding to GFOR.
The enzymatic assay for GFOR activity is usually performed without NADP in the reaction mixture (1), and the formation of gluconic acid is followed by the acidification of the reaction mixture using p-nitrophenol as the pH indicator. As mutants B and C (data not shown) obviously did not contain a tightly bound cofactor, we assayed the GFOR mutant proteins for glucose dehydrogenase activity. In the reaction mixtures, which contained excess NADP, formation of NADPH was followed by the increase in absorbance at 340 nm. Indeed, in contrast to the wild-type enzyme and mutant A, mutants B and C were active as glucose dehydrogenases with apparent activities of about 3.5 units/mg of protein (Table I). NAD was also used as cosubstrate and resulted in similar glucose dehydrogenase activities. In the reverse reaction, gluconolactone and NAD(P)H were used at an apparent Vmax of about 0.6 unit/mg of protein (data not shown), but the inherent instability of gluconolactone at the given pH prevented a more detailed study of this reaction. The mutant proteins displayed no detectable activity as fructose reductase or as sorbitol dehydrogenase when NADPH or NADH was present in the reaction mixtures (data not shown).
As NADP and NAD were used as cosubstrates in the glucose dehydrogenase reaction of mutants B and C, we were able to measure respective Km values toward these pyridine nucleotides (Table II). Mutants B and C showed higher affinity for NADP than for NAD, judged by the lower Km values for NADP. This indicated that the mutant proteins preferred the native cofactor of GFOR, NADP. The turnover number (kcat) and the kcat/Km values as criteria for the overall kinetic properties showed that the dehydrogenase reaction of mutants B and C was slow and that NADP was a better substrate than NAD. Thus, a single amino acid exchange S116D (mutant B) leads to a mutant GFOR displaying glucose dehydrogenase activity with dual coenzyme specificity for NADP and NAD.
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Purified mutant proteins B and C have apparently lost their
cofactor, and this is the reason for lack of GFOR activity. We assayed
whether the mutant proteins B and C would behave like apoenzymes that
could regain GFOR activity after prolonged preincubation with an excess
of cofactor for an efficient restoration of enzymatic activity. Indeed,
using mutant proteins B and C, GFOR activities could be restored to
approximately one-third of the wild-type enzyme activity (Table I).
However, when the preincubation step was omitted, and NADP was added
directly to the test mixture (at the same final concentration), GFOR
activity from mutant protein B could not be detected over a period of 5 min. When the preincubation step was prolonged from 5 to 30 min, GFOR
activity of mutant B increased further from about 50 to about 70 units/mg (Fig. 6). Longer incubation with NADP (up to
7.5 h) did not increase GFOR activity beyond 75 units/mg. In
contrast, glucose dehydrogenase activity decreased significantly over
time (Fig. 6). Thus, a kinetic correlation between increasing GFOR and
decreasing glucose dehydrogenase activities appeared. As glucose
dehydrogenase lost its activity also in the absence of NADP in a linear
manner, the enzyme was inherently unstable. We infer that mutant B
undergoes a partial conformational change upon preincubation with NADP,
yielding a conformation that binds NADP tightly and which exhibits GFOR
activity and excludes glucose dehydrogenase activity.
Combination of Exchange S116D with Additional Mutations Results in Complete Loss of GFOR Activity
To analyze if a mutant enzyme with
the complete loss of GFOR activity could be engineered by further
reducing the affinity for NADP of mutant protein B, we performed
additional exchanges of amino acid residues that were outside of the
putative Rossmann fingerprint sequence of GFOR. Positively charged
amino acid residues that follow directly the fingerprint motif may
stabilize the 2
-phosphate group of NADP (29, 31, 33). As a blueprint
for GFOR mutagenesis, we used the sequence of an
NAD-dependent enzyme, inositol dehydrogenase of
Bacillus subtilis (36). This enzyme is the only well
characterized and strictly NAD-dependent enzyme (37) with
striking sequence similarities to GFOR (Fig. 3). Therefore, the region
around the positively charged residues Lys-121 and Lys-123 of GFOR was
exchanged by respective amino acid residues (K121A/K123Q/I124K) to
mimic the inositol dehydrogenase sequence in this region. This
additional exchange of positively charged residues (mutant proteins D
and E, Fig. 4) had no severe effect on the glucose dehydrogenase
activity when compared with the respective ancestor proteins B and C
(Table I). The Km values for NADP are increased
(Table II), which might result from the lack of interaction between
Lys-121 and/or Lys-123 and the 2
-phosphate of NADP. For NAD, only a
slight increase of Km values was observed. More
importantly, with mutant proteins D and E, no GFOR activities could be
detected by the standard photometric assay. In contrast to the ancestor proteins B and C, GFOR activities could not be restored after preincubation with NADP (Table I).
