JBC PeproTech; Our Business is Cytokines!

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Culver, G. M.
Right arrow Articles by Phizicky, E. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Culver, G. M.
Right arrow Articles by Phizicky, E. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


Volume 272, Number 20, Issue of May 16, 1997 pp. 13203-13210
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

A 2'-Phosphotransferase Implicated in tRNA Splicing Is Essential in Saccharomyces cerevisiae*

(Received for publication, November 7, 1996, and in revised form, January 27, 1997)

Gloria M. Culver Dagger §, Stephen M. McCraith §, Sandra A. Consaul , David R. Stanford par ** and Eric M. Phizicky Dagger Dagger

From the Department of Biochemistry and Biophysics, University of Rochester School of Medicine, Rochester, New York 14642 and the par  Department of Biological Chemistry, Milton S. Hershey Medical Center, Pennsylvania State University, Hershey, Pennsylvania 17033

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

The last step of tRNA splicing in the yeast Saccharomyces cerevisiae is catalyzed by an NAD-dependent 2'-phosphotransferase, which transfers the splice junction 2'-phosphate from ligated tRNA to NAD to produce ADP-ribose 1"-2" cyclic phosphate. We have purified the phosphotransferase about 28,000-fold from yeast extracts and cloned its structural gene by reverse genetics. Expression of this gene (TPT1) in yeast or in Escherichia coli results in overproduction of 2'-phosphotransferase activity in extracts. Tpt1 protein is essential for vegetative growth in yeast, as demonstrated by gene disruption experiments. No obvious binding motifs are found within the protein. Several candidate homologs in other organisms are identified by searches of the data base, the strongest of which is in Schizosaccharomyces pombe.


INTRODUCTION

tRNA splicing is essential in both the yeast Saccharomyces cerevisiae and humans, since both organisms contain tRNA gene families whose members all contain intervening sequences. Yeast has 10 such intron-containing tRNA gene families (of the approximately 45 total tRNA gene families) (see Ref. 1 for review), and humans have at least one intron-containing tRNA gene family (2). Since all known eukaryotic nuclear-encoded tRNATyr genes contain introns, it is likely that tRNA splicing is essential in all eukaryotes for processing of tRNA genes.

tRNA introns are invariably located 1 base 3' of the anticodon, and this location is critical for the the first step of splicing. In both Xenopus and yeast the endonuclease binds the mature domain of the precursor tRNA, measures the length of the anticodon stem to locate the intron (3, 4), and excises it if the structure at the 3' splice site is correct (5, 6). The products of the reaction are exons bearing 2'-3' cyclic phosphates and 5'-hydroxyl groups at their ends, as shown in Fig. 1 (7, 8).


Fig. 1. tRNA splicing in yeast. A schematic representation of tRNA splicing is shown.
[View Larger Version of this Image (13K GIF file)]

Joining of the exons involves a ligase that generates a mature sized tRNA bearing a splice junction 2'-phosphate (9). The ligase from yeast catalyzes four distinct chemical steps to effect ligation: the 2'-3' cyclic phosphate at the end of the 5' exon is opened to a 2'-phosphate by a cyclic phosphodiesterase activity; the 5'-OH at the beginning of the 3' exon is phosphorylated by a polynucleotide kinase activity in the presence of GTP; the 5'-phosphate is activated by adenylylation from ATP; and then ligation occurs with loss of the adenylate moiety (9-11). The result of ligation is a mature sized tRNA bearing a splice junction 2'-phosphate (see Fig. 1). A ligase present in wheat germ (12, 13), Chlamydomonas (14), and humans (15) also generates splice junctions with a 2'-phosphate, and the wheat germ protein is very similar in catalytic activities to the yeast enzyme (16, 17). Since removal of the 2'-terminal phosphate prevents the yeast ligase from working in vitro (10, 18), the 2'-phosphate is likely formed at the splice junction when this ligase acts in vivo. The yeast ligase is known to be responsible for tRNA splicing in yeast, since conditional ligase mutants accumulate unligated tRNA exons under nonpermissive conditions (19). However, a second ligase, which uses a completely different chemical reaction and does not generate a splice junction 2'-phosphate, has been implicated in tRNA splicing in humans in vitro (20, 21) and in Xenopus oocytes in vivo (22).

Removal of the splice junction 2'-phosphate occurs by a highly unusual reaction: a 2'-phosphotransferase transfers the splice junction phosphate to NAD, forming the novel NAD derivative, ADP-ribose 1"-2" cyclic phosphate (Appr>p)1 (23). Two lines of evidence support the claim that the yeast enzyme catalyzes this step in the cell (24, 25). First, the phosphotransferase is highly specific for substrates bearing an internal 2'-phosphate; an oligonucleotide bearing an internal 2'-phosphate is efficiently dephosphorylated, whereas oligonucleotides terminating with 5'-, 3'-, 2'-, or 2'-3' cyclic phosphates are not detectably dephosphorylated. Second, this is the only activity detected in crude extracts that can efficiently remove the 2'-phosphate from ligated tRNA. A similar 2'-phosphotransferase has been described in HeLa cell extracts; like the yeast enzyme the HeLa enzyme is highly specific for substrates with internal 2'-phosphates and is the only activity that can efficiently dephosphorylate 2'-phosphorylated ligated tRNA (25). Moreover, it is likely that the phosphotransferase can act in vivo on tRNA substrates: Xenopus oocytes injected with 2'-phosphorylated ligated tRNA catalyze formation of Appr>p concomitant with dephosphorylation (23).

To begin to study the role of the phosphotransferase in yeast, we have purified the protein and cloned its structural gene (TPT1; tRNA 2'-phosphotransferase). Phosphotransferase was purified ~28,000-fold, the N-terminal amino acid sequence was determined, and the appropriate DNA was isolated by colony hybridization of a yeast genomic library. The identified ORF was expressed in Escherichia coli and shown to catalyze 2'-phosphotransferase activity, implying that phosphotransferase is a single catalytic polypeptide. 2'-Phosphotransferase is essential for vegetative growth in yeast, as demonstrated by analysis of strains with chromosomal deletions in the TPT1 gene. The sequence of the phosphotransferase does not reveal any obvious binding or catalytic motifs. Several significantly similar ORFs are identified by searches of the data base, including a particularly strong one in Schizosaccharomyces pombe.


EXPERIMENTAL PROCEDURES

Preparation of Ligated tRNA

Ligated tRNAPhe with a 32P-labeled splice junction 2'-phosphate was prepared by in vitro endonucleolytic cleavage and ligation (with partially purified enzymes) of an [alpha -32P]ATP-labeled pre-tRNAPhe transcript (26). The 32P-labeled pre-tRNAPhe transcript (340 Ci/mmol) was derived from T7 RNA polymerase transcription of a plasmid-borne copy of the end-matured pre-tRNAPhe gene (27).

2'-Phosphotransferase Assay

Transfer of the 2'-phosphate from ligated tRNA to NAD to form Appr>p was performed as described by McCraith and Phizicky (26) in 10 µl reaction mixtures in phosphotransferase buffer (20 mM Tris-HCl, pH 7.5, 5 mM MgCl2, 2.5 mM spermidine, 0.1 mM DTT, and 0.4% Triton X-100) containing 1-4 fmol of ligated tRNA, 1 mM NAD, and 1 µl of 2'-phosphotransferase diluted in Buffer B containing 100 µg/ml BSA. Reaction mixtures were incubated at 30 °C for 20 min and applied to polyethyleneimine-cellulose plates that were developed in 2 M sodium formate, pH 3.6, to separate Appr>p from the tRNA (26). One unit of activity corresponds to the amount of phosphotransferase required to transfer 50% of the 2'-phosphate from 1 fmol of ligated tRNA to NAD in 20 min, determined by serial dilution.

Yeast Strains

Yeast strains YM4126 (SC724) (MATa, ura 3-52, his 3Delta 200, ade2-101, lys2-801 leu2-3, 112, trp1-903 GAL+), YM4127 (SC725) (MATa, ura3-52, his3-Delta 200, ade2-101, lys2-801, leu2-3, 112, trp1-903 tyr1-501 GAL+), YM4128 (SC726) (MATalpha , ura3-52, his3-Delta 200, ade2-101, lys2-801 leu2-3, 112, trp1-903 GAL+), and YM4129 (SC727) (MATalpha , ura3-52, his3-Delta 200, ade2-101, lys2-801, leu2-3, 112, trp1-903 tyr1-501 GAL+) were obtained from Mark Johnston (Department of Genetics, Washington University Medical School, St. Louis, MO). YM4126 was crossed with YM4129 to create the diploid SC759 (picked from the zygotes), and YM4127 was crossed withYM4128 to create the diploid SC758. SC804 (TPT1+/tpt1-Delta 1) was derived from SC759 by one-step gene replacement with pGMC22 (tpt1-Delta 1::LEU2), and SC805 (TPT1+/tpt1-Delta 2) was derived from SC758 by one-step gene replacement with pGMC17 (tpt1-Delta 2::LEU2). SC466 (MATalpha , ura3-52, leu2-3, 112, his3-Delta 200 lys2-801) was described previously (28), and JHRY-20-2Ca (Mata, his3-Delta 200, leu2-3, 112, ura 3-52, pep4::URA3) was obtained from Tom Stevens (Institute of Molecular Biology, University of Oregon, Eugene, OR).

Growth of Yeast

YP medium contains 1% yeast extract and 2% peptone, minimal medium is described by Sherman (29), and 5-fluoroorotic acid medium is described by Boeke et al. (30). Strain JHRY-20-2Ca was grown in a 100-liter fermentor (New Brunswick model IF130) at 30 °C to an A600 of 4 in YP medium containing 2% glucose, 0.083 µg/ml streptomycin, 0.033 µg/ml penicillin, 0.5% ethanol, and 0.17% polyethylene glycol, and cells were chilled with ice and harvested in a Westfalia Clarifier (Centrico Inc., Northvale, NJ). To measure phosphotransferase expression, strain JHRY-20-2Ca transformed with either the 2µ LEU2 vector yEPlac181 or with pGMC5 (yEPlac181 TPT1+) was grown at 30 °C in minimal medium lacking leucine to A600 = 0.45. SC466 transformed with either the GAL10 promoter vector pBM150 (CEN URA3 PGAL10) or with pGMC21 (pBM150 PGAL10-TPT1) was grown overnight in minimal medium containing 2% raffinose and lacking uracil, and cells were inoculated directly into 75-ml cultures of YP + 2% galactose or YP + 2% glucose and grown for 2.5 generations. Cells were harvested, washed, resuspended, and made into extracts as described below for the purification of phosphotransferase.

Plasmids and DNA Manipulations

The vectors yCPlac33, yEPlac195, and yEPlac 181 were constructed by Geitz and Sugino (31). The TPT1 gene was isolated by E. coli colony hybridization of a yeast genomic library (32), essentially as described by Sambrook et al. (33), using the 5' 32P-oligomer CCGCTGTATGTCGAAGCAGATATG (an antisense oligomer corresponding to nucleotides 79-56 of Fig. 4A), as a probe. Large fragments encompassing the TPT1 gene (see Fig. 4B) from the isolated plasmid (pEMP981) were ligated into the multicloning sites of the URA3 CEN vector yCPlac33 to construct pGMC1 (EcoRI-SacI fragment), the URA3 2-µm vector yEPlac195 to construct pGMC4 (EcoRI-PstI fragment), the LEU2 2-µm vector yEPlac181 to construct pGMC5 (EcoRI-PstI fragment), and pSP72 vector to construct pGMC7 (EcoRI-HpaI fragment of EMP981 ligated into the EcoRI and PvuII vector fragment).


Fig. 4. A, predicted amino acid sequence of the Tpt1 protein. The sequence was obtained from the Saccharomyces cerevisiae genome data base (HRE230 accession number S51897[GenBank]) and independently confirmed. B, restriction map of the TPT1 gene and surrounding region on chromosome XV. The TPT1 ORF and neighboring ORFs are represented by heavy arrows in the direction in which they are transcribed. Restriction sites within and around the TPT1 gene, which were used for plasmid constructions, are represented by light vertical lines. The positions of the oligonucleotides used for polymerase chain reaction amplification of the TPT1 ORF (dP-1 and dP-2) and of the tpt1 deletions are indicated. All restriction sites shown are unique within the fragment represented, and the map is drawn approximately to scale, indicated at the top left. P, PstI; Hp, HpaI; S, SacI; H, HindIII; A, AflII; R, EcoRI.
[View Larger Version of this Image (28K GIF file)]

Disruptions of the TPT1 gene were generated by insertion of a LEU2 HindIII fragment (obtained from a polylinker-inserted LEU2 SspI chromosomal fragment, modified to contain HindIII ends) into one of two positions within the TPT1 gene, as illustrated in Fig. 4B: to replace the HindIII fragment of 226 nucleotides around the ATG translation start of pGMC7, generating pGMC22 (tpt1-Delta 1::LEU2), or to replace the 744 base pair HindIII-AflII fragment of pGMC7, after filling in the AflII end and adding a HindIII linker, generating pGMC17 (tpt1-Delta 2::LEU2).

pGMC10 contains the TPT1 ORF bounded by engineered EcoRI sites, ligated into pSP72. It was generated by polymerase chain reaction amplification of the TPT1 gene from the ATG of the ORF to a site 240 nucleotides downstream of the TAA termination codon (see Fig. 4B), using Taq polymerase and primers dP-1 (AGAGGAATTCACAGGTGGCCGAAGGTGCTGCC) and dP-2 (GACGAATTCATGCGCCAGGTACTACAAAAAG), followed by EcoRI digestion, ligation into the vector, and sequencing of transformants to identify an otherwise unaltered gene. The EcoRI fragment of pGMC10 was inserted into pBM150 (34) to place the TPT1 gene under control of the yeast GAL10 promoter (pGMC21) and into pKK223-3 (34) to place the TPT1 gene under control of the E. coli tac promoter (pGMC9).

