|
Volume 272, Number 20,
Issue of May 16, 1997
pp. 13203-13210
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
A 2 -Phosphotransferase Implicated in tRNA Splicing Is
Essential in Saccharomyces cerevisiae*
(Received for publication, November 7, 1996, and in revised form, January 27, 1997)
Gloria M.
Culver
§,
Stephen M.
McCraith
§¶,
Sandra A.
Consaul
,
David R.
Stanford
** and
Eric M.
Phizicky

From the Department of Biochemistry and Biophysics, University of
Rochester School of Medicine, Rochester, New York 14642 and the
Department of Biological Chemistry, Milton S. Hershey
Medical Center, Pennsylvania State University,
Hershey, Pennsylvania 17033
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
The last step of tRNA splicing in the yeast
Saccharomyces cerevisiae is catalyzed by an
NAD-dependent 2 -phosphotransferase, which transfers the
splice junction 2 -phosphate from ligated tRNA to NAD to produce
ADP-ribose 1"-2" cyclic phosphate. We have purified the
phosphotransferase about 28,000-fold from yeast extracts and cloned its
structural gene by reverse genetics. Expression of this gene
(TPT1) in yeast or in Escherichia coli results
in overproduction of 2 -phosphotransferase activity in extracts. Tpt1
protein is essential for vegetative growth in yeast, as demonstrated by
gene disruption experiments. No obvious binding motifs are found within
the protein. Several candidate homologs in other organisms are
identified by searches of the data base, the strongest of which is in
Schizosaccharomyces pombe.
INTRODUCTION
tRNA splicing is essential in both the yeast Saccharomyces
cerevisiae and humans, since both organisms contain tRNA gene
families whose members all contain intervening sequences. Yeast has 10 such intron-containing tRNA gene families (of the approximately 45 total tRNA gene families) (see Ref. 1 for review), and humans have at
least one intron-containing tRNA gene family (2). Since all known
eukaryotic nuclear-encoded tRNATyr genes contain introns,
it is likely that tRNA splicing is essential in all eukaryotes for
processing of tRNA genes.
tRNA introns are invariably located 1 base 3 of the anticodon,
and this location is critical for the the first step of splicing. In
both Xenopus and yeast the endonuclease binds the mature
domain of the precursor tRNA, measures the length of the anticodon stem to locate the intron (3, 4), and excises it if the structure at the 3
splice site is correct (5, 6). The products of the reaction are exons
bearing 2 -3 cyclic phosphates and 5 -hydroxyl groups at their ends,
as shown in Fig. 1 (7, 8).
Fig. 1.
tRNA splicing in yeast. A schematic
representation of tRNA splicing is shown.
[View Larger Version of this Image (13K GIF file)]
Joining of the exons involves a ligase that generates a mature sized
tRNA bearing a splice junction 2 -phosphate (9). The ligase from yeast
catalyzes four distinct chemical steps to effect ligation: the 2 -3
cyclic phosphate at the end of the 5 exon is opened to a 2 -phosphate
by a cyclic phosphodiesterase activity; the 5 -OH at the beginning of
the 3 exon is phosphorylated by a polynucleotide kinase activity in
the presence of GTP; the 5 -phosphate is activated by adenylylation
from ATP; and then ligation occurs with loss of the adenylate moiety
(9-11). The result of ligation is a mature sized tRNA bearing a splice
junction 2 -phosphate (see Fig. 1). A ligase present in wheat germ (12,
13), Chlamydomonas (14), and humans (15) also generates
splice junctions with a 2 -phosphate, and the wheat germ protein is
very similar in catalytic activities to the yeast enzyme (16, 17).
Since removal of the 2 -terminal phosphate prevents the yeast ligase
from working in vitro (10, 18), the 2 -phosphate is likely
formed at the splice junction when this ligase acts in vivo.
The yeast ligase is known to be responsible for tRNA splicing in yeast,
since conditional ligase mutants accumulate unligated tRNA exons under
nonpermissive conditions (19). However, a second ligase, which uses a
completely different chemical reaction and does not generate a splice
junction 2 -phosphate, has been implicated in tRNA splicing in humans
in vitro (20, 21) and in Xenopus oocytes in
vivo (22).
Removal of the splice junction 2 -phosphate occurs by a highly unusual
reaction: a 2 -phosphotransferase transfers the splice junction
phosphate to NAD, forming the novel NAD derivative, ADP-ribose 1"-2"
cyclic phosphate (Appr>p)1 (23). Two lines
of evidence support the claim that the yeast enzyme catalyzes this step
in the cell (24, 25). First, the phosphotransferase is highly specific
for substrates bearing an internal 2 -phosphate; an oligonucleotide
bearing an internal 2 -phosphate is efficiently dephosphorylated,
whereas oligonucleotides terminating with 5 -, 3 -, 2 -, or 2 -3
cyclic phosphates are not detectably dephosphorylated. Second, this is
the only activity detected in crude extracts that can efficiently
remove the 2 -phosphate from ligated tRNA. A similar
2 -phosphotransferase has been described in HeLa cell extracts; like
the yeast enzyme the HeLa enzyme is highly specific for substrates with
internal 2 -phosphates and is the only activity that can efficiently
dephosphorylate 2 -phosphorylated ligated tRNA (25). Moreover, it is
likely that the phosphotransferase can act in vivo on tRNA
substrates: Xenopus oocytes injected with 2 -phosphorylated
ligated tRNA catalyze formation of Appr>p concomitant with
dephosphorylation (23).
To begin to study the role of the phosphotransferase in yeast, we have
purified the protein and cloned its structural gene (TPT1;
tRNA 2 -phosphotransferase).
Phosphotransferase was purified ~28,000-fold, the N-terminal amino
acid sequence was determined, and the appropriate DNA was isolated by
colony hybridization of a yeast genomic library. The identified ORF was
expressed in Escherichia coli and shown to catalyze
2 -phosphotransferase activity, implying that phosphotransferase is a
single catalytic polypeptide. 2 -Phosphotransferase is essential for
vegetative growth in yeast, as demonstrated by analysis of strains with
chromosomal deletions in the TPT1 gene. The sequence of the
phosphotransferase does not reveal any obvious binding or catalytic
motifs. Several significantly similar ORFs are identified by searches
of the data base, including a particularly strong one in
Schizosaccharomyces pombe.
EXPERIMENTAL PROCEDURES
Preparation of Ligated tRNA
Ligated tRNAPhe
with a 32P-labeled splice junction 2 -phosphate was
prepared by in vitro endonucleolytic cleavage and ligation (with partially purified enzymes) of an
[ -32P]ATP-labeled pre-tRNAPhe transcript
(26). The 32P-labeled pre-tRNAPhe transcript
(340 Ci/mmol) was derived from T7 RNA polymerase transcription of a
plasmid-borne copy of the end-matured pre-tRNAPhe gene
(27).
2 -Phosphotransferase Assay
Transfer of the 2 -phosphate
from ligated tRNA to NAD to form Appr>p was performed as described by
McCraith and Phizicky (26) in 10 µl reaction mixtures in
phosphotransferase buffer (20 mM Tris-HCl, pH 7.5, 5 mM MgCl2, 2.5 mM spermidine, 0.1 mM DTT, and 0.4% Triton X-100) containing 1-4 fmol of
ligated tRNA, 1 mM NAD, and 1 µl of 2 -phosphotransferase
diluted in Buffer B containing 100 µg/ml BSA. Reaction mixtures were
incubated at 30 °C for 20 min and applied to
polyethyleneimine-cellulose plates that were developed in 2 M sodium formate, pH 3.6, to separate Appr>p from the tRNA
(26). One unit of activity corresponds to the amount of
phosphotransferase required to transfer 50% of the 2 -phosphate from 1 fmol of ligated tRNA to NAD in 20 min, determined by serial dilution.
Yeast Strains
Yeast strains YM4126 (SC724) (MATa, ura
3-52, his 3 200, ade2-101,
lys2-801 leu2-3, 112, trp1-903
GAL+), YM4127 (SC725) (MATa, ura3-52,
his3- 200, ade2-101, lys2-801, leu2-3, 112, trp1-903
tyr1-501 GAL+), YM4128 (SC726) (MAT ,
ura3-52, his3- 200, ade2-101, lys2-801 leu2-3,
112, trp1-903 GAL+), and YM4129 (SC727)
(MAT , ura3-52, his3- 200, ade2-101,
lys2-801, leu2-3, 112, trp1-903 tyr1-501 GAL+)
were obtained from Mark Johnston (Department of Genetics, Washington University Medical School, St. Louis, MO). YM4126 was crossed with
YM4129 to create the diploid SC759 (picked from the zygotes), and
YM4127 was crossed withYM4128 to create the diploid SC758. SC804
(TPT1+/tpt1- 1) was
derived from SC759 by one-step gene replacement with pGMC22
(tpt1- 1::LEU2), and SC805
(TPT1+/tpt1- 2) was
derived from SC758 by one-step gene replacement with pGMC17
(tpt1- 2::LEU2). SC466
(MAT , ura3-52, leu2-3, 112, his3- 200 lys2-801) was described previously (28),
and JHRY-20-2Ca (Mata, his3- 200, leu2-3, 112, ura
3-52, pep4::URA3) was obtained from Tom Stevens
(Institute of Molecular Biology, University of Oregon, Eugene, OR).
Growth of Yeast
YP medium contains 1% yeast extract and
2% peptone, minimal medium is described by Sherman (29), and
5-fluoroorotic acid medium is described by Boeke et al.
(30). Strain JHRY-20-2Ca was grown in a 100-liter fermentor (New
Brunswick model IF130) at 30 °C to an A600 of
4 in YP medium containing 2% glucose, 0.083 µg/ml streptomycin, 0.033 µg/ml penicillin, 0.5% ethanol, and 0.17% polyethylene
glycol, and cells were chilled with ice and harvested in a Westfalia
Clarifier (Centrico Inc., Northvale, NJ). To measure phosphotransferase expression, strain JHRY-20-2Ca transformed with either the 2µ LEU2 vector yEPlac181 or with pGMC5 (yEPlac181
TPT1+) was grown at 30 °C in minimal medium
lacking leucine to A600 = 0.45. SC466
transformed with either the GAL10 promoter vector pBM150
(CEN URA3 PGAL10) or with pGMC21 (pBM150
PGAL10-TPT1) was grown overnight in minimal
medium containing 2% raffinose and lacking uracil, and cells were
inoculated directly into 75-ml cultures of YP + 2% galactose or YP + 2% glucose and grown for 2.5 generations. Cells were harvested,
washed, resuspended, and made into extracts as described below for the
purification of phosphotransferase.
Plasmids and DNA Manipulations
The vectors yCPlac33,
yEPlac195, and yEPlac 181 were constructed by Geitz and Sugino (31).
The TPT1 gene was isolated by E. coli colony
hybridization of a yeast genomic library (32), essentially as described
by Sambrook et al. (33), using the 5
32P-oligomer CCGCTGTATGTCGAAGCAGATATG (an antisense
oligomer corresponding to nucleotides 79-56 of Fig. 4A), as
a probe. Large fragments encompassing the TPT1 gene (see
Fig. 4B) from the isolated plasmid (pEMP981) were ligated
into the multicloning sites of the URA3 CEN vector yCPlac33
to construct pGMC1 (EcoRI-SacI fragment), the
URA3 2-µm vector yEPlac195 to construct pGMC4
(EcoRI-PstI fragment), the LEU2 2-µm
vector yEPlac181 to construct pGMC5 (EcoRI-PstI fragment), and pSP72 vector to construct pGMC7
(EcoRI-HpaI fragment of EMP981 ligated into the
EcoRI and PvuII vector fragment).
Fig. 4.
A, predicted amino acid sequence of the
Tpt1 protein. The sequence was obtained from the Saccharomyces
cerevisiae genome data base (HRE230 accession number S51897[GenBank]) and
independently confirmed. B, restriction map of the
TPT1 gene and surrounding region on chromosome XV. The
TPT1 ORF and neighboring ORFs are represented by heavy
arrows in the direction in which they are transcribed. Restriction
sites within and around the TPT1 gene, which were used for
plasmid constructions, are represented by light vertical
lines. The positions of the oligonucleotides used for polymerase
chain reaction amplification of the TPT1 ORF
(dP-1 and dP-2) and of the tpt1
deletions are indicated. All restriction sites shown are unique within
the fragment represented, and the map is drawn approximately to scale,
indicated at the top left. P, PstI; Hp,
HpaI; S, SacI; H,
HindIII; A, AflII; R,
EcoRI.
[View Larger Version of this Image (28K GIF file)]
Disruptions of the TPT1 gene were generated by insertion of
a LEU2 HindIII fragment (obtained from a polylinker-inserted
LEU2 SspI chromosomal fragment, modified to contain
HindIII ends) into one of two positions within the
TPT1 gene, as illustrated in Fig. 4B: to replace
the HindIII fragment of 226 nucleotides around the ATG
translation start of pGMC7, generating pGMC22
(tpt1- 1::LEU2), or to replace the
744 base pair HindIII-AflII fragment of pGMC7, after filling in the AflII end and adding a
HindIII linker, generating pGMC17
(tpt1- 2::LEU2).
pGMC10 contains the TPT1 ORF bounded by engineered
EcoRI sites, ligated into pSP72. It was generated by
polymerase chain reaction amplification of the TPT1 gene
from the ATG of the ORF to a site 240 nucleotides downstream of the TAA
termination codon (see Fig. 4B), using Taq
polymerase and primers dP-1 (AGAGGAATTCACAGGTGGCCGAAGGTGCTGCC) and dP-2
(GACGAATTCATGCGCCAGGTACTACAAAAAG), followed by EcoRI digestion, ligation into the vector, and sequencing of transformants to
identify an otherwise unaltered gene. The EcoRI fragment of pGMC10 was inserted into pBM150 (34) to place the TPT1 gene under control of the yeast GAL10 promoter (pGMC21) and into pKK223-3 (34) to place the TPT1 gene under control of the E. coli tac promoter (pGMC9).
Expression of Tpt1 Protein in E. coli
E. coli
strain RZ510 (relevant genotype lac iSQ) was
transformed with pKK223-3 vector or with pGMC9 to express the
TPT1 gene. 50-ml cultures were grown at 37 °C in L broth
to an A600 of 0.8, induced with 1 mM
isopropyl- -D-thiogalactopyranoside for 1 h, and
cells were harvested, resuspended in 2 ml of buffer containing 50 mM Tris 7.5, 1 mM EDTA, 450 mM
NaCl, 5 mM DTT, and 10% glycerol, and sonicated on ice in
10 s bursts for 1 min. Extracts obtained after centrifugation
(12.5 mg/ml) were aliquoted, frozen, and thawed to measure
phosphotransferase activity.
Protein Concentration and Visualization
Protein
concentration was determined using Bradford reagent (Bio-Rad).
Polypeptides were visualized after SDS-polyacrylamide gel
electrophoresis by silver staining, as described (35).
Purification of 2 -Phosphotransferase
2.5 kg (wet weight)
of frozen yeast were thawed, washed with 5 liters of Wash Buffer (0.1 M Tris-HCl, pH 7.5, and 10 mM DTT), resuspended
in 1.25 liters of lysis buffer (20 mM Tris, pH 7.5, 2 mM EDTA, 10 mM DTT, 10% (v/v) glycerol, 1 M NaCl, 1.7 mM phenylmethylsulfonyl fluoride,
1.2 µg/ml leupeptin, and 1.2 µg/ml pepstatin A), and lysed with
0.5-mm glass beads using a Bead-Beater, as described by McCraith and
Phizicky (24). Crude extract was obtained by passing the mixture
through a coarse sintered glass funnel, followed by centrifugation at
13,000 × g for 40 min.