Evidently, the affinity of NADP(H) to mutants D and E is reduced. As a
direct and sensitive method to determine the affinity of mutant GFOR to
NADPH, we measured the interaction of protein with cofactor by the
fluorescence enhancement of NADPH upon binding to the apoprotein. This
method can be used to calculate the dissociation constant
Kd of NAD(P)H to various dehydrogenases (23) and is
based on the fact that NAD(P)H fluorescence intensity is enhanced upon
specific binding to the protein. A titration curve with mutant proteins
B and D relating the NADPH fluorescence intensity to the concentration
of added NADPH is given in Fig. 7A. In
contrast to B, no major fluorescence enhancement could be measured in
the range of 0-10 µM NADPH for mutant D, showing that
the affinity of mutant protein D for NADPH is greatly reduced. The
dissociation constant Kd for mutant B was calculated
by fitting the values of the titration experiment to Equation 1 (Fig.
7C). A Kd of 0.3 µM was
derived for mutant B.
32-46
mutants B and D (solid symbols), GFOR
2-74, and mutants
F and G (open symbols) assessed by monitoring the
nucleotide fluorescence enhancement (
ex = 360 nm;
em = 450 nm). Enzyme solutions (0.6 µM tetramer) were titrated with increasing NADPH
concentrations up to 10 µM. Panel A:
crosses, buffer without the addition of enzyme;
circles, GFOR
32-46; squares, mutant protein
B; triangles, mutant protein D. Panel B:
crosses, buffer without the addition of enzyme;
circles, GFOR
2-74; squares, mutant F;
triangles, mutant G. Panel C: data of
fluorescence enhancement for mutants B (solid squares), F
(open squares), and GFOR
2-74 (open circles)
were fitted to Equation 1 for a second-order type binding process (see
"Materials and Methods"). To assess the number of NADPH binding
sites/tetramer, the plotted data were linearized (inset;
x = (F
FL)(F
FL)
1; y = [NADPH]) according to Bisswanger (38). For mutants B and F, a ratio
of 4 NADPH/tetramer, for GFOR
2-74 a ratio of 2 NADPH/tetramer was
obtained (intersections with y axis). An approximate
dissociation constant of 0.04 µM for GFOR
2-74 and 0.3 µM for mutants B and F was calculated.
Deletion
2-74 Affects GFOR Activity but Not Glucose
Dehydrogenase Activity in Combination with Exchange S116D
During purification steps, we observed that the protein stability of mutants B, C, D, and E was severely affected. After the cation-exchange chromatography step, in several fractions a smaller protein of about 38 kDa could be seen both in SDS-polyacrylamide gels (Fig. 2) and in Western blots (data not shown). From a nearly homogeneous preparation, this form of mutant D (lane 9 of Fig. 2) was shown to be active as glucose dehydrogenase. Using limited Edman degradation, the NH2-terminal amino acid residues were determined to be Ile-Arg-Pro-Met-Pro, which match the amino acid residues from position 75 to 79 of GFOR. Thus, this smaller protein is a degradation form of mutant D resulting from proteolytic truncation at its NH2 terminus. Degradation had removed a proline-rich sequence while retaining the putative Rossmann fold. The calculated molecular mass of the truncated protein of 40,027 Da was in good correlation to the size estimated by SDS-polyacrylamide gel electrophoresis (about 38 kDa, Fig. 2).
As the NH2-terminal truncation apparently only occurred
when tight binding of NADP was affected (mutants B-E), we examined whether the proline-rich region from position 53 to 74 of GFOR fulfilled a specific function in the tight binding of NADP (amino acid
residues 2-52 represent the signal sequence that is normally processed
during export to the periplasm). The coding region for amino acid
residues 2-74 in the plasmid-encoded gfo gene was deleted by a polymerase chain reaction method (18). In addition, this deletion
was combined with mutation B or D. The resulting alleles
2-74, F
and G (Fig. 4) were expressed in Z. mobilis ACM3963, and the
mutant proteins were purified to apparent homogeneity (Fig. 2).
With mutant GFOR
2-74, neither GFOR nor glucose dehydrogenase
activity could be measured (Table I), nor could GFOR activity be
restored upon preincubation with NADP. With mutants F and G, glucose
dehydrogenase activity could be detected at similar levels as with
mutants B-E. Again, no GFOR activity was detected no matter whether
the protein was preincubated with NADP or not (Table I). Km values for mutant F (S116D combined with
2-74) for NADP and NAD were decreased by a factor of approximately
2 compared with mutant B (S116D). For mutant G, no severe change of
Km for NADP and NAD was measured compared with the
respective mutant E without NH2-terminal truncation. In
fluorescence spectra, mutant proteins
2-74, F, and G showed the
same enhanced tryptophan fluorescence as mutant B, indicating that no
NADP(H) was bound to the proteins. No NADP(H) was detected in
supernatants of GFOR
2-74 denatured with perchloric acid (data not
shown). The affinity to NADPH of mutant proteins GFOR
2-74, F, and G
was measured by fluorescence titration (Fig. 7B). NADPH
fluorescence enhancement with GFOR
2-74 ascended steeper than the
titration curve of mutant F, indicating a higher affinity for NADPH
(38).
When fitted to Equation 1, a Kd of 0.3 µM for mutant F was calculated (Fig. 7C) under
the assumption that four NADP binding sites/enzyme are present (1;
inset in Fig. 7C). For GFOR
2-74, a
Kd of 0.04 µM was determined. However,
for GFOR
2-74 only two NADP binding sites were calculated
(inset in Fig. 7C). The reason for this
discrepancy is unknown. Mutant F showed only slight fluorescence
enhancement with NADPH concentrations up to 10 µM. These
data showed that mutant GFOR
2-74 was able to bind NADPH with a
higher affinity than mutants E or F. The lack of GFOR and glucose
dehydrogenase activity in mutant protein GFOR
2-74 is therefore not
due to a mere defect in NADP(H) binding. As the same
Kd values for NADPH were obtained for mutant
proteins B and F, it may be inferred that the proline-rich region of
wild-type GFOR has no direct effect on the affinity for NADP(H).
Based on the revised amino acid sequence derived of the
gfo gene and from our mutational analyses it appears that
the cofactor NADP binds to the 

-dinucleotide binding motif of
GFOR (Rossmann fold; 28). To probe this suggestion and to analyze the
mode of tight NADP binding in GFOR, we used site-directed mutagenesis in the region of the fingerprint motif with the intention of weakening the interaction of the GFOR protein with its cofactor NADP. We reasoned
that a suitable way to accomplish this was to introduce an NAD binding
motif. The exchange A95G (mutant A), however, led to no distinguishable
effect on the NADP binding characteristics, as no differences of mutant
A and the wild-type enzyme were observed in terms of tight cofactor
binding or specificity. In the NADP-dependent glutathione
reductase, the comparable exchange A179G had resulted in a 40-fold
decrease of the Km value for NAD (29). Mutant A of
GFOR, however, had not been able to incorporate detectable quantities
of NAD cofactor during its biosynthesis, as only NADP could be detected
in supernatants of denatured protein.
Combinations of the exchange A95G with mutations B and D (mutants C and
E) also showed no severe effects on cofactor specificity. Therefore,
the exchange A95G is not sufficient to induce an alteration of the
hydrogen bond pattern of the NADP binding 

-fold. In the
NAD-containing S-adenosylhomocysteinase, the exchange G224V in the putative fingerprint region results in a complete loss of
enzymatic activity, and stability had been affected (39). In this
report, however, it is unclear whether the mutation prevents coenzyme
binding indirectly through a gross conformational alteration of the
whole structure. Similar results have been obtained when the Gly-18
residue in the putative fingerprint region of an alcohol oxidase from
Hansenula polymorpha with tightly bound FAD was exchanged to
Val (40). We therefore refrained from introducing other mutations at
position 95 of GFOR.
The single exchange S116D in GFOR had a drastic effect on tight NADP
binding, as the cofactor was absent in the purified protein. Introduction of the negatively charged amino acid residue at the end of
b reduces the affinity for NADP probably by repulsion of the
2
-phosphate of the adenine ribose or by the destruction of a possible
hydrogen bond between the hydroxyl group of Ser-116 to the 2
-P of NADP
in wild-type GFOR.
Interestingly, mutant B displayed glucose dehydrogenase activity which was not found with wild-type GFOR. It may be concluded that the overall structure of the dinucleotide binding fold is maintained in mutant B and that the lower affinity for NADP allowed the free exchange of bound NADPH with soluble NADP. The cofactor NADP was thus changed to a cosubstrate, and the oxidation of glucose was separated from the reduction of fructose. Therefore, the single site mutation altered GFOR to a dehydrogenase with dissociable NAD(P) as cosubstrate and a sequential reaction type, in contrast to the wild-type enzyme, which reacts in a ping-pong type mechanism and contains NADP as a nondissociable redox cofactor. Interestingly, mutant B acts neither as fructose reductase nor as sorbitol dehydrogenase, although from kinetic studies on GFOR it has been postulated that glucose and fructose occupy the same binding site (41). It may be that additional conformational requirements for the binding and/or turnover of fructose can only be adopted when NADP is tightly bound.
The dual coenzyme specificity of the glucose dehydrogenase reaction for
NADP and NAD of mutant B underlines the key role of residue Ser-116 for
cofactor recognition. These results are in good agreement with an
analogous mutation in the NADP-dependent cinnamyl-alcohol
dehydrogenase isoform of Eucalyptus gunnii (42), where a Ser
residue was also involved in recognition of the 2
-phosphate of NADP.
There, a single exchange S212D had resulted in a 2.2 × 103-fold decrease of the overall catalytic efficiency for
NADP, whereas this parameter had not been significantly changed for
NAD.
To our knowledge, this is the first report that an enzyme catalyzing a
so-called complex pyridine nucleotide-dependent
transformation (43) is changed to a dehydrogenase by site-directed
mutagenesis. We suggest that restoration of GFOR activity in mutant B
upon preincubation with high concentrations of NADP concomitant with the decrease in glucose dehydrogenase activity indicates that in mutant
B two possible conformations can be adopted, one with tightly bound
NADP as cofactor acting as GFOR, and another with lower affinity to
NADP acting as glucose dehydrogenase. The exchange of several amino
acid residues (in addition to S116D) which are adjacent to the putative
b-sheet (the
c-loop region) of GFOR by respective residues of the
NAD-dependent inositol dehydrogenase resulted in a mutant
(D) which was not able to restore GFOR activity but whose kinetic
properties as glucose dehydrogenase almost remained the same as those
of mutant B. However, fluorescence titrations showed that the affinity
to NADPH, compared with mutant B, was severely reduced, as little
fluorescence enhancement could be detected. Therefore, residues Lys-121
and/or Lys-123 may indeed contribute to tight NADP binding, most likely
by interaction with the 2
-phosphate of NADP. Such electrostatic
interactions have recently been shown to be essential in NADP
recognition by glucose-6-phosphate dehydrogenase, as the single
exchange of Arg-46 to Gln or Ala resulted in mutant enzymes that
preferred NAD (31).
From the analysis of NADP affinity in mutant proteins B and E, it may
be inferred that tight binding of NADP in GFOR is achieved solely by an
extension of protein-ligand interactions in the 

dinucleotide
binding fold, as has been reported for the UDP-galactose epimerase of
E. coli (44). However, the nature of the conformational change in mutant B necessary to restore GFOR activity is still unclear,
and it is likely that additional interactions with the cofactor are
produced which lock NADP in its binding site, accomplishing tight
binding despite the relaxation caused in mutant S116D.
A possible explanation may be drawn from the analysis of mutant
proteins
2-74, and derivatives thereof, which mimic the
NH2-terminal degradation product that invariantly had
appeared during protein purification of mutants B and D in which tight
NADP binding was affected. Although
2-74 was not able to bind
NADP(H) in the same tight manner as wild-type GFOR, fluorescence
titratons clearly showed that GFOR
2-74 was still able to bind NADPH
with high affinity. Thus, glucose dehydrogenase may be excluded as it
relies on cosubstrate diffusion. Therefore, the proline-rich region
preceding the 

binding fold in GFOR seems to contribute also
to tight NADP binding. As, after preincubation with NADP, no GFOR
activity was measured with GFOR
2-74, the proline-rich region is
essential for the adoption of a conformation displaying GFOR activity.
Mutant F exhibited glucose dehydrogenase activity but, in contrast to
mutant B, did not restore GFOR activity. The proline-rich region of
GFOR therefore might constitute a flexible loop. After binding of NADP
to the high affinity 

-NADP binding fold of GFOR, a
conformational change may induce this loop to cover the dinucleotide
binding fold, thus completing tight NADP binding and creating
structural requirements for GFOR activity. This hypothesis of a
flexible loop is supported by the fact that truncation of GFOR was only observed when tight NADP binding was affected. It is likely that the
proline-rich NH2-terminal loop becomes accessible to
proteases when the cofactor binding site of GFOR is not occupied by
NADP.
We have demonstrated by site-directed mutagenesis of Ser-116 residue (S116D) two new phenomena in GFOR: loss of tight binding of NADP cofactor and acquisition of a new enzyme activity (glucose dehydrogenase) with dual cofactor specificity. Additional mutagenesis (mutants D and E) or NH2-terminal deletions led to the loss of GFOR activity while glucose dehydrogenase activity was retained in the case of mutants D, E, F, and G. GFOR thus may have evolved originally from a glucose dehydrogenase-like ancestor. This is likely as the enzyme still shows sequence similarity to a class of sugar dehydrogenases and because of the behavior of some of the mutants described in this report.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) Z80356[GenBank].
To whom correspondence should be addressed: Institut für
Biotechnologie 1 der Forschungszentrum Jülich GmbH, Postfach
1913, D-52425 Jülich, Germany. Tel.: 49-2461-616205; Fax:
49-2461-612710; E-mail: G.sprenger{at}kfa-juelich.de.
We are indebted to Heidi Loos for contributions to the sequencing of the gfo gene, to Dagmar Mueller for NH2-terminal sequencing, to Volker Wendisch for help with HPLC applications, and to Dirk Halbig for help with GFOR enzyme assays. We thank Reinhard Krämer for critically reading the manuscript.
While the present manuscript was under review, the
three-dimensional structure of GFOR with its cofactor NADP was
published (50). Data therein showed that GFOR, indeed, binds its
cofactor by an extension of protein-ligand interactions in a typical
Rossmann fold with residues Gly-90, Gly-92, and Ala-95 (our
enumeration) as part of the fingerprint region. With respect to our
mutagenesis approach, it is remarkable that amino acid residues Ser-116
and Lys-121 from one subunit and Arg-69 from the
NH2-terminal arm of an adjacent subunit cooperate in
forming hydrogen bonds to the 2
-phosphate of NADP. These structural
data are in full accord with our mutagenesis studies.