JBC Oz Biosciences

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Genschik, P.
Right arrow Articles by Filipowicz, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Genschik, P.
Right arrow Articles by Filipowicz, W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


Volume 272, Number 20, Issue of May 16, 1997 pp. 13211-13219
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Cloning and Characterization of the Arabidopsis Cyclic Phosphodiesterase Which Hydrolyzes ADP-ribose 1",2"-Cyclic Phosphate and Nucleoside 2',3'-Cyclic Phosphates*

(Received for publication, November 26, 1996, and in revised form, February 6, 1997)

Pascal Genschik Dagger , Jonathan Hall § and Witold Filipowicz

From the Friedrich Miescher-Institut, P. O. Box 2543, 4002 Basel and the § Central Research Laboratories, Ciba, 4002 Basel, Switzerland

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

In eukaryotic cells, pre-tRNAs spliced by a pathway that produces a 3',5'-phosphodiester, 2'-phosphomonoester linkage contain a 2'-phosphate group adjacent to the tRNA anticodon. This 2'-phosphate is transferred to NAD to give adenosine diphosphate (ADP)-ribose 1",2"-cyclic phosphate (Appr>p), which is subsequently metabolized to ADP-ribose 1"-phosphate (Appr-1"p). The latter reaction is catalyzed by a cyclic phosphodiesterase (CPDase), previously identified in yeast and wheat. In the work presented here, we describe cloning of the Arabidopsis cDNA encoding the 20-kDa CPDase that hydrolyzes Appr>p to Appr-1"p. Properties of the bacterially overexpressed and purified Arabidopsis enzyme are similar to those of wheat CPDase. In addition to their transformation of Appr>p, both enzymes hydrolyze nucleoside 2',3'-cyclic phosphates to nucleoside 2'-phosphates. For the Arabidopsis CPDase, the apparent Km values for Appr>p, A>p, C>p, G>p, and U>p are 1.35, 1.34, 2.38, 16.86, and 17.67 mM, respectively. Southern analysis indicated that CPDase in Arabidopsis is encoded by a single copy gene that is expressed, at different levels, in all Arabidopsis organs that were analyzed. Indirect immunofluorescence, performed with transfected protoplasts, showed that CPDase is localized in the cytoplasm. Based on substrate specificity and products generated, the plant enzyme differs from other known cyclic phosphodiesterases. The Arabidopsis CPDase does not have recognizable structural similarity or motifs in common with proteins deposited in public data bases.


INTRODUCTION

Transcripts of many tRNA genes in eukaryotes contain a single short intron, located in a conserved position in the anticodon loop, which is excised by a different mechanism to that utilized during nuclear pre-mRNA processing (Fig. 1; reviewed in Refs. 1 and 2). Splicing of pre-tRNA is initiated by endonucleolytic cleavages that result in removal of the intron and formation of two tRNA half-molecules, a 5'-half terminating in a 2',3'-cyclic phosphate and a 3'-half bearing a 5'-hydroxyl group (3-7). In yeast and plants, these two tRNA exons are ligated to give an unusual 3',5'-phosphodiester, 2'-phosphomonoester linkage. This reaction, catalyzed by the RNA ligase (8-11), is a multistep process resulting in formation of the mature length tRNA containing a 2'-phosphate at the splice junction (1, 2) (Fig. 1). The ligation pathway leading to the formation of the 2'-phosphate-bearing tRNA molecules is also conserved in vertebrates (12), despite the fact that in these organisms most of the tRNA splicing appears to involve another RNA ligase, an enzyme which joins two tRNA halves by the regular 3',5'-phosphodiester (3, 4, 13).


Fig. 1. Eukaryotic tRNA splicing pathways and formation of Appr>p and its hydrolysis product Appr-1"p. For additional details and references, see text.
[View Larger Version of this Image (24K GIF file)]