Expression of Tpt1 Protein in E. coli

E. coli strain RZ510 (relevant genotype lac iSQ) was transformed with pKK223-3 vector or with pGMC9 to express the TPT1 gene. 50-ml cultures were grown at 37 °C in L broth to an A600 of 0.8, induced with 1 mM isopropyl-beta -D-thiogalactopyranoside for 1 h, and cells were harvested, resuspended in 2 ml of buffer containing 50 mM Tris 7.5, 1 mM EDTA, 450 mM NaCl, 5 mM DTT, and 10% glycerol, and sonicated on ice in 10 s bursts for 1 min. Extracts obtained after centrifugation (12.5 mg/ml) were aliquoted, frozen, and thawed to measure phosphotransferase activity.

Protein Concentration and Visualization

Protein concentration was determined using Bradford reagent (Bio-Rad). Polypeptides were visualized after SDS-polyacrylamide gel electrophoresis by silver staining, as described (35).

Purification of 2'-Phosphotransferase

2.5 kg (wet weight) of frozen yeast were thawed, washed with 5 liters of Wash Buffer (0.1 M Tris-HCl, pH 7.5, and 10 mM DTT), resuspended in 1.25 liters of lysis buffer (20 mM Tris, pH 7.5, 2 mM EDTA, 10 mM DTT, 10% (v/v) glycerol, 1 M NaCl, 1.7 mM phenylmethylsulfonyl fluoride, 1.2 µg/ml leupeptin, and 1.2 µg/ml pepstatin A), and lysed with 0.5-mm glass beads using a Bead-Beater, as described by McCraith and Phizicky (24). Crude extract was obtained by passing the mixture through a coarse sintered glass funnel, followed by centrifugation at 13,000 × g for 40 min.

Protein was precipitated by the addition of solid ammonium sulfate to 80% saturation, followed by centrifugation at 14,700 × g for 45 min. The protein pellet was washed with 2 liters of Buffer A (20 mM Tris-HCl, pH 7.5, 1 mM EDTA, pH 8.0, 200 mM NaCl, 1 mM DTT, and 10% (v/v) glycerol) containing 59% saturated ammonium sulfate, and 2'-phosphotransferase activity was recovered by two successive extractions of the 59% pellet with 2 liters of Buffer A containing 46% saturated ammonium sulfate, followed by centrifugation to remove the pellet. Protein in the combined supernatants was reprecipitated by the addition of solid ammonium sulfate (to 80% saturation) and centrifugation, and the pellet was resuspended in 500 ml of Buffer B (20 mM Tris, pH 7.5, 2 mM EDTA, 4 mM MgCl2, 1 mM DTT, and 10% (v/v) glycerol) containing 350 mM NaCl, and dialyzed overnight against 20 liters of this buffer. Dialyzed protein was applied to a 250 ml blue Sepharose CL-6B column (Pharmacia Biotech Inc.) equilibrated in the same buffer, washed, and active fractions (700 ml) flowed through the column. These fractions were pooled, diluted 2-fold with Buffer B lacking NaCl, reapplied to the blue Sepharose column equilibrated with Buffer B containing 0.175 M NaCl, and retained protein was eluted with a 2-liter linear gradient of Buffer B from 0.175 to 2 M NaCl. 2'-Phosphotransferase eluted at 450-500 mM NaCl.

Active fractions (350 ml) from the blue Sepharose column were dialyzed against Buffer B containing 40 mM NaCl, applied to a 250-ml heparin-Sepharose column, and activity was eluted with a gradient of Buffer B containing 40-900 mM NaCl. Active fractions (25 ml) were loaded directly onto a 15-ml hydroxylapaptite column (DNA grade Bio-Gel HTP, Bio-Rad) equilibrated in Buffer C (20 mM Tris, pH 7.5, 0.5 mM EDTA, 1 mM MgCl2, 10% (v/v) glycerol, 1 mM beta -mercaptoethanol, and 50 mM NaCl), and phosphotransferase activity was eluted with a linear gradient of Buffer C containing 0-0.25 M K2HPO4 (pH 7.5 with phosphoric acid). Peak fractions from the hydroxylapatite column (8 ml) were dialyzed against Buffer B containing 40 mM NaCl and 20% glycerol, applied to a 0.5-ml orange A Sepharose column (Amicon Division, W. R. Grace & Co., Beverly, MA), and 2'-phosphotransferase was eluted with a gradient of Buffer B from 40 to 700 mM NaCl. Active fractions, (250 µl each), were dialyzed individually against Buffer B containing 50% (v/v) glycerol and 55 mM NaCl and subsequently stored at -20 °C. Little loss of activity was observed over 3 months.

A streamlined purification yielded material that was about 4-fold less pure. Crude extracts were dialyzed against Buffer B containing 0.15 M NaCl, loaded directly on a 500-ml blue Sepharose column, and retained protein was eluted with a 2.5-liter gradient of Buffer B containing 150 mM to 1.5 M NaCl. Active fractions (which elute at higher salt concentration (0.6 M) than in the preparation above) were then subjected to chromatography on heparin-agarose, hydroxylapatite, and orange A Sepharose as described above.

Protein Sequencing

100-200 pmol of purified phosphotransferase was resolved on a 12% SDS-polyacrylamide gel, transferred electrophoretically to polyvinylidene difluoride membranes, stained with Coomassie Blue R-250, destained, and used for sequencing essentially as described by Matsudaira (36). Transfer was done in a Bio-Rad transblot apparatus at room temperature for 4 h at 0.65 mA/square cm or 300 mA in transfer buffer containing 39 mM glycine, 48 mM Tris base, and 20% methanol.

UV Cross-linking of tRNA to Phosphotransferase Fractions

RNA-protein cross-linking reactions were assembled in 15 µl of phosphotransferase assay buffer containing 200 µg/ml BSA, 180,000 cpm of spliced tRNA, 750 units (approximately 5 ng) of 2'-phosphotransferase from the orange A column peak, 5 mM AMP, and no NAD. Reaction mixtures were preincubated for 15 min at 30 °C, and proteins were cross-linked to RNA for 10 min at room temperature, using a UV source at 254 nm (UV-C Bleit 155 lamp, Spectronics Corp., Westbury, NY) with an intensity of 2 milliwatts/cm2. Samples were supplemented with 55 µl of 10 mM Tris, pH 7.5, and digested with 7.5 units of ribonuclease T1 at 50 °C for 45 min. Proteins were precipitated at -20 °C by the addition of trichloroacetic acid to 10%, followed by centrifugation to pellet the protein, washing with ice cold acetone, resuspension in SDS-polyacrylamide gel electrophoresis loading buffer, boiling for 15 min, and electrophoresis on a 12% SDS-polyacrylamide gel.


RESULTS

Purification of 2'-Phosphotransferase Implicates a 30-kDa Polypeptide

The purification of 2'-phosphotransferase yields a prominent polypeptide of 30 kDa, which comigrates with activity. This is illustrated in Fig. 2, in which fractions from the final purification step were analyzed for both polypeptides and phosphotransferase activity. The amount of 30-kDa polypeptide closely parallels phosphotransferase activity in different fractions, both across the final orange A column (compare fractions 20-36 in Figs. 2, A and B) and in the peak fractions from the heparin-agarose and hydroxylapatite columns of the purification (Fig. 2A). Three other minor polypeptides are visible in this preparation of 2'-phosphotransferase activity, with apparent molecular masses of 52, 45, and 20 kDa. Neither of the chromatographic profiles of the 52-kDa or the 45-kDa polypeptides corresponds to the observed activity peak from the orange A column (Fig. 2); however, the profile of the 20-kDa polypeptide does appear to correspond to the observed activity peak from this column. The same 30-kDa polypeptide, but not the 20-kDa polypeptide, also copurifies with activity using a streamlined purification procedure (see "Experimental Procedures"), and if the material from the penultimate step of this streamlined procedure is chromatographed on DEAE or on another heparin-agarose column (with isocratic elution) instead of the orange A column. Thus it seemed likely that the 30-kDa polypeptide is the limiting component responsible for 2'-phosphotransferase activity.


Fig. 2. Purification of yeast 2'-phosphotransferase. A, SDS-polyacrylamide gel electrophoresis of polypeptides present in representative fractions from the purification, visualized by silver staining. Blue Sepharose number 2 peak (Blue 2), 64 µg, 21,650 units; heparin-agarose peak, 5 µg, 15,000 units; Bio-Gel-HTP hydroxylapatite peak, 1.8 µg, 40,000 units; fractions 17-36, 5 µl each of the orange A Sepharose column fractions, as indicated (fraction 26, 40,000 units, 0.4 µg); Prep 1, peak fraction (1 × 107 units/mg) from an earlier purification, omitting the first blue Sepharose column and the hydroxylapatite column. Size markers are indicated on the right. B, orange A Sepharose column profile. Fractions from the orange A column were individually assayed for phosphotransferase activity (filled circles) and for protein (open circles), as described under "Experimental Procedures."
[View Larger Version of this Image (46K GIF file)]

The 30-kDa Protein Cross-links to Spliced tRNA

The suggestion that the 30-kDa polypeptide is a component of the phosphotransferase is supported by the observation that it can be cross-linked to its substrate. As shown in Fig. 3, ligated tRNA bearing a 2'-phosphate, prepared from [alpha -32P]ATP-labeled pre-tRNA transcript, is cross-linked to a polypeptide of 30 kDa (band B1) from the peak orange A fraction, as visualized after RNase T1 treatment of the sample and subsequent electrophoresis through an SDS-polyacrylamide gel. This cross-linking requires both phosphotransferase and UV illumination. No UV-dependent cross-linking is observed to BSA, which was deliberately present at a 600-fold higher concentration than 2'-phosphotransferase and to the contaminating 52- and 45-kDa polypeptides. A band migrating at around 20 kDa (band B2) was present in all lanes, and thus represents an RNase T1-resistant background. Based on the apparent molecular mass of the cross-linked polypeptide (band B1), we conclude that the 30-kDa polypeptide comigrating with activity in the purification is the cross-linked protein. Separate experiments with less purified fractions demonstrate that the interaction of the 30-kDa polypeptide with tRNA is specific: cross-linking occurs with ligated tRNA bearing a 2'-phosphate, but not with dephosphorylated ligated tRNA (data not shown). Furthermore, cross-linking is inhibited by an excess of unlabeled synthetic substrate (UppU, which contains a 2'-phosphate) (23, 37) at a concentration of 50 µM, but is not inhibited by the corresponding nonsubstrate (UpU) at a concentration of 10 mM (data not shown). Since the same size polypeptide copurifies with activity and cross-links to tRNA substrate, it is likely that this is one of the components of the phosphotransferase. Since, in addition there is reasonably good yield at each step of the purification (see Table I), and there is only one major copurifying polypeptide, it is likely that this polypeptide is the only catalytic subunit of the phosphotransferase. This conclusion is substantiated further below.


Fig. 3. UV cross-linking of 2'-phosphotransferase to ligated tRNA. 750 units of highly purified 2'-phosphotransferase from the orange A column peak (lanes a and b) or appropriately diluted buffer (lanes c and d) was incubated with 180,000 cpm of alpha -32P-labeled-spliced tRNA in phosphotransferase buffer containing 200 µg/ml BSA and no NAD, illuminated with 254-nm light, and cross-linked proteins were detected after RNase T1 digestion by electrophoresis on an SDS-polyacrylamide gel, as described under "Experimental Procedures." B1, the major cross-linked species observed with phosphotransferase, migrating as a doublet; B2, a background RNase T1-resistant UV-independent band observed in all lanes.
[View Larger Version of this Image (32K GIF file)]

Table I. Purification of yeast 2'-phosphotransferase protein


Fraction Volume Activity Protein Specific activity Fold purification, step (overall) Yield, step (overall)

ml units mg units/mg %
Extract 1820 6.7  × 108 136,000 4.9  × 103
46-59% (NH4)2SO4 1040 3.5  × 108 17,300 2.0  × 104 4.1  (4.1) 52
Blue Sepharose #1 1400 2.4  × 108 9,800 2.4  × 104 1.2  (4.9) 69  (36)
Blue Sepharose #2 35 4.2  × 107 123 3.4  × 105 14  (69) 17  (6.3)
Heparin Agarose 25 6.6  × 107 21.8 3.0  × 106 8.9  (620) 160  (9.9)
Bio-Gel-HTP 8.2 2.6  × 107 1.17 2.2  × 107 7.3  (4500) 39  (3.9)
Orange A Sepahrose 1.1 1.1  × 107 0.080 1.4  × 108 6.2  (28,000) 42  (1.6)

Isolation of the Phosphotransferase Gene

To clone the structural gene for the phosphotransferase, we sequenced the N-terminal end of the 30-kDa protein in the final orange A column, after transfer of the polypeptides to polyvinylidene difluoride paper and excision of the appropriate region. We obtained 14 amino acids of N-terminal sequence. The same sequence was also obtained from two other experiments with equivalent, but less pure, material obtained from the streamlined purification procedure, which contained slightly different contaminants. Furthermore, the yield of amino acids obtained from the initial steps of the sequencing run corresponded roughly to the number of moles of 30-kDa polypeptide subjected to sequencing. Thus, we were likely sequencing the major polypeptide present at 30 kDa and not a minor contaminant.

The 2'-phosphotransferase gene (TPT1) was isolated by reverse genetics. The sequence of 14 amino acids was compared with the information in the yeast data base, and a single perfect match was found at the N-terminal end of an ORF of 26.2 kDa, located on chromosome XV. The sequence of this ORF is shown in Fig. 4A. No other near matches were found in the yeast data base. An oligonucleotide probe was designed from the data base DNA sequence, and this probe was used to isolate the gene from a yeast genomic library by colony hybridization, as described under "Experimental Procedures." A schematic of a portion of chromosome XV that was isolated is illustrated in Fig. 4B, showing the position of the TPT1 ORF and neighboring ORFs. Plasmids containing the phosphotransferase gene, constructed as described under "Experimental Procedures," were then used to confirm that the gene encodes 2'-phosphotransferase.

TPT1 Encodes the 2'-Phosphotransferase

Overproduction of Tpt1 protein in yeast results in overproduction of 2'-phosphotransferase activity. This was established in two experiments, which are summarized in Table II. First, high gene dosage results in overproduction of activity. Extracts made from a strain bearing a high copy plasmid containing the gene and its regulatory regions (2-µm TPT1) have about 55-fold more phosphotransferase activity than extracts from the same strain bearing the plasmid vector alone (Table II). Second, placing the open reading frame under control of a regulatable promoter in yeast results in regulated overproduction of the phosphotransferase activity. To this end, a plasmid was constructed with the TPT1 open reading frame immediately downstream of the GAL10 promoter and transcription start site, as described under "Experimental Procedures." A strain bearing this plasmid (PGAL10-TPT1) overproduces phosphotransferase about 20-fold when grown in galactose, which induces transcription, compared with the phosphotransferase produced when cells are grown in glucose, which represses transcription (Table II). These two experiments demonstrate that expression of the TPT1 gene is the limiting factor determining the observed 2'-phosphotransferase activity in yeast extracts.

Table II. Overproduction of phosphotransferase in yeast


Strain Growth Specific activity

units/mg
EMP177 + yEPlac181 (2-µm LEU2 vector)  -Leucine 9  × 103
EMP177 + pGMC5 (2-µm LEU2 TPT1)  -Leucine 500  × 103
SC466 + pBM150 (PGAL10 vector) YP + glucose 6.1  × 103
SC466 + pBM150 (PGAL10 vector) YP + galactose 6.8  × 103
SC466 + pGMC21 (PGAL10-TPT1) YP + glucose 8.6  × 103
SC466 + pGMC21 (PGAL10-TPT1) YP + galactose 170  × 103

To establish that TPT1 encodes the 2'-phosphotransferase, the gene was expressed in E. coli. As shown in Table III, extracts from an E. coli strain bearing the expression vector pKK223-3 have little, if any, detectable 2'-phosphotransferase activity. However, extracts from an E. coli strain containing the TPT1 ORF fused immediately downstream of the hybrid trp-lac promoter of pKK223-3 have 106-fold more 2'-phosphotransferase activity than the control extracts when expression is induced in the presence of isopropyl-beta -D-thiogalactopyranoside. Since the TPT1 gene encodes a protein of 26.2 kDa, which has 2'-phosphotransferase activity, and its size is nearly the same as that identified in the purification (Fig. 2), and in cross-linking experiments (Fig. 3), it is highly likely that Tpt1 protein is the phosphotransferase protein.

Table III. Overproduction of phosphotransferase activity in E. coli


Strain Specific activity

units/mg
E. coli + Ptac vector, induced <3
E. coli + Ptac-TPT1, induced 8 × 106

2'-Phosphotransferase produced by expression of the TPT1 gene in E. coli is very similar to that purified from yeast. Both proteins require NAD to catalyze removal of the splice junction 2'-phosphate from ligated tRNA, and the NAD dependence is similar (half-maximal activity at 1 unit of Tpt1 protein requires about 10-20 µM NAD). Furthermore, Tpt1 protein expressed in E. coli also transfers the splice junction 2'-phosphate from ligated tRNA to NAD to produce Appr>p, as measured by comigration of the product (in several different thin layer chromatography systems) with Appr>p made by the purified yeast protein, as well as by phosphatase resistance of the product (data not shown). Similarly, Tpt1 protein produced in E. coli, like the yeast enzyme, prefers substrates with tRNA structure: for each protein 2'-phosphorylated tRNA is about 50-fold more efficient a substrate than a synthetic oligonucleotide (pUpUppU), which contains a 2'-phosphate.2 Assuming that E. coli extracts do not fortuitously supply missing factors that can act in concert with Tpt1 protein, it is likely that 2'-phosphotransferase is a single polypeptide that can recognize its substrates and catalyze the complete phosphotransfer reaction.

Tpt1 Protein Is Essential for Vegetative Growth

Removal of the 2'-phosphate from ligated tRNA is likely to be critical for tRNA function. Since the splice junction 2'-phosphate is 1 base 3' of the anticodon, its bulk and charge would be expected to interfere with anticodon recognition and thus impair growth. If Tpt1 protein is the enzyme that catalyzes removal of the splice junction 2'-phosphate from ligated tRNA in vivo, then cells lacking this protein would likely be dead (or very sick).

Gene disruption experiments demonstrate that the TPT1 gene is essential. To show this, we did a standard one-step gene disruption experiment, in which we replaced one allele of the TPT1 gene in a diploid with a copy of the LEU2 gene, as described under "Experimental Procedures," and sporulated the resulting diploid. Two separate gene disruptions were made by replacement of a fragment spanning the ATG of the ORF with the LEU2 gene: in tpt1-Delta 1::LEU2, a 226-nucleotide HindIII fragment extending from -174 in the promoter to +53 in the coding region was replaced; and in tpt1-Delta 2::LEU2 a 744 nucleotide HindIII-AflII fragment from -174 in the promoter to +570 in the coding region was replaced (see Fig. 4B). Southern analysis confirmed in both cases that the chromosomal DNA from the transformant diploids contained one normal sized copy of the TPT1 gene and one copy of the TPT1 gene that was altered by the presence of the LEU2 gene (data not shown). In SC804 (relevant genotype: TPT1+/tpt1-Delta 1::LEU2) 6 tetrads were examined; all segregated two live:two dead spores, and all the live spores lacked the LEU2 marker. Similarly in SC805 (relevant genotype: TPT1+/tpt1-Delta 2) seven tetrads were examined and all segregated two live Leu- spores and two dead spores. These are the expected results if disruption of the TPT1 gene is lethal. Since, in addition, microscopic examination of the nonsurviving spores demonstrated that they germinated and grew into microcolonies, these results suggest that the TPT1 gene is essential.

To confirm that the lethality of the disruptions was caused by lack of the TPT1 gene itself, we demonstrated that the TPT1 gene on a plasmid could complement the deletion and suffice for viability. As shown in Table IV, SC804 (tpt1-Delta 1::LEU2/TPT1+) carrying a plasmid bearing the TPT1 gene on either a single copy plasmid (CEN URA3) or a multicopy plasmid (2-µm URA3) could readily segregate Leu+ (tpt1-) spores as long as the spores also contained a URA3+ TPT1+ plasmid; by contrast, SC804 carrying just a URA3 plasmid segregated only Leu- spores. Furthermore, only the TPT1 gene itself was required to complement the tpt1-Delta 1::LEU2 disruption, since Leu+ Ura+ spores could be readily recovered if the sporulated diploid carried a URA3 CEN plasmid containing only the TPT1 ORF (fused to the GAL10 promoter) and 236 nucleotides of downstream DNA (to allow for termination of transcription). Since the TPT1 ORF is the only ORF on this plasmid, and it still complements the lethality of the tpt1 disruption, it is highly likely that the TPT1 gene is essential. Furthermore, as expected if the TPT1 gene is essential for vegetative growth, cells bearing the TPT1 deletion require the plasmid-borne TPT1 gene for continued viability. Whereas wild type cells bearing a URA3 plasmid can easily lose such plasmids when the URA3 gene is selected against on media containing 5-fluoroorotic acid, tpt1-Delta 1::LEU2 haploid strains bearing the TPT1 gene on a URA3 plasmid cannot lose the plasmid and therefore die on media containing 5-fluoroorotic acid (see Table IV). This is the expected result if expression of the TPT1 gene is necessary for vegetative growth.

Table IV. Segregation of SC804 (TPT1+/tpt1-Delta 1::LEU2) transformed with URA3 plasmids


Plasmid Tetrads, Leu+:Leu- segregation Total Leu+ Total Leu+,Ura+ Total Leu+,Ura+,5-FOAs

pEMP881 (CEN URA3) 5, 0:2 0 0 0
2, 0:1 0 0 0
pGMC1 (CEN URA3 TPT1) 2, 2:2 4 4 4
1, 1:2 1 1 1
1, 2:1 2 2 2
1, 0:3 0 0 0
1, 1:1 1 1 1
3, 0:2 0 0 0
pGMC4 (2-µm URA3 TPT1) 4, 2:2 8 8 8
2, 1:2 2 2 2
1, 2:1 2 2 2
1, 1:1 1 1 1
1, 0:2 0 0 0
pGMC21 (CEN URA3 PGAL10-TPT1) 2, 2:2 4 4 4
1, 1:2 1 1 1
2, 0:2 0 0 0
1, 1:0 1 1 1
1, 0:1 0 0 0

Analysis of the TPT1 Gene

The phosphotransferase is a 230-amino acid protein, with a calculated molecular weight of 26,196 and an isoelectric point of 9.30. It is a highly charged protein; fully 30% of the residues are potentially ionized at neutral pH, and there is a substantial excess of basic residues (12 Arg, 20 Lys, 12 His) over acidic residues (11 Asp, 14 Glu).

Examination of the amino acid sequence with either GCG or Prosite, or by visual inspection, reveals little about possible domains of the protein. No well characterized RNA binding motifs are found in the Tpt1 protein, including the RNP1, arginine-rich (ARM), RGG, K homology (KH), and double-stranded RNA binding motifs (see Ref. 38 for review). Similarly, there are no sequences identical to the RNA binding motifs of the class I aminoacyl tRNA synthetases, which are involved in binding the amino acid acceptor stem of the tRNA (39, 40), and no marked similarities with the less well characterized class II aminoacyl tRNA synthetase sequences (41). Among the tRNA synthetases there is a lack of a consensus site for binding the tRNA anticodon (42, 43). The best match to an NAD binding domain is to that of diphtheria toxin (44). The residues of diphtheria toxin (and by analogy the related exotoxin A from Pseudomonas aeruginosa) that contact NAD are characterized by the sequence HGTXXXYXXSIXX(X)GXQ/RXP/R. A reasonable match is found in the S. cerevisiae sequence beginning at amino acid 117 (HGTNLQSVIKIIESGAISP). The other well characterized NAD binding site contains the sequence GXGXXG/A, which is found in many dehydrogenases at the end of the first beta -sheet of a beta alpha beta ADP-binding fold (45-47), and which is also found in NAD-requiring poly(ADP-ribose) polymerases (48); no perfect matches are located in the TPT1 sequence. There are also no obvious similarities with the sequence of NAD-dependent DNA ligases, including the region around the adenylylation site (49).

The Tpt1 amino acid sequence is conserved in ORFs from several different eukaryotes as well as in an ORF from E. coli. The closest similarity is to an ORF in S. pombe, found on clone c2C4 of the S. pombe sequencing project being done at the Sanger Center in the United Kingdom (http://www.sanger.ac.uk/~yeastpub/svw/pombe.html). The predicted amino acid sequence of this gene is shown in Fig. 5. The S. pombe ORF is 34% identical and 57% similar to that of S. cerevisiae, with three distinct blocks of 10 or more amino acids where the identity approaches or exceeds 80%. The conservation of sequence extends over the entire length of the S. cerevisiae protein, suggesting that the S. pombe ORF might be a functional homolog of the Tpt1 protein. Tpt1 protein also shares significant conserved amino acid sequence with an ORF in E. coli and several ESTs from higher eukaryotes, as illustrated in Fig. 5. The amount of conserved sequence, and the fact that the conservation is largely in the same regions between all the potential proteins, suggest that these ORFs form a family.


Fig. 5. Comparison of the Tpt1 amino acid sequence with sequences in the data base. The S. cerevisiae sequence (HRE230; GenBankTM accession number S51897[GenBank]) is aligned with other likely related sequences from S. pombe (clone c2c4 at the Sanger Center), E. coli (sp|P39380 YJII_ECOLI), mouse (GenBankTM number W65960[GenBank]); and rice (dbj|D15111|RICC0076A). Not shown aligned is a human sequence ((GenBankTM accession numbers H39778[GenBank], H43264[GenBank], W23913[GenBank]), which is similar to the others, but has a large insert and a region of duplicated alignment. Black shadings with white lettering, amino acids which are conserved in the S. cerevisiae sequence and any of the other ORFs; *, translation termination signal; -, gaps in the alignment.
[View Larger Version of this Image (72K GIF file)]


DISCUSSION

We have cloned the S. cerevisiae TPT1 gene, which encodes the 2'-phosphotransferase activity implicated in the last step of tRNA splicing: removal of the splice junction 2'-phosphate from ligated tRNA. This gene was cloned from the purified protein by reverse genetics and demonstrated to be authentic by overproduction of the activity in both yeast and E. coli under regulated promoter control. 2'-Phosphotransferase appears to be a single catalytic polypeptide (Fig. 1, Table III). The purified protein is the predominant silver-staining band in highly purified preparations, and the bacterially expressed protein catalyzes the same NAD-dependent 2'-phosphotransferase reaction in extracts from E. coli. Since formation of Appr>p is at least a two-step chemical reaction, this single polypeptide likely carries out both steps, if both steps are enzyme-catalyzed.