Protein was precipitated by the addition of solid ammonium sulfate to
80% saturation, followed by centrifugation at 14,700 × g for 45 min. The protein pellet was washed with 2 liters of Buffer A (20 mM Tris-HCl, pH 7.5, 1 mM EDTA, pH
8.0, 200 mM NaCl, 1 mM DTT, and 10% (v/v)
glycerol) containing 59% saturated ammonium sulfate, and
2 -phosphotransferase activity was recovered by two successive
extractions of the 59% pellet with 2 liters of Buffer A containing
46% saturated ammonium sulfate, followed by centrifugation to remove
the pellet. Protein in the combined supernatants was reprecipitated by
the addition of solid ammonium sulfate (to 80% saturation) and
centrifugation, and the pellet was resuspended in 500 ml of Buffer B
(20 mM Tris, pH 7.5, 2 mM EDTA, 4 mM MgCl2, 1 mM DTT, and 10% (v/v)
glycerol) containing 350 mM NaCl, and dialyzed overnight
against 20 liters of this buffer. Dialyzed protein was applied to a 250 ml blue Sepharose CL-6B column (Pharmacia Biotech Inc.) equilibrated in
the same buffer, washed, and active fractions (700 ml) flowed through
the column. These fractions were pooled, diluted 2-fold with Buffer B
lacking NaCl, reapplied to the blue Sepharose column equilibrated with
Buffer B containing 0.175 M NaCl, and retained protein was
eluted with a 2-liter linear gradient of Buffer B from 0.175 to 2 M NaCl. 2 -Phosphotransferase eluted at 450-500
mM NaCl.
Active fractions (350 ml) from the blue Sepharose column were dialyzed
against Buffer B containing 40 mM NaCl, applied to a 250-ml
heparin-Sepharose column, and activity was eluted with a gradient of
Buffer B containing 40-900 mM NaCl. Active fractions (25 ml) were loaded directly onto a 15-ml hydroxylapaptite column (DNA
grade Bio-Gel HTP, Bio-Rad) equilibrated in Buffer C (20 mM
Tris, pH 7.5, 0.5 mM EDTA, 1 mM
MgCl2, 10% (v/v) glycerol, 1 mM
-mercaptoethanol, and 50 mM NaCl), and
phosphotransferase activity was eluted with a linear gradient of Buffer
C containing 0-0.25 M K2HPO4 (pH
7.5 with phosphoric acid). Peak fractions from the hydroxylapatite
column (8 ml) were dialyzed against Buffer B containing 40 mM NaCl and 20% glycerol, applied to a 0.5-ml orange A
Sepharose column (Amicon Division, W. R. Grace & Co., Beverly, MA), and
2 -phosphotransferase was eluted with a gradient of Buffer B from 40 to
700 mM NaCl. Active fractions, (250 µl each), were
dialyzed individually against Buffer B containing 50% (v/v) glycerol
and 55 mM NaCl and subsequently stored at 20 °C. Little loss of activity was observed over 3 months.
A streamlined purification yielded material that was about 4-fold less
pure. Crude extracts were dialyzed against Buffer B containing 0.15 M NaCl, loaded directly on a 500-ml blue Sepharose column,
and retained protein was eluted with a 2.5-liter gradient of Buffer B
containing 150 mM to 1.5 M NaCl. Active
fractions (which elute at higher salt concentration (0.6 M)
than in the preparation above) were then subjected to chromatography on
heparin-agarose, hydroxylapatite, and orange A Sepharose as described
above.
Protein Sequencing
100-200 pmol of purified
phosphotransferase was resolved on a 12% SDS-polyacrylamide gel,
transferred electrophoretically to polyvinylidene difluoride membranes,
stained with Coomassie Blue R-250, destained, and used for sequencing
essentially as described by Matsudaira (36). Transfer was done in a
Bio-Rad transblot apparatus at room temperature for 4 h at 0.65 mA/square cm or 300 mA in transfer buffer containing 39 mM
glycine, 48 mM Tris base, and 20% methanol.
UV Cross-linking of tRNA to Phosphotransferase
Fractions
RNA-protein cross-linking reactions were assembled in
15 µl of phosphotransferase assay buffer containing 200 µg/ml BSA,
180,000 cpm of spliced tRNA, 750 units (approximately 5 ng) of
2 -phosphotransferase from the orange A column peak, 5 mM
AMP, and no NAD. Reaction mixtures were preincubated for 15 min at
30 °C, and proteins were cross-linked to RNA for 10 min at room
temperature, using a UV source at 254 nm (UV-C Bleit 155 lamp,
Spectronics Corp., Westbury, NY) with an intensity of 2 milliwatts/cm2. Samples were supplemented with 55 µl of
10 mM Tris, pH 7.5, and digested with 7.5 units of
ribonuclease T1 at 50 °C for 45 min. Proteins were precipitated at
20 °C by the addition of trichloroacetic acid to 10%, followed by
centrifugation to pellet the protein, washing with ice cold acetone,
resuspension in SDS-polyacrylamide gel electrophoresis loading buffer,
boiling for 15 min, and electrophoresis on a 12% SDS-polyacrylamide
gel.
RESULTS
Purification of 2 -Phosphotransferase Implicates a 30-kDa
Polypeptide
The purification of 2 -phosphotransferase yields a
prominent polypeptide of 30 kDa, which comigrates with activity. This
is illustrated in Fig. 2, in which fractions from the
final purification step were analyzed for both polypeptides and
phosphotransferase activity. The amount of 30-kDa polypeptide closely
parallels phosphotransferase activity in different fractions, both
across the final orange A column (compare fractions 20-36 in Figs. 2,
A and B) and in the peak fractions from the
heparin-agarose and hydroxylapatite columns of the purification (Fig.
2A). Three other minor polypeptides are visible in this
preparation of 2 -phosphotransferase activity, with apparent molecular
masses of 52, 45, and 20 kDa. Neither of the chromatographic profiles
of the 52-kDa or the 45-kDa polypeptides corresponds to the observed
activity peak from the orange A column (Fig. 2); however, the profile
of the 20-kDa polypeptide does appear to correspond to the observed
activity peak from this column. The same 30-kDa polypeptide, but not
the 20-kDa polypeptide, also copurifies with activity using a
streamlined purification procedure (see "Experimental Procedures"),
and if the material from the penultimate step of this streamlined
procedure is chromatographed on DEAE or on another heparin-agarose
column (with isocratic elution) instead of the orange A column. Thus it
seemed likely that the 30-kDa polypeptide is the limiting component
responsible for 2 -phosphotransferase activity.
Fig. 2.
Purification of yeast 2 -phosphotransferase.
A, SDS-polyacrylamide gel electrophoresis of polypeptides
present in representative fractions from the purification, visualized
by silver staining. Blue Sepharose number 2 peak (Blue 2),
64 µg, 21,650 units; heparin-agarose peak, 5 µg, 15,000 units;
Bio-Gel-HTP hydroxylapatite peak, 1.8 µg, 40,000 units;
fractions 17-36, 5 µl each of the orange A Sepharose column fractions, as indicated (fraction 26, 40,000 units,
0.4 µg); Prep 1, peak fraction (1 × 107
units/mg) from an earlier purification, omitting the first blue Sepharose column and the hydroxylapatite column. Size markers are
indicated on the right. B, orange A Sepharose
column profile. Fractions from the orange A column were individually
assayed for phosphotransferase activity (filled circles) and
for protein (open circles), as described under
"Experimental Procedures."
[View Larger Version of this Image (46K GIF file)]
The 30-kDa Protein Cross-links to Spliced tRNA
The suggestion
that the 30-kDa polypeptide is a component of the phosphotransferase is
supported by the observation that it can be cross-linked to its
substrate. As shown in Fig. 3, ligated tRNA bearing a
2 -phosphate, prepared from [ -32P]ATP-labeled pre-tRNA
transcript, is cross-linked to a polypeptide of 30 kDa (band
B1) from the peak orange A fraction, as visualized after RNase T1
treatment of the sample and subsequent electrophoresis through an
SDS-polyacrylamide gel. This cross-linking requires both
phosphotransferase and UV illumination. No UV-dependent
cross-linking is observed to BSA, which was deliberately present at a
600-fold higher concentration than 2 -phosphotransferase and to the
contaminating 52- and 45-kDa polypeptides. A band migrating at around
20 kDa (band B2) was present in all lanes, and thus
represents an RNase T1-resistant background. Based on the apparent
molecular mass of the cross-linked polypeptide (band B1), we
conclude that the 30-kDa polypeptide comigrating with activity in the
purification is the cross-linked protein. Separate experiments with
less purified fractions demonstrate that the interaction of the 30-kDa
polypeptide with tRNA is specific: cross-linking occurs with ligated
tRNA bearing a 2 -phosphate, but not with dephosphorylated ligated tRNA
(data not shown). Furthermore, cross-linking is inhibited by an excess
of unlabeled synthetic substrate (UppU, which contains a
2 -phosphate) (23, 37) at a concentration of 50 µM, but
is not inhibited by the corresponding nonsubstrate (UpU) at a
concentration of 10 mM (data not shown). Since the same
size polypeptide copurifies with activity and cross-links to tRNA
substrate, it is likely that this is one of the components of the
phosphotransferase. Since, in addition there is reasonably good yield
at each step of the purification (see Table I), and there is only one major copurifying polypeptide, it is likely that this
polypeptide is the only catalytic subunit of the phosphotransferase. This conclusion is substantiated further below.
Fig. 3.
UV cross-linking of 2 -phosphotransferase to
ligated tRNA. 750 units of highly purified 2 -phosphotransferase
from the orange A column peak (lanes a and b) or
appropriately diluted buffer (lanes c and d) was
incubated with 180,000 cpm of -32P-labeled-spliced tRNA
in phosphotransferase buffer containing 200 µg/ml BSA and no NAD,
illuminated with 254-nm light, and cross-linked proteins were detected
after RNase T1 digestion by electrophoresis on an SDS-polyacrylamide
gel, as described under "Experimental Procedures." B1,
the major cross-linked species observed with phosphotransferase,
migrating as a doublet; B2, a background RNase T1-resistant
UV-independent band observed in all lanes.
[View Larger Version of this Image (32K GIF file)]
Table I.
Purification of yeast 2 -phosphotransferase protein
|
| Fraction |
Volume |
Activity |
Protein |
Specific
activity |
Fold purification, step (overall) |
Yield, step (overall)
|
|
|
ml |
units |
mg |
units/mg |
|
%
|
| Extract |
1820 |
6.7
× 108 |
136,000 |
4.9
× 103 |
| 46-59%
(NH4)2SO4 |
1040 |
3.5
× 108 |
17,300 |
2.0
× 104 |
4.1 (4.1) |
52 |
| Blue
Sepharose #1 |
1400 |
2.4 × 108 |
9,800 |
2.4
× 104 |
1.2 (4.9) |
69 (36) |
| Blue Sepharose
#2 |
35 |
4.2 × 107 |
123 |
3.4
× 105 |
14 (69) |
17 (6.3) |
| Heparin
Agarose |
25 |
6.6 × 107 |
21.8 |
3.0
× 106 |
8.9 (620) |
160 (9.9)
|
| Bio-Gel-HTP |
8.2 |
2.6 × 107 |
1.17 |
2.2
× 107 |
7.3 (4500) |
39 (3.9) |
| Orange A
Sepahrose |
1.1 |
1.1 × 107 |
0.080 |
1.4
× 108 |
6.2 (28,000) |
42 (1.6) |
|
Isolation of the Phosphotransferase Gene
To clone the
structural gene for the phosphotransferase, we sequenced the N-terminal
end of the 30-kDa protein in the final orange A column, after transfer
of the polypeptides to polyvinylidene difluoride paper and excision of
the appropriate region. We obtained 14 amino acids of N-terminal
sequence. The same sequence was also obtained from two other
experiments with equivalent, but less pure, material obtained from the
streamlined purification procedure, which contained slightly different
contaminants. Furthermore, the yield of amino acids obtained from the
initial steps of the sequencing run corresponded roughly to the number
of moles of 30-kDa polypeptide subjected to sequencing. Thus, we were
likely sequencing the major polypeptide present at 30 kDa and not a
minor contaminant.
The 2 -phosphotransferase gene (TPT1) was isolated by
reverse genetics. The sequence of 14 amino acids was compared with the information in the yeast data base, and a single perfect match was
found at the N-terminal end of an ORF of 26.2 kDa, located on
chromosome XV. The sequence of this ORF is shown in Fig.
4A. No other near matches were found in the
yeast data base. An oligonucleotide probe was designed from the
data base DNA sequence, and this probe was used to isolate the gene
from a yeast genomic library by colony hybridization, as described
under "Experimental Procedures." A schematic of a portion of
chromosome XV that was isolated is illustrated in Fig. 4B,
showing the position of the TPT1 ORF and neighboring ORFs. Plasmids containing the phosphotransferase gene,
constructed as described under "Experimental Procedures,"
were then used to confirm that the gene encodes
2 -phosphotransferase.
TPT1 Encodes the 2 -Phosphotransferase
Overproduction of Tpt1
protein in yeast results in overproduction of 2 -phosphotransferase
activity. This was established in two experiments, which are summarized
in Table II. First, high gene dosage results in
overproduction of activity. Extracts made from a strain bearing a high
copy plasmid containing the gene and its regulatory regions (2-µm
TPT1) have about 55-fold more phosphotransferase activity
than extracts from the same strain bearing the plasmid vector alone
(Table II). Second, placing the open reading frame under control of a
regulatable promoter in yeast results in regulated overproduction of
the phosphotransferase activity. To this end, a plasmid was constructed
with the TPT1 open reading frame immediately downstream of
the GAL10 promoter and transcription start site, as
described under "Experimental Procedures." A strain bearing this
plasmid (PGAL10-TPT1) overproduces phosphotransferase about 20-fold when grown in galactose, which induces
transcription, compared with the phosphotransferase produced when cells
are grown in glucose, which represses transcription (Table II). These
two experiments demonstrate that expression of the TPT1 gene
is the limiting factor determining the observed 2 -phosphotransferase
activity in yeast extracts.
Table II.
Overproduction of phosphotransferase in yeast
|
| Strain |
Growth |
Specific activity
|
|
|
|
units/mg |
| EMP177 + yEPlac181 (2-µm LEU2
vector) |
Leucine |
9
× 103 |
| EMP177 + pGMC5 (2-µm LEU2
TPT1) |
Leucine |
500 × 103 |
| SC466 + pBM150
(PGAL10 vector) |
YP + glucose |
6.1 × 103
|
| SC466 + pBM150 (PGAL10 vector) |
YP + galactose |
6.8
× 103 |
| SC466 + pGMC21
(PGAL10-TPT1) |
YP + glucose |
8.6
× 103 |
| SC466 + pGMC21
(PGAL10-TPT1) |
YP + galactose |
170
× 103 |
|
To establish that TPT1 encodes the 2 -phosphotransferase,
the gene was expressed in E. coli. As shown in Table
III, extracts from an E. coli strain bearing
the expression vector pKK223-3 have little, if any, detectable
2 -phosphotransferase activity. However, extracts from an E. coli strain containing the TPT1 ORF fused immediately
downstream of the hybrid trp-lac promoter of pKK223-3 have
106-fold more 2 -phosphotransferase activity than the
control extracts when expression is induced in the presence of
isopropyl- -D-thiogalactopyranoside. Since the
TPT1 gene encodes a protein of 26.2 kDa, which has
2 -phosphotransferase activity, and its size is nearly the same as that
identified in the purification (Fig. 2), and in cross-linking
experiments (Fig. 3), it is highly likely that Tpt1 protein is the
phosphotransferase protein.
Table III.
Overproduction of phosphotransferase activity in E. coli
|
| Strain |
Specific activity
|
|
|
units/mg |
| E. coli + Ptac vector, induced |
<3 |
| E.
coli + Ptac-TPT1, induced |
8 × 106 |
|
2 -Phosphotransferase produced by expression of the TPT1
gene in E. coli is very similar to that purified from yeast.
Both proteins require NAD to catalyze removal of the splice junction 2 -phosphate from ligated tRNA, and the NAD dependence is similar (half-maximal activity at 1 unit of Tpt1 protein requires about 10-20
µM NAD). Furthermore, Tpt1 protein expressed in E. coli also transfers the splice junction 2 -phosphate from ligated
tRNA to NAD to produce Appr>p, as measured by comigration of the
product (in several different thin layer chromatography systems) with Appr>p made by the purified yeast protein, as well as by phosphatase resistance of the product (data not shown). Similarly, Tpt1 protein produced in E. coli, like the yeast enzyme, prefers
substrates with tRNA structure: for each protein 2 -phosphorylated tRNA
is about 50-fold more efficient a substrate than a synthetic
oligonucleotide (pUpUppU), which contains a
2 -phosphate.2 Assuming that E. coli extracts do not fortuitously supply missing factors that can
act in concert with Tpt1 protein, it is likely that
2 -phosphotransferase is a single polypeptide that can recognize its
substrates and catalyze the complete phosphotransfer reaction.
Tpt1 Protein Is Essential for Vegetative Growth
Removal of
the 2 -phosphate from ligated tRNA is likely to be critical for tRNA
function. Since the splice junction 2 -phosphate is 1 base 3 of the
anticodon, its bulk and charge would be expected to interfere with
anticodon recognition and thus impair growth. If Tpt1 protein is the
enzyme that catalyzes removal of the splice junction 2 -phosphate from
ligated tRNA in vivo, then cells lacking this protein would
likely be dead (or very sick).
Gene disruption experiments demonstrate that the TPT1 gene
is essential. To show this, we did a standard one-step gene disruption experiment, in which we replaced one allele of the TPT1 gene
in a diploid with a copy of the LEU2 gene, as described
under "Experimental Procedures," and sporulated the resulting
diploid. Two separate gene disruptions were made by replacement of a
fragment spanning the ATG of the ORF with the LEU2 gene: in
tpt1- 1::LEU2, a 226-nucleotide HindIII fragment extending from 174 in the promoter to +53
in the coding region was replaced; and in
tpt1- 2::LEU2 a 744 nucleotide HindIII-AflII fragment from 174 in the promoter
to +570 in the coding region was replaced (see Fig. 4B).
Southern analysis confirmed in both cases that the chromosomal DNA from
the transformant diploids contained one normal sized copy of the
TPT1 gene and one copy of the TPT1 gene that was
altered by the presence of the LEU2 gene (data not shown).
In SC804 (relevant genotype:
TPT1+/tpt1- 1::LEU2)
6 tetrads were examined; all segregated two live:two dead spores, and
all the live spores lacked the LEU2 marker. Similarly in
SC805 (relevant genotype:
TPT1+/tpt1- 2) seven
tetrads were examined and all segregated two live Leu
spores and two dead spores. These are the expected results if disruption of the TPT1 gene is lethal. Since, in addition,
microscopic examination of the nonsurviving spores demonstrated that
they germinated and grew into microcolonies, these results suggest that
the TPT1 gene is essential.
To confirm that the lethality of the disruptions was caused by
lack of the TPT1 gene itself, we demonstrated that the
TPT1 gene on a plasmid could complement the deletion and
suffice for viability. As shown in Table IV, SC804
(tpt1- 1::LEU2/TPT1+)
carrying a plasmid bearing the TPT1 gene on either a single copy plasmid (CEN URA3) or a multicopy plasmid (2-µm
URA3) could readily segregate Leu+
(tpt1 ) spores as long as the spores also
contained a URA3+ TPT1+ plasmid; by
contrast, SC804 carrying just a URA3 plasmid segregated only
Leu spores. Furthermore, only the TPT1 gene
itself was required to complement the
tpt1- 1::LEU2 disruption, since
Leu+ Ura+ spores could be readily recovered if
the sporulated diploid carried a URA3 CEN plasmid containing
only the TPT1 ORF (fused to the GAL10 promoter)
and 236 nucleotides of downstream DNA (to allow for termination of
transcription). Since the TPT1 ORF is the only ORF on this
plasmid, and it still complements the lethality of the tpt1
disruption, it is highly likely that the TPT1 gene is essential. Furthermore, as expected if the TPT1 gene is
essential for vegetative growth, cells bearing the TPT1
deletion require the plasmid-borne TPT1 gene for continued
viability. Whereas wild type cells bearing a URA3 plasmid
can easily lose such plasmids when the URA3 gene is selected
against on media containing 5-fluoroorotic acid,
tpt1- 1::LEU2 haploid strains bearing
the TPT1 gene on a URA3 plasmid cannot lose the
plasmid and therefore die on media containing 5-fluoroorotic acid (see
Table IV). This is the expected result if expression of the
TPT1 gene is necessary for vegetative growth.
Table IV.
Segregation of SC804 (TPT1+/tpt1- 1::LEU2)
transformed with URA3 plasmids
|
| Plasmid |
Tetrads, Leu+:Leu segregation |
Total
Leu+ |
Total Leu+,Ura+ |
Total
Leu+,Ura+,5-FOAs |
|
| pEMP881 (CEN
URA3) |
5, 0:2 |
0 |
0 |
0 |
|
2,
0:1 |
0 |
0 |
0 |
| pGMC1 (CEN URA3 TPT1) |
2,
2:2 |
4 |
4 |
4 |
|
1, 1:2 |
1 |
1 |
1 |
|
1,
2:1 |
2 |
2 |
2 |
|
1, 0:3 |
0 |
0 |
0 |
|
1,
1:1 |
1 |
1 |
1 |
|
3, 0:2 |
0 |
0 |
0 |
| pGMC4 (2-µm
URA3 TPT1) |
4, 2:2 |
8 |
8 |
8 |
|
2,
1:2 |
2 |
2 |
2 |
|
1, 2:1 |
2 |
2 |
2 |
|
1,
1:1 |
1 |
1 |
1 |
|
1, 0:2 |
0 |
0 |
0 |
| pGMC21 (CEN
URA3 PGAL10-TPT1) |
2, 2:2 |
4 |
4 |
4
|
|
1, 1:2 |
1 |
1 |
1 |
|
2, 0:2 |
0 |
0 |
0 |
|
1,
1:0 |
1 |
1 |
1 |
|
1, 0:1 |
0 |
0 |
0 |
|
Analysis of the TPT1 Gene
The phosphotransferase is a
230-amino acid protein, with a calculated molecular weight of 26,196 and an isoelectric point of 9.30. It is a highly charged protein; fully
30% of the residues are potentially ionized at neutral pH, and there
is a substantial excess of basic residues (12 Arg, 20 Lys, 12 His) over
acidic residues (11 Asp, 14 Glu).
Examination of the amino acid sequence with either GCG or Prosite, or
by visual inspection, reveals little about possible domains of the
protein. No well characterized RNA binding motifs are found in the Tpt1
protein, including the RNP1, arginine-rich (ARM), RGG, K homology (KH),
and double-stranded RNA binding motifs (see Ref. 38 for review).
Similarly, there are no sequences identical to the RNA binding motifs
of the class I aminoacyl tRNA synthetases, which are involved in
binding the amino acid acceptor stem of the tRNA (39, 40), and no
marked similarities with the less well characterized class II aminoacyl
tRNA synthetase sequences (41). Among the tRNA synthetases there is a
lack of a consensus site for binding the tRNA anticodon (42, 43). The
best match to an NAD binding domain is to that of diphtheria toxin
(44). The residues of diphtheria toxin (and by analogy the related
exotoxin A from Pseudomonas aeruginosa) that contact NAD are
characterized by the sequence
HGTXXXYXXSIXX(X)GXQ/RXP/R. A reasonable match is found in the S. cerevisiae sequence
beginning at amino acid 117 (HGTNLQSVIKIIESGAISP). The other well
characterized NAD binding site contains the sequence
GXGXXG/A, which is found in many dehydrogenases
at the end of the first -sheet of a   ADP-binding fold
(45-47), and which is also found in NAD-requiring poly(ADP-ribose)
polymerases (48); no perfect matches are located in the TPT1
sequence. There are also no obvious similarities with the sequence of
NAD-dependent DNA ligases, including the region around the
adenylylation site (49).
The Tpt1 amino acid sequence is conserved in ORFs from several
different eukaryotes as well as in an ORF from E. coli. The closest similarity is to an ORF in S. pombe, found on clone
c2C4 of the S. pombe sequencing project being done at the
Sanger Center in the United Kingdom
(http://www.sanger.ac.uk/~yeastpub/svw/pombe.html). The predicted
amino acid sequence of this gene is shown in Fig. 5. The
S. pombe ORF is 34% identical and 57% similar to that of S. cerevisiae, with three distinct blocks of 10 or more
amino acids where the identity approaches or exceeds 80%. The
conservation of sequence extends over the entire length of the S. cerevisiae protein, suggesting that the S. pombe ORF
might be a functional homolog of the Tpt1 protein. Tpt1 protein also
shares significant conserved amino acid sequence with an ORF in
E. coli and several ESTs from higher eukaryotes, as
illustrated in Fig. 5. The amount of conserved sequence, and the fact
that the conservation is largely in the same regions between all the
potential proteins, suggest that these ORFs form a family.
Fig. 5.
Comparison of the Tpt1 amino acid sequence
with sequences in the data base. The S. cerevisiae
sequence (HRE230; GenBankTM accession number S51897[GenBank]) is aligned with
other likely related sequences from S. pombe (clone c2c4 at
the Sanger Center), E. coli (sp|P39380 YJII_ECOLI), mouse
(GenBankTM number W65960[GenBank]); and rice (dbj|D15111|RICC0076A). Not
shown aligned is a human sequence ((GenBankTM accession numbers H39778[GenBank],
H43264[GenBank], W23913[GenBank]), which is similar to the others, but has a large insert
and a region of duplicated alignment. Black shadings with white lettering, amino acids which are conserved in the
S. cerevisiae sequence and any of the other ORFs; *,
translation termination signal; -, gaps in the alignment.
[View Larger Version of this Image (72K GIF file)]
DISCUSSION
We have cloned the S. cerevisiae TPT1 gene, which
encodes the 2 -phosphotransferase activity implicated in the last step
of tRNA splicing: removal of the splice junction 2 -phosphate from ligated tRNA. This gene was cloned from the purified protein by reverse
genetics and demonstrated to be authentic by overproduction of the
activity in both yeast and E. coli under regulated promoter control. 2 -Phosphotransferase appears to be a single catalytic polypeptide (Fig. 1, Table III). The purified protein is the
predominant silver-staining band in highly purified preparations, and
the bacterially expressed protein catalyzes the same
NAD-dependent 2 -phosphotransferase reaction in
extracts from E. coli. Since formation of Appr>p is at
least a two-step chemical reaction, this single polypeptide likely
carries out both steps, if both steps are enzyme-catalyzed.
2 -Phosphotransferase is essential for vegetative growth in S. cerevisiae, since a diploid of genotype
tpt1- 1::LEU2/TPT1+ could
not segregate a LEU2 spore unless an exogenous source of phosphotransferase was present on a plasmid, and since the
TPT1-containing plasmid could not then be lost from the
strain (Table IV). Based on its biochemical activity (23-26), the
lethality caused by a lack of phosphotransferase in yeast is due either
to a failure to complete the dephosphorylation step of tRNA splicing or
to the lack of Appr>p in the cell. We favor the former hypothesis. Since all members of each of 10 tRNA gene families have introns in
yeast (1), lack of phosphotransferase ought to lead to the accumulation
of 2 -phosphorylated tRNAs for all members of these gene families.
Presence of the 2 -phosphate 1 base 3 of the anticodon would seem
likely to impair tRNA function at some stage of translation. However,
it is conceivable that lack of Appr>p is also deleterious. To our
knowledge this splicing reaction is the only biochemical pathway
leading to Appr>p formation; if it or its downstream metabolic products has a cellular role, then the failure to make this product might also impair growth. We have recently isolated conditional tpt1 mutants to begin to ascertain the
consequences of a lack of the protein.3 The
cellular role of Appr>p would most easily be addressed by altering its
levels in vivo. We have previously identified a highly specific cyclic
phosphodiesterase that can convert Appr>p or r>p to the corresponding
ribose-1-P derivative in yeast extracts (50), an activity that appears
to be related to a similar activity in wheat germ (50, 51). A cyclic
phosphodiesterase from Arabidopsis with very similar
properties has recently been cloned (52); analysis of its function in
Arabidopsis or of the function of the corresponding gene in
yeast may directly address the question of the role of Appr>p in
cells.
A crude calculation based on the purification (Table I) indicates that
there is on the order of 10 times more phosphotransferase protein in a
yeast cell than there is of the other splicing enzymes: tRNA ligase
protein and endonuclease (34, 53). Endonuclease and ligase may form a
complex in vivo, based on their similar populations within
the cell, their localization in similar subdomains of the nucleus (7,
54), and the concerted splicing reaction observed in vitro
with tRNA precursors (55). If such a complex includes the
phosphotransferase, there is likely an excess of uncomplexed
phosphotransferase. This is consistent with the observation that there
is at least 12 times as much 2 -phosphotransferase activity in cells as
is necessary for normal growth. Since the GAL10 promoter is
tightly repressed by glucose-containing medium, it might be expected
that a tpt1- 1::LEU2 strain with a
PGAL10-TPT1 plasmid would die on glucose.
Unfortunately this is not the case; cells with only a
galactose-regulated TPT1 gene have wild type growth rates
after prolonged growth in glucose. Under these conditions, phosphotransferase activity is down 12-fold from that observed in wild
type cells2; thus there is an excess of phosphotransferase
in the cell.
The high degree of conservation of the S. cerevisiae Tpt1
sequence with sequences from S. pombe, mouse, rice, and
E. coli suggests strongly that these proteins constitute a
family. Given the similarities of sequence, it seems reasonably likely
that the S. pombe ORF, and perhaps the mouse and rice ORFs,
encode functional Tpt1 proteins; these ORFs all share the same regions of conserved sequence with the S. cerevisiae protein (Fig.
5) and similar or more extensive homologies with one another (data not
shown). If so, then the regions of conserved sequence presumably contain the as yet uncharacterized binding and catalytic domains of the
protein. We note that the putative NAD binding site identified by
comparison of the S. cerevisiae sequence to the diphtheria toxin NAD binding site (44) is retained in all the sequences. Further
experiments will be required to define this and the other domains.
In the context of a gene family, the presence of a highly conserved
E. coli ORF is striking. Since E. coli is not
known to splice tRNAs, or to have a ligase like that in yeast that
generates splice junctions with a 2 -phosphate, it seems unlikely that
this protein encodes a tRNA 2 -phosphotransferase. However, the
E. coli ORF might encode a related catalytic or binding
activity. Understanding the function and/or the biochemical activity of the E. coli protein might therefore lead to an understanding
of the origin of the unusual activity catalyzed by the yeast
2 -phosphotransferase.
FOOTNOTES
*
This work was supported by National Institutes of Health
Grant GM-52347 (to E. M. P.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Supported by Oral, Cellular and Molecular Biology Training Grant
T32-DE07202. Present address: Dept. of Biology, 406 Sinsheimer Laboratories, University of California, Santa Cruz, CA 95060.
§
Contributed equally to this work.
¶
Present address: Laboratory of Cellular Metabolism, Bldg. 10, Rm. 5N307, NHLBI, NIH, Bethesda MD 20892.
**
Supported by National Institutes of Health Grant GM 27930 (awarded
to Anita Hopper).

To whom correspondence should be addressed. Tel.: 716-275-7268;
Fax: 716-271-2683; E-mail: ephi{at}bphvax.biophysics.rochester.edu.
1
The abbreviations used are: Appr>p, ADP-ribose
1"-2" cyclic phosphate; r>p, ribose 1,2-cyclic phosphate; ORF, open
reading frame; DTT, dithiothreitol; BSA, bovine serum albumin.
2
S. Spinelli and E. M. Phizicky, unpublished
results.
3
S. Spinelli, S. A. Consaul, and E. M. Phizicky,
unpublished results.
ACKNOWLEDGEMENTS
We thank Brian Vanwuyckhuyse and Lawrence
Tabak for sequencing the Tpt1 protein; Michael Briggs and J. Scott
Butler for the yeast genomic library; Mark Johnston for yeast strains,
Ryszard Kierzek for the gift of the 2 -phosphorylated oligomer
UpUppU; Min-Hao Kuo for valuable computer help; and Anita
Hopper, Elizabeth Grayhack, and Matthew Robinson for valuable
discussions about this work and the manuscript.
REFERENCES
-
Hopper, A. K., and Martin, N. C.
(1993)
in
Molecular and Cellular Biology of the Yeast Saccharomyces: Gene Expression (Jones, E. W., Broach, J. R., and Pringle, J. R., eds), pp. 99-141, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
-
van Tol, H., and Beier, H.
(1988)
Nucleic Acids Res.
16,
1951-1966
[Abstract/Free Full Text]
-
Reyes, V. M., and Abelson, J.
(1988)
Cell
55,
719-730
[CrossRef][Medline]
[Order article via Infotrieve]
-
Mattoccia, E., Baldi, I. M., Gandini-Attardi, D., Ciafre, S., and Tocchini-Valentini, G. P.
(1988)
Cell
55,
731-738
[CrossRef][Medline]
[Order article via Infotrieve]
-
Szekely, E., Belford, H. G., and Greer, C. L.
(1988)
J. Biol. Chem.
263,
13839-13847
[Abstract/Free Full Text]
-
Baldi, M. I., Mattoccia, E., Burfardeci, E., Fabbri, S., and Tocchini-Valentini, G. P.
(1992)
Science
225,
1404-1408
-
Peebles, C. L., Gegenheimer, P., and Abelson, J.
(1983)
Cell
32,
525-536
[CrossRef][Medline]
[Order article via Infotrieve]
-
Gandini Attardi, D., Margarit, I., and Tocchini-Valentini, G. P.
(1985)
EMBO J.
4,
3289-3297
[Medline]
[Order article via Infotrieve]
-
Greer, C. L., Peebles, C. L., Gegenheimer, P., and Abelson, J.
(1983)
Cell
32,
537-546
[CrossRef][Medline]
[Order article via Infotrieve]
-
Westaway, S. K., Belford, H. G., Apostol, B. L., Abelson, J., and Greer, C. L.
(1993)
J. Biol. Chem.
268,
2435-2443
[Abstract/Free Full Text]
-
Belford, H. G., Westaway, S. K., Abelson, J., and Greer, C. L.
(1993)
J. Biol. Chem.
268,
2444-2450
[Abstract/Free Full Text]
-
Konarska, M., Filipowicz, W., Domdey, H., and Gross, H. J.
(1981)
Nature
293,
112-116
[CrossRef][Medline]
[Order article via Infotrieve]
-
Schwartz, R. C., Greer, C. L., Gegenheimer, P., and Abelson, J.
(1983)
J. Biol. Chem.
258,
8374-8383
[Abstract/Free Full Text]
-
Kikuchi, Y., Tyc, K., Filipowicz, W., Sanger, H. L., and Gross, H. J.
(1982)
Nucleic Acids Res.
10,
7521-7529
[Abstract/Free Full Text]
-
Zillman, M., Gorovsky, M. A., and Phizicky, E. M.
(1991)
Mol. Cell. Biol.
11,
5410-5416
[Abstract/Free Full Text]
-
Pick, L., and Hurwitz, J.
(1986)
J. Biol. Chem.
261,
6684-6693
[Abstract/Free Full Text]
-
Pick, L., Furneaux, H., and Hurwitz, J
(1986)
J. Biol. Chem.
261,
6694-6704
[Abstract/Free Full Text]
-
Knapp, G., Ogden, R. C., Peebles, C. L., and Abelson, J.
(1979)
Cell
18,
37-45
[CrossRef][Medline]
[Order article via Infotrieve]
-
Phizicky, E. M., Consaul, S. A., Nehrke, K. W., and Abelson, J.
(1992)
J. Biol. Chem.
267,
4577-4582
[Abstract/Free Full Text]
-
Filipowicz, W., and Shatkin, A. J.
(1983)
Cell
32,
547-557
[CrossRef][Medline]
[Order article via Infotrieve]
-
Laski, F. A., Fire, A. Z., RajBhandary, U. L., and Sharp, P. A.
(1983)
J. Biol. Chem.
258,
11974-11980
[Abstract/Free Full Text]
-
Nishikura, K., and DeRobertis, E. M.
(1981)
J. Mol. Biol.
145,
405-420
[CrossRef][Medline]
[Order article via Infotrieve]
-
Culver, G. M., McCraith, S. M., Zillman, M., Kierzek, R., Michaud, N., LaReau, R. D., Turner, D. H., and Phizicky, E. M.
(1993)
Science
261,
206-208
[Abstract/Free Full Text]
-
McCraith, S. M., and Phizicky, E. M.
(1990)
Mol. Cell. Biol.
10,
1049-1055
[Abstract/Free Full Text]
-
Zillmann, M., Gorovsky, M. A., and Phizicky, E. M.
(1992)
J. Biol. Chem.
267,
10289-10294
[Abstract/Free Full Text]
-
McCraith, S. M., and Phizicky, E. M.
(1991)
J. Biol. Chem.
266,
11986-11992
[Abstract/Free Full Text]
-
Reyes, V. M., and Abelson, J.
(1987)
Anal. Biochem.
166,
90-106
[CrossRef][Medline]
[Order article via Infotrieve]
-
Robinson, M. K., van Zyl, W. H., Phizicky, E. M., and Broach, J. R.
(1994)
Mol. Cell. Biol.
14,
3634-3645
[Abstract/Free Full Text]
-
Sherman, F.
(1991)
Methods Enzymol.
194,
3-21
[CrossRef][Medline]
[Order article via Infotrieve]
-
Boeke, J. D., La Croute, F., and Fink, G. R.
(1984)
Mol. & Gen. Genet.
197,
345-346
-
Geitz, R. D., and Sugino, A.
(1988)
Gene (Amst.)
74,
527-534
[CrossRef][Medline]
[Order article via Infotrieve]
-
Briggs, M. W., and Butler, J. S.
(1996)
Genetics
143,
1149-1161
[Abstract]
-
Sambrook, J., Fritsch, E. F., and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual, 2nd Ed., pp. 318-328, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
-
Phizicky, E. M., Schwartz, R. C., and Abelson, J.
(1986)
J. Biol. Chem.
261,
2978-2986
[Abstract/Free Full Text]
-
Marhall, T.
(1984)
Anal. Biochem.
136,
340-346
[CrossRef][Medline]
[Order article via Infotrieve]
-
Matsudaira, P.
(1987)
J. Biol. Chem.
262,
10035-10038
[Abstract/Free Full Text]
-
Kierzek, R.
(1994)
Nucleosides Nucleotides
13,
1757-1768
-
Burd, C. G., and Dreyfuss, G.
(1994)
Science
265,
615-621
[Abstract/Free Full Text]
-
Kisselev, L. L.
(1993)
Biochemie
75,
1027-1039
[Medline]
[Order article via Infotrieve]
-
Hountondji, C., Dessen, P., and Blanquet, S.
(1993)
Biochemie (Paris)
75,
1137-1142
-
Cussack, S.
(1993)
Biochemie (Paris)
75,
1077-1081
-
Rould, M. A., Soll, J. J. D., and Steitz, T. A.
(1989)
Science
246,
1135-1142
[Abstract/Free Full Text]
-
Ruff, M., Krishnaswamy, S., Boeglin, M., Poterszman, A., Mitschler, A., Podjarny, A., Ress, B., Thierry, J. C., and Moras, D.
(1991)
Science
252,
1682-1689
[Abstract/Free Full Text]
-
Bell, C. E., and Eisenberg, D.
(1996)
Biochemistry
35,
1137-1147
[CrossRef][Medline]
[Order article via Infotrieve]
-
Rossman, M. G., Moras, D., and Olsen, K. W.
(1974)
Nature
250,
194-199
[CrossRef][Medline]
[Order article via Infotrieve]
-
Wierenga, R. K., De Mayer, M. C. H., and Hol, W. G. J.
(1985)
Biochemistry
24,
1346-1357
[CrossRef]
-
Scrutton, N. S., Berry, A., and Perham, R. N.
(1990)
Nature
343,
38-43
[CrossRef][Medline]
[Order article via Infotrieve]
-
Uchida, K., and Miwa, M.
(1994)
Mol. Cell. Biochem.
138,
25-32
[CrossRef][Medline]
[Order article via Infotrieve]
-
Jonsson, Z. O., Thorbjarnardottir, S. H., Eggertsson, G., and Palsdottir, A.
(1994)
Gene (Amst.)
151,
177-180
[CrossRef][Medline]
[Order article via Infotrieve]
-
Culver, G. M., Consaul, S. A., Tycowski, K. T., Filipowicz, W., and Phizicky, E. M.
(1994)
J. Biol. Chem.
269,
24928-24934
[Abstract/Free Full Text]
-
Tyc, K., Kellenberger, C., and Filipowicz, W.
(1987)
J. Biol. Chem.
262,
12994-13000
[Abstract/Free Full Text]
-
Genschik, P., Hall, J., and Filipowicz, W.
(1997)
J. Biol. Chem.
272,
13211-13219
[Abstract/Free Full Text]
-
Rauhut, R., Green, P. R., and Abelson, J.
(1990)
J. Biol. Chem.
265,
18180-18184
[Abstract/Free Full Text]
-
Clark, M. W., and Abelson, J.
(1987)
J. Cell Biol.
105,
1515-1526
[Abstract/Free Full Text]
-
Greer, C. L.
(1986)
Mol. Cell. Biol.
6,
636-644
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
H. P. Harding, J. G. Lackey, H.-C. Hsu, Y. Zhang, J. Deng, R.-M. Xu, M. J. Damha, and D. Ron
An intact unfolded protein response in Trpt1 knockout mice reveals phylogenic divergence in pathways for RNA ligation
RNA,
February 1, 2008;
14(2):
225 - 232.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Yoshihisa, C. Ohshima, K. Yunoki-Esaki, and T. Endo
Cytoplasmic splicing of tRNA in Saccharomyces cerevisiae
Genes Cells,
March 1, 2007;
12(3):
285 - 297.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. H. Back, K. Lee, E. Vink, and R. J. Kaufman
Cytoplasmic IRE1{alpha}-mediated XBP1 mRNA Splicing in the Absence of Nuclear Processing and Endoplasmic Reticulum Stress
J. Biol. Chem.,
July 7, 2006;
281(27):
18691 - 18706.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. H. Shaheen and A. K. Hopper
From the Cover: Retrograde movement of tRNAs from the cytoplasm to the nucleus in Saccharomyces cerevisiae
PNAS,
August 9, 2005;
102(32):
11290 - 11295.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. P. Shull, S. L. Spinelli, and E. M. Phizicky
A highly specific phosphatase that acts on ADP-ribose 1''-phosphate, a metabolite of tRNA splicing in Saccharomyces cerevisiae
Nucleic Acids Res.,
January 31, 2005;
33(2):
650 - 660.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. STEIGER, J. E. JACKMAN, and E. M. PHIZICKY
Analysis of 2'-phosphotransferase (Tpt1p) from Saccharomyces cerevisiae: Evidence for a conserved two-step reaction mechanism
RNA,
January 1, 2005;
11(1):
99 - 106.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. SAWAYA, B. SCHWER, and S. SHUMAN
Structure-function analysis of the yeast NAD+-dependent tRNA 2'-phosphotransferase Tpt1
RNA,
January 1, 2005;
11(1):
107 - 113.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Schwer, R. Sawaya, C. K. Ho, and S. Shuman
Portability and fidelity of RNA-repair systems
PNAS,
March 2, 2004;
101(9):
2788 - 2793.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Sawaya, B. Schwer, and S. Shuman
Genetic and Biochemical Analysis of the Functional Domains of Yeast tRNA Ligase
J. Biol. Chem.,
November 7, 2003;
278(45):
43928 - 43938.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Yoshihisa, K. Yunoki-Esaki, C. Ohshima, N. Tanaka, and T. Endo
Possibility of Cytoplasmic pre-tRNA Splicing: the Yeast tRNA Splicing Endonuclease Mainly Localizes on the Mitochondria
Mol. Biol. Cell,
August 1, 2003;
14(8):
3266 - 3279.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. K. Hopper and E. M. Phizicky
tRNA transfers to the limelight
Genes & Dev.,
January 15, 2003;
17(2):
162 - 180.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Kufel, C. Allmang, L. Verdone, J. D. Beggs, and D. Tollervey
Lsm Proteins Are Required for Normal Processing of Pre-tRNAs and Their Efficient Association with La-Homologous Protein Lhp1p
Mol. Cell. Biol.,
July 15, 2002;
22(14):
5248 - 5256.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Nasr and W. Filipowicz
Characterization of the Saccharomyces cerevisiae cyclic nucleotide phosphodiesterase involved in the metabolism of ADP-ribose 1'',2''-cyclic phosphate
Nucleic Acids Res.,
April 15, 2000;
28(8):
1676 - 1683.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. R. Martzen, S. M. McCraith, S. L. Spinelli, F. M. Torres, S. Fields, E. J. Grayhack, and E. M. Phizicky
A Biochemical Genomics Approach for Identifying Genes by the Activity of Their Products
Science,
November 5, 1999;
286(5442):
1153 - 1155.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
S. L. Spinelli, R. Kierzek, D. H. Turner, and E. M. Phizicky
Transient ADP-ribosylation of a 2'-Phosphate Implicated in Its Removal from Ligated tRNA during Splicing in Yeast
J. Biol. Chem.,
January 29, 1999;
274(5):
2637 - 2644.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. L. Spinelli, H. S. Malik, S. A. Consaul, and E. M. Phizicky
A functional homolog of a yeast tRNA splicing enzyme is conserved in higher eukaryotes and in Escherichia coli
PNAS,
November 24, 1998;
95(24):
14136 - 14141.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Abelson, C. R. Trotta, and H. Li
tRNA Splicing
J. Biol. Chem.,
May 22, 1998;
273(21):
12685 - 12688.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Genschik, J. Hall, and W. Filipowicz
Cloning and Characterization of the Arabidopsis Cyclic Phosphodiesterase Which Hydrolyzes ADP-ribose 1",2"-Cyclic Phosphate and Nucleoside 2',3'-Cyclic Phosphates
J. Biol. Chem.,
May 16, 1997;
272(20):
13211 - 13219.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Nakai, M. Nakai, H. Hayashi, and H. Kagamiyama
Nuclear Localization of Yeast Nfs1p Is Required for Cell Survival
J. Biol. Chem.,
March 9, 2001;
276(11):
8314 - 8320.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|