The 2'-phosphate present in the product of the spliced tRNA is removed by a specific phosphotransferase, previously identified in yeast and vertebrates (14, 15). Culver et al. (16) found that this enzyme transfers the 2'-phosphate to an NAD acceptor molecule, to produce ADP-ribose 1",2"-cyclic phosphate (Appr>p).1 However, Appr>p is not the final product of this complex series of reactions. It has been found recently that Appr>p is converted into ADP-ribose 1"-phosphate (Appr-1"p) by the action of the cyclic phosphodiesterase (CPDase), identified in yeast and wheat (17). Although all partial reactions leading to the formation of Appr>p and Appr-1"p have, to date, only been demonstrated in yeast (16, 17), the available evidence suggests that both compounds are also produced, as a result of the tRNA splicing reaction, in plants and vertebrates (12, 15-17). It has been suggested that Appr>p, or its hydrolysis product, may perform some as yet unspecified regulatory function(s) in the cell (16). Conservation of the Appr>p-forming pathway in vertebrates (12, 15, 16), despite the fact that most of the cellular tRNA in these organisms seems to be processed by another pathway (see above), offers some support for this hypothesis.

The plant CPDase was originally purified from wheat as an enzyme that hydrolyzes nucleoside 2',3'-cyclic phosphates to nucleoside 2'-phosphates (18). The biological significance of this reaction is not known, but the ability of the enzyme to convert the 2',3'-cyclic phosphate to the 2'-phosphate in mononucleotides but not in cyclic-phosphate-terminated oligoribonucleotides, together with its ability to hydrolyze Appr>p, clearly distinguishes it from other known enzymes having the 2',3'-cyclic phosphate 3'-phosphodiesterase activity (17, 18; see "Discussion"). Although the yeast phosphodiesterase shares many characteristics with the wheat enzyme, it has a different substrate specificity, hydrolyzing Appr>p to Appr-1"p, but having no detectable activity on nucleoside 2',3'-cyclic phosphates (17). Fractionation experiments performed with yeast and wheat germ extracts indicated that phosphodiesterases described above are, most probably, the only cellular activities converting Appr>p to Appr-1"p (17).

In this work we describe the molecular characterization of the plant cyclic phosphodiesterase. The cDNA encoding this protein in Arabidopsis has been cloned and the properties of the bacterially overexpressed and purified enzyme have been compared with those of its purified wheat counterpart. The Arabidopsis enzyme has no apparent structural resemblance to other known cyclic nucleotide phosphodiesterases.


EXPERIMENTAL PROCEDURES

Plant Material

Plantlets of Arabidopsis thaliana, ecotype Columbia C0, were grown in Petri dishes containing 0.8% agar, 1% sucrose, and MS salts (19) in a 22 °C growth chamber under a 12-h light/12-h dark cycle. Three weeks after sowing, leaves, roots, and floral buds were harvested. For leaf strip incubation, the leaves were sliced and incubated in a culture medium described by Nagy and Maliga (20), containing 1 mg/liter of 2,4-dichlorophenoxyacetic acid. Aliquots were harvested at different times of culture for total RNA extraction.

Sequencing of the Wheat CPDase

About 5 µg of wheat germ CPDase, purified as described previously (18), was applied to the SDS-PAGE 10% gel. After blotting to the polyvinylidene difluoride membrane (Bio-Rad) and staining with Ponceau S, the approximately 23-kDa CPDase band was excised and treated with trypsin. Proteolytic peptides were resolved by HPLC and sequenced by Dr. W. S. Lane (Harvard MicroChem, Cambridge, MA). Three peptides were sequenced (Fig. 2).


Fig. 2. Nucleotide and derived amino acid sequences of the A. thaliana CPDase and its cDNA. The upstream end of the longest cDNA isolated from the Arabidopsis lambda ZAP cDNA library is marked by an arrow. The short open reading frame in the 5'-terminal leader sequence is underlined. Termination codons in the 5'-leader are overlined. Putative polyadenylation signal sequences are double-underlined. Amino acid sequence comparisons with the sequenced peptides (pep 1, pep 2, and pep 3) of the wheat CPDase are boxed. Identical residues are indicated by dashes, while conserved residues are in bold. The N-terminal amino acid of pep3 is either Ser (S) or Thr (T). The nucleotide sequence shown in this figure has been submitted to the EMBL/GenBank/DDBJ Nucleotide Sequence Libraries under accession number Y11650[GenBank].
[View Larger Version of this Image (50K GIF file)]