2'-Phosphotransferase is essential for vegetative growth in S. cerevisiae, since a diploid of genotype tpt1-Delta 1::LEU2/TPT1+ could not segregate a LEU2 spore unless an exogenous source of phosphotransferase was present on a plasmid, and since the TPT1-containing plasmid could not then be lost from the strain (Table IV). Based on its biochemical activity (23-26), the lethality caused by a lack of phosphotransferase in yeast is due either to a failure to complete the dephosphorylation step of tRNA splicing or to the lack of Appr>p in the cell. We favor the former hypothesis. Since all members of each of 10 tRNA gene families have introns in yeast (1), lack of phosphotransferase ought to lead to the accumulation of 2'-phosphorylated tRNAs for all members of these gene families. Presence of the 2'-phosphate 1 base 3' of the anticodon would seem likely to impair tRNA function at some stage of translation. However, it is conceivable that lack of Appr>p is also deleterious. To our knowledge this splicing reaction is the only biochemical pathway leading to Appr>p formation; if it or its downstream metabolic products has a cellular role, then the failure to make this product might also impair growth. We have recently isolated conditional tpt1- mutants to begin to ascertain the consequences of a lack of the protein.3 The cellular role of Appr>p would most easily be addressed by altering its levels in vivo. We have previously identified a highly specific cyclic phosphodiesterase that can convert Appr>p or r>p to the corresponding ribose-1-P derivative in yeast extracts (50), an activity that appears to be related to a similar activity in wheat germ (50, 51). A cyclic phosphodiesterase from Arabidopsis with very similar properties has recently been cloned (52); analysis of its function in Arabidopsis or of the function of the corresponding gene in yeast may directly address the question of the role of Appr>p in cells.

A crude calculation based on the purification (Table I) indicates that there is on the order of 10 times more phosphotransferase protein in a yeast cell than there is of the other splicing enzymes: tRNA ligase protein and endonuclease (34, 53). Endonuclease and ligase may form a complex in vivo, based on their similar populations within the cell, their localization in similar subdomains of the nucleus (7, 54), and the concerted splicing reaction observed in vitro with tRNA precursors (55). If such a complex includes the phosphotransferase, there is likely an excess of uncomplexed phosphotransferase. This is consistent with the observation that there is at least 12 times as much 2'-phosphotransferase activity in cells as is necessary for normal growth. Since the GAL10 promoter is tightly repressed by glucose-containing medium, it might be expected that a tpt1-Delta 1::LEU2 strain with a PGAL10-TPT1 plasmid would die on glucose. Unfortunately this is not the case; cells with only a galactose-regulated TPT1 gene have wild type growth rates after prolonged growth in glucose. Under these conditions, phosphotransferase activity is down 12-fold from that observed in wild type cells2; thus there is an excess of phosphotransferase in the cell.

The high degree of conservation of the S. cerevisiae Tpt1 sequence with sequences from S. pombe, mouse, rice, and E. coli suggests strongly that these proteins constitute a family. Given the similarities of sequence, it seems reasonably likely that the S. pombe ORF, and perhaps the mouse and rice ORFs, encode functional Tpt1 proteins; these ORFs all share the same regions of conserved sequence with the S. cerevisiae protein (Fig. 5) and similar or more extensive homologies with one another (data not shown). If so, then the regions of conserved sequence presumably contain the as yet uncharacterized binding and catalytic domains of the protein. We note that the putative NAD binding site identified by comparison of the S. cerevisiae sequence to the diphtheria toxin NAD binding site (44) is retained in all the sequences. Further experiments will be required to define this and the other domains.

In the context of a gene family, the presence of a highly conserved E. coli ORF is striking. Since E. coli is not known to splice tRNAs, or to have a ligase like that in yeast that generates splice junctions with a 2'-phosphate, it seems unlikely that this protein encodes a tRNA 2'-phosphotransferase. However, the E. coli ORF might encode a related catalytic or binding activity. Understanding the function and/or the biochemical activity of the E. coli protein might therefore lead to an understanding of the origin of the unusual activity catalyzed by the yeast 2'-phosphotransferase.


FOOTNOTES

*   This work was supported by National Institutes of Health Grant GM-52347 (to E. M. P.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Dagger    Supported by Oral, Cellular and Molecular Biology Training Grant T32-DE07202. Present address: Dept. of Biology, 406 Sinsheimer Laboratories, University of California, Santa Cruz, CA 95060.
§   Contributed equally to this work.
   Present address: Laboratory of Cellular Metabolism, Bldg. 10, Rm. 5N307, NHLBI, NIH, Bethesda MD 20892.
**   Supported by National Institutes of Health Grant GM 27930 (awarded to Anita Hopper).
Dagger Dagger    To whom correspondence should be addressed. Tel.: 716-275-7268; Fax: 716-271-2683; E-mail: ephi{at}bphvax.biophysics.rochester.edu.
1   The abbreviations used are: Appr>p, ADP-ribose 1"-2" cyclic phosphate; r>p, ribose 1,2-cyclic phosphate; ORF, open reading frame; DTT, dithiothreitol; BSA, bovine serum albumin.
2   S. Spinelli and E. M. Phizicky, unpublished results.
3   S. Spinelli, S. A. Consaul, and E. M. Phizicky, unpublished results.

ACKNOWLEDGEMENTS

We thank Brian Vanwuyckhuyse and Lawrence Tabak for sequencing the Tpt1 protein; Michael Briggs and J. Scott Butler for the yeast genomic library; Mark Johnston for yeast strains, Ryszard Kierzek for the gift of the 2'-phosphorylated oligomer UpUppU; Min-Hao Kuo for valuable computer help; and Anita Hopper, Elizabeth Grayhack, and Matthew Robinson for valuable discussions about this work and the manuscript.


REFERENCES

  1. Hopper, A. K., and Martin, N. C. (1993) in Molecular and Cellular Biology of the Yeast Saccharomyces: Gene Expression (Jones, E. W., Broach, J. R., and Pringle, J. R., eds), pp. 99-141, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  2. van Tol, H., and Beier, H. (1988) Nucleic Acids Res. 16, 1951-1966 [Abstract/Free Full Text]
  3. Reyes, V. M., and Abelson, J. (1988) Cell 55, 719-730 [CrossRef][Medline] [Order article via Infotrieve]
  4. Mattoccia, E., Baldi, I. M., Gandini-Attardi, D., Ciafre, S., and Tocchini-Valentini, G. P. (1988) Cell 55, 731-738 [CrossRef][Medline] [Order article via Infotrieve]
  5. Szekely, E., Belford, H. G., and Greer, C. L. (1988) J. Biol. Chem. 263, 13839-13847 [Abstract/Free Full Text]
  6. Baldi, M. I., Mattoccia, E., Burfardeci, E., Fabbri, S., and Tocchini-Valentini, G. P. (1992) Science 225, 1404-1408
  7. Peebles, C. L., Gegenheimer, P., and Abelson, J. (1983) Cell 32, 525-536 [CrossRef][Medline] [Order article via Infotrieve]
  8. Gandini Attardi, D., Margarit, I., and Tocchini-Valentini, G. P. (1985) EMBO J. 4, 3289-3297 [Medline] [Order article via Infotrieve]
  9. Greer, C. L., Peebles, C. L., Gegenheimer, P., and Abelson, J. (1983) Cell 32, 537-546 [CrossRef][Medline] [Order article via Infotrieve]
  10. Westaway, S. K., Belford, H. G., Apostol, B. L., Abelson, J., and Greer, C. L. (1993) J. Biol. Chem. 268, 2435-2443 [Abstract/Free Full Text]
  11. Belford, H. G., Westaway, S. K., Abelson, J., and Greer, C. L. (1993) J. Biol. Chem. 268, 2444-2450 [Abstract/Free Full Text]
  12. Konarska, M., Filipowicz, W., Domdey, H., and Gross, H. J. (1981) Nature 293, 112-116 [CrossRef][Medline] [Order article via Infotrieve]
  13. Schwartz, R. C., Greer, C. L., Gegenheimer, P., and Abelson, J. (1983) J. Biol. Chem. 258, 8374-8383 [Abstract/Free Full Text]
  14. Kikuchi, Y., Tyc, K., Filipowicz, W., Sanger, H. L., and Gross, H. J. (1982) Nucleic Acids Res. 10, 7521-7529 [Abstract/Free Full Text]
  15. Zillman, M., Gorovsky, M. A., and Phizicky, E. M. (1991) Mol. Cell. Biol. 11, 5410-5416 [Abstract/Free Full Text]
  16. Pick, L., and Hurwitz, J. (1986) J. Biol. Chem. 261, 6684-6693 [Abstract/Free Full Text]
  17. Pick, L., Furneaux, H., and Hurwitz, J (1986) J. Biol. Chem. 261, 6694-6704 [Abstract/Free Full Text]
  18. Knapp, G., Ogden, R. C., Peebles, C. L., and Abelson, J. (1979) Cell 18, 37-45 [CrossRef][Medline] [Order article via Infotrieve]
  19. Phizicky, E. M., Consaul, S. A., Nehrke, K. W., and Abelson, J. (1992) J. Biol. Chem. 267, 4577-4582 [Abstract/Free Full Text]
  20. Filipowicz, W., and Shatkin, A. J. (1983) Cell 32, 547-557 [CrossRef][Medline] [Order article via Infotrieve]
  21. Laski, F. A., Fire, A. Z., RajBhandary, U. L., and Sharp, P. A. (1983) J. Biol. Chem. 258, 11974-11980 [Abstract/Free Full Text]
  22. Nishikura, K., and DeRobertis, E. M. (1981) J. Mol. Biol. 145, 405-420 [CrossRef][Medline] [Order article via Infotrieve]
  23. Culver, G. M., McCraith, S. M., Zillman, M., Kierzek, R., Michaud, N., LaReau, R. D., Turner, D. H., and Phizicky, E. M. (1993) Science 261, 206-208 [Abstract/Free Full Text]
  24. McCraith, S. M., and Phizicky, E. M. (1990) Mol. Cell. Biol. 10, 1049-1055 [Abstract/Free Full Text]
  25. Zillmann, M., Gorovsky, M. A., and Phizicky, E. M. (1992) J. Biol. Chem. 267, 10289-10294 [Abstract/Free Full Text]
  26. McCraith, S. M., and Phizicky, E. M. (1991) J. Biol. Chem. 266, 11986-11992 [Abstract/Free Full Text]
  27. Reyes, V. M., and Abelson, J. (1987) Anal. Biochem. 166, 90-106 [CrossRef][Medline] [Order article via Infotrieve]
  28. Robinson, M. K., van Zyl, W. H., Phizicky, E. M., and Broach, J. R. (1994) Mol. Cell. Biol. 14, 3634-3645 [Abstract/Free Full Text]
  29. Sherman, F. (1991) Methods Enzymol. 194, 3-21 [CrossRef][Medline] [Order article via Infotrieve]
  30. Boeke, J. D., La Croute, F., and Fink, G. R. (1984) Mol. & Gen. Genet. 197, 345-346
  31. Geitz, R. D., and Sugino, A. (1988) Gene (Amst.) 74, 527-534 [CrossRef][Medline] [Order article via Infotrieve]
  32. Briggs, M. W., and Butler, J. S. (1996) Genetics 143, 1149-1161 [Abstract]
  33. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., pp. 318-328, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  34. Phizicky, E. M., Schwartz, R. C., and Abelson, J. (1986) J. Biol. Chem. 261, 2978-2986 [Abstract/Free Full Text]
  35. Marhall, T. (1984) Anal. Biochem. 136, 340-346 [CrossRef][Medline] [Order article via Infotrieve]
  36. Matsudaira, P. (1987) J. Biol. Chem. 262, 10035-10038 [Abstract/Free Full Text]
  37. Kierzek, R. (1994) Nucleosides Nucleotides 13, 1757-1768
  38. Burd, C. G., and Dreyfuss, G. (1994) Science 265, 615-621 [Abstract/Free Full Text]
  39. Kisselev, L. L. (1993) Biochemie 75, 1027-1039 [Medline] [Order article via Infotrieve]
  40. Hountondji, C., Dessen, P., and Blanquet, S. (1993) Biochemie (Paris) 75, 1137-1142
  41. Cussack, S. (1993) Biochemie (Paris) 75, 1077-1081
  42. Rould, M. A., Soll, J. J. D., and Steitz, T. A. (1989) Science 246, 1135-1142 [Abstract/Free Full Text]
  43. Ruff, M., Krishnaswamy, S., Boeglin, M., Poterszman, A., Mitschler, A., Podjarny, A., Ress, B., Thierry, J. C., and Moras, D. (1991) Science 252, 1682-1689 [Abstract/Free Full Text]
  44. <