Screening of a cDNA Library

A lambda ZAP cDNA library, prepared with a mixture of the poly(A)+ RNA isolated from 24, 48, and 72 h leaf strip cultures (a gift from J. Fleck, Institut de Biologie Moléculaire des Plantes du CNRS, Strasbourg, France), was screened with the partial cDNA clone (the Arabidopsis EST; GenBankTM/EBI accession number T12916[GenBank]; kindly provided by the Arabidopsis Biological Resource Center at Ohio State University, Columbus, OH) as a probe. Hybridizations were performed overnight at 42 °C in 5 × SSPE (SSPE: 0.18 M NaCl, 10 mM NaH2PO4, 1 mM Na2-EDTA, pH 7.7) containing 50% formamide, 5 × Denhardt's solution (100 × Denhardt's solution is 2% Ficoll, 2% polyvinylpyrrolidone, 2% bovine serum albumin), 1% SDS, and 50 µg/ml denatured salmon sperm DNA. Filters were subsequently washed in 2 × SSC (SSC: 0.15 M NaCl, 15 mM Na2citrate) and 0.1% SDS for 30 min at 42 °C and in 0.2 × SSC and 0.1% SDS for 30 min at 42 °C. Twenty-nine clones were isolated after screening 800,000 recombinant phages. After excision of the phagemids, the inserts were analyzed by restriction mapping and sequencing of the ends. The longest clones were subsequently sequenced on both strands.

Determination of the CPDase mRNA 5' Terminus by RACE

Primer extension was carried out (21) using a 25-mer-specific 32P-labeled oligonucleotide 1 (ACGGTGACGTGAGGAACGAATCTTG), complementary to positions 203-227 of the cDNA (Fig. 2), 10 units of avian myoblastosis virus reverse transcriptase, and 100 µg of RNA isolated from the Arabidopsis leaf strip cultures incubated for either 24 or 48 h. The resulting cDNA was purified on a 6% denaturing polyacrylamide gel and its 3' end was tagged with the 5'-phosphorylated oligonucleotide 2 (pCATCTCGAGCGGCCGCATCA) using T4 RNA ligase (22). The CPDase cDNA sequence was PCR-amplified using oligonucleotide 3 (GTGAGGAACGAATCTTGG; complementary to positions 202 to 219; Fig. 2) and oligonucleotide 4 (TGATGCGGCCGCTCGAGA; complementary to the 3' tag) as primers. The PCR products were cloned into pBluescript (Stratagene) and sequenced.

Cloning of the Promoter Region of the CPDase Gene

The fragment encompassing 226 base pairs of the promoter and upstream portion of the transcribed region was cloned by inverse PCR (23). The Arabidopsis DNA was digested with EcoRI and ligated using T4 DNA ligase. PCR was performed using oligonucleotide 5 (CGATTCCTCATCTGGTAATGC; complementary to positions 130 to 150 in Fig. 2) and oligonucleotide 6 (GCTAATGGAAGCTTTGAGATCC; positions 168 to 189 in Fig. 2) as primers. The amplified fragments were cloned into the SmaI site of pBluescript and sequenced.

Northern, Southern, and Western Blot Analysis

Total RNA from Arabidopsis organs and leaf strip cultures was isolated as described by Hall et al. (24). RNA (10 µg/lane) was separated on a formaldehyde-agarose gel, blotted onto Hybond-N nylon membrane (Amersham Corp.) by capillary transfer using 20 × SSPE, and UV-cross-linked to the membrane. The integrity and the amount of RNA applied to each lane were verified by control hybridizations using a tomato 25 S rRNA probe (25). The cDNA fragment extending from positions 430-741 (Fig. 2) was used as a CPDase probe. The histone H4 probe corresponds to the 196-base pair restriction fragment AccI/DdeI of the coding region of the gene H4A748 (26). The actin probe corresponds to the 570-base pair PCR-amplified fragment of the Arabidopsis actin gene AAc1 (27). The genomic DNA was isolated from lyophilized Arabidopsis plants using a procedure similar to that of Murray and Thompson (28). The probes were labeled with [alpha -32P]dCTP (3000 Ci/mmol, Amersham) by the random priming method (29). RNA as well as DNA gel blots were hybridized overnight at 42 °C in 5 × SSPE, 50% formamide, 10% dextran sulfate, 1% SDS, and 50 µg/ml denatured salmon sperm DNA. The blots were subsequently washed in 2 × SSC and 0.1% SDS for 30 min at 42 °C and in 0.2 × SSC and 0.1% SDS for 30 min at 42 °C and then at 60 °C.

For immunoblot analysis, proteins were fractionated by SDS-PAGE and electroblotted onto the polyvinylidene difluoride membrane. The membrane was probed with a 1:1000 dilution of the hen polyclonal antibody. The immunoreactive proteins were detected using peroxidase-conjugated affinity-purified rabbit anti-chicken IgYs (Dianova) and the ECL Western blotting analysis system from Amersham.

Expression and Purification of the CPDase

A BamHI site was introduced 3' to the CPDase coding sequence by site-directed mutagenesis (30). The NcoI/BamHI fragment (the NcoI site is present at the AUG initiation codon of the CPDase cDNA) was cloned into the pQE-60 vector (Qiagen) yielding plasmid pQECPDase. In this construct, 10 additional amino acids (sequence GSRSHHHHHH) are placed in frame at the C terminus of the recombinant protein. The protein remained soluble during expression in the Escherichia coli strain BL21(DE3) and was purified in the native form, under nondenaturing conditions, using the nickel-nitrilotriacetic acid resin and following the Qiagen protocol. The purified CPDase was applied to a 10-ml Sephadex G-25 column equilibrated and eluted with 20 mM Tris acetate, pH 7.6, 0.5 mM dithiothreitol, 0.1 mM EDTA, 0.5 mM dithiothreitol, 5% (v/v) glycerol, 0.01% Triton X-100, and 10 µM phenylmethylsulfonyl fluoride. The protein concentration was measured by the method of Bradford (31) using bovine serum albumin as a standard.

Preparation of Hen Antibodies

Two hens were immunized with the purified recombinant CPDase. For primary immunization, 20 µg of the protein, in Freund's complete adjuvant, was used. After 4 weeks, 20 µg of the protein with Freund's incomplete adjuvant was injected. Eggs were collected daily starting 2 weeks after the last immunization. Antibodies were purified from egg yolk according to the three-step method of Polson and von Wechmar (32). A 2 M (NH4)2 SO4 precipitation was used for the complete removal of polyethylene glycol.

Sources of Nucleotides and Oligonucleotides

All nucleoside 2',3'-cyclic and 3',5'-cyclicphosphates, nucleoside 5'-, 3'- and 2'-phosphates, pG>p and inositol 1,2-cyclic phosphate were obtained from Sigma and Pharmacia Biotech Inc. A>p, G>p, and C>p were purified by reverse phase HPLC on Nucleosil C4 RP-300 column using 50 mM triethyl-ammonium acetate-acetonitrile gradient. Products were collected as a single peak. Appr>p was chemically synthesized as described elsewhere (33). The 32P-labeled oligoribonucleotide AAAAUAAAAG>p* (asterisk denotes the position of the label) was prepared as follows: the synthetic oligoribonucleotide AAAAUAAAAG (0.7 µg), obtained from MWG-Biotech (Munich, Germany), was 3'-terminally labeled using 5'-[32P]pCp (*pCp) and T4 RNA ligase. The ligation product was then digested with 5 units of RNase T1 yielding AAAAUAAAAGp*. The latter was quantitatively converted into AAAUAAAAG>p* by incubation with the RNA 3'-terminal phosphate cyclase purified from HeLa cells (34). The oligonucleotide was recovered by phenol extraction and ethanol precipitation.

Assays of Cyclic Nucleotide Phosphodiesterase Activity and Thin Layer Chromatography (TLC)

For calculation of specific activities and kinetic analysis, a quantitative assay based on a measurement of the phosphatase-sensitive nucleotide product was used. All incubations (20 µl) contained 50 mM Tris-HCl, pH 7.0, and 0.01% Triton X-100. Concentrations of CPDase and substrates and incubation times at 30 °C were as indicated in the figure legends. Reactions were stopped by boiling for 2 min, and 80 µl of 0.1 M Tris-HCl, pH 8.0, containing 0.2 unit of CIP was added. After incubation for 10 min at 37 °C, liberated phosphate was assayed according to Hess and Derr (35). For determination of the Km and Vmax values, the assays contained substrates at concentrations of 1.38-12.5 mM. All velocities were calculated from the initial linear rates. Values were fitted to the Lineweaver-Burk equation by the linear regression method assuming proportional errors.

Products of enzymatic digestions, performed as described previously (8), were analyzed by cellulose TLC in solvent A (saturated (NH4)2SO4/3 M sodium acetate/isopropyl alcohol (80:6:2)) or by polyethyleneimine-cellulose TLC in solvent B (0.75 M LiCl). The nucleotide standards and reaction products were visualized under UV light.

Transfection of Plant Protoplasts and Indirect Immunofluorescence

The CPDase coding sequence (the NcoI-BamHI fragment from pQECPDase; see above) was cloned into the NcoI and BamHI sites of the pGGS.5 expression vector (kindly provided by Gordon Simpson of this laboratory; the vector contains a duplicated cauliflower mosaic virus promoter and a cauliflower mosaic virus poly(A) signal), resulting in the plasmid pHATCPDase. The CPDase encoded by pHATCPDase contains the influenza hemagglutinin nonapeptide epitope tag (flu tag, amino acids YPYDVPDYA) at the C terminus. A similar plasmid (pNRBP43) expressing the nuclear RNA-binding protein N-RBP43 of Nicotiana plumbaginifolia with the flu tag fused at the C terminus, was used as a control for the nuclear-localized protein. Mesophyll protoplasts of N. plumbaginifolia were transfected by the polyethylene glycol method (36), using 20 µg of plasmid per transfection. Transfected protoplasts were collected 24 h after transfection, washed twice with 10 ml of W5 solution (36), twice with 10 ml of 0.5% Mes, pH 5.7, containing 175 mM CaCl2, and suspended in 100 µl of the same Mes/CaCl2 buffer.

Indirect immunofluorescence analysis was performed according to Cairns et al. (37) and Neuhaus et al. (38), with modifications. Aliquots of the protoplast suspension were spread on the surface of detergent- and acetone-washed glass slides. The slides were dried in an oven at 55 °C and kept overnight under vacuum in a desiccator. Samples were fixed for 30 min at room temperature by overlaying with 100 µl of the fixation solution (4% formaldehyde, 1% Triton X-100 in 0.1 M potassium phosphate buffer, pH 8.0). They were subsequently washed four times for 30 min with 1 ml of washing solution A (2.5% NaCl in 0.1 M glycine-KOH buffer, pH 8.5), and overlaid for 1 h in a wet chamber with 100 µl of a solution of the rabbit antiserum against the flu epitope (antibody HA-11; Berkley Antibody Co.), diluted 1:80 with buffer B (2.5% NaCl solution in 0.1 M Tris-HCl, pH 7.4). Glass slides were washed four times for 15 min with 1 ml of solution A and overlaid for 30 min with the fluorescein isothiocyanate-conjugated goat anti-rabbit antibody (AffiniPure F(ab')2 fragment; Jackson/Milan Analytica AG). The secondary antibody was diluted 1:100 with buffer B, containing 10 µg/ml Hoechst 33258 dye. After washing four times with 1 ml of solution A and four times with 1 ml of solution C (0.1 M glycine-KOH, pH 8.5), samples were overlaid with a drop of the embedding material and covered with a cover glass. Samples were examined with a Zeiss Axiophot microscope and a Leica TCS 4D confocal scanning laser microscope, using a 63× objective. Images were recorded using the Leica software (SCANware 4.2) provided with the system and analyzed with the Imaris software on a Silicon Graphics work station.


RESULTS

Cloning of the cDNA Encoding Arabidopsis CPDase

The previously purified wheat germ CPDase (18) was subjected to tryptic digestion, and three peptide sequences were obtained. One of these, the 20-amino acid-long pep3, showed 80% identity and 100% similarity to an open reading frame of the Arabidopsis EST, present in the GenBankTM/EBI data base (accession number T12916[GenBank]). The EST cDNA was used as a probe to screen the lambda ZAP cDNA library made with the poly(A)+ RNA obtained from the Arabidopsis leaf strip culture. Twenty-nine positive recombinant phages were isolated, and their inserts were analyzed by restriction mapping and sequencing of the ends. The longest cDNA obtained from this screening started approximately 85 nucleotides downstream from the transcription initiation site, as determined by primer extension (data not shown). To determine the 5'-terminal mRNA sequence, RACE experiments were performed using RNA isolated from leaf strip cultures incubated for either 24 or 48 h. Both RNA preparations yielded cDNA clones of identical sequence and extending to the same position (position 1 in Fig. 2). The sequence of the region identified by RACE was independently confirmed by cloning, using inverse PCR, and sequencing the promoter region of the gene. The apparent full-length cDNA is 741 nucleotides long, without counting the poly(A) tail (Fig. 2). The sequence including the presumed AUG initiation codon (AUCCAUGGA) is similar to the consensus (AACCAUGGC) established for plant genes (39). The 5'-terminal leader contains one additional AUG in a much less favorable context, followed by termination codons (Fig. 2). Conceptual translation of the cDNA yields a 20.5-kDa protein of 181 amino acids with a predicted isoelectric point of 4.82. The deduced Arabidopsis protein contains sequences showing significant similarities with all sequenced peptides derived from the wheat protein. The greatest sequence homology is for pep3 (see above). Peptides pep1 and pep2 show 39 and 38% similarity and 39 and 31% identity, respectively.

Enzymatic Properties of the Overexpressed Arabidopsis CPDase and Its Comparison with the Wheat Enzyme

The coding region of the Arabidopsis cDNA was subcloned in the pQE-60-inducible expression vector to yield a fusion protein containing six histidine residues at the C terminus. The tagged protein was overproduced in E. coli and purified using the nickel-nitrilotriacetic acid resin (Fig. 3A). The protein was over 95% pure as judged by SDS-PAGE. The polyclonal antibodies, raised in chickens immunized with the overexpressed Arabidopsis CPDase, detected purified Arabidopsis protein on Western blots and also cross-reacted with the purified wheat CPDase (Fig. 3B). The antibodies did not detect the CPDase in crude cellular extracts prepared from the leaves of Arabidopsis, but the protein band likely to correspond to the CPDase could be detected after partial purification of the enzyme (data not shown). Hence, consistent with previous observations (18), the CPDase appears to be a nonabundant protein.


Fig. 3. Gel electrophoresis of the purified Arabidopsis histidine-tagged CPDase (A) and immunological relationship to the wheat enzyme (B). A, a total of 200 ng (lane 1) and 400 ng (lane 2) of the affinity-purified CPDase was applied to the 10% gel. The gel was stained with Coomassie Blue. B, SDS-PAGE immunoblot of purified Arabidopsis and wheat CPDases, probed with the polyclonal antibody raised against the Arabidopsis protein. No immunoreactive material was detected with the preimmune antibody (data not shown). Lanes 1 and 2, 20 and 40 ng, respectively, of the Arabidopsis CPDase; lanes 3 and 4, 10 and 50 ng, respectively, of the purified wheat CPDase. Molecular mass markers are indicated.
[View Larger Version of this Image (28K GIF file)]

The Arabidopsis CPDase hydrolyzed all four nucleoside 2',3'-cyclic phosphates to the corresponding 2'-phosphomonoesters as analyzed by cellulose TLC (Fig. 4). No 3'-phosphomonoester formation could be detected. Thus, like the wheat protein, the Arabidopsis enzyme has 2',3'-cyclic nucleotide 3'-phosphodiesterase activity. Nucleoside 3',5'-cyclic phosphates (3',5'-cAMP and 3',5'-cGMP), inositol 1,2-cyclic phosphate and guanosine 5'-phosphate, 2',3'-cyclic phosphate (pG>p), and also the cyclic phosphodiester in the 2',3'-cyclic phosphate-terminated oligoribonucleotide (AAAAUAAAAG>p*, the asterisk indicates a position of the 32P label) were not hydrolyzed (data not shown); these compounds are also not substrates for the wheat enzyme (17, 18).


Fig. 4. Hydrolysis of the 2',3'-cyclic nucleotides by the Arabidopsis CPDase. Reaction mixtures of 10 µl were incubated with (even-numbered lanes) or without (odd-numbered lanes) 200 ng of CPDase and contained the following nucleotides (each 20 mM): A>p (lanes 1 and 2), G>p (lanes 3 and 4), C>p (lanes 5 and 6), U>p (lanes 7 and 8). A total of 4 µl of each sample was subjected to cellulose TLC in solvent A. Positions of nucleotide markers are indicated.
[View Larger Version of this Image (63K GIF file)]

The wheat CPDase was previously shown to cleave the 1",2"-cyclic phosphate linkage in the enzymatically produced 32P-labeled Appr>p to generate Appr-1"p (17). We have used chemically synthesized Appr>p (33) to demonstrate that the Arabidopsis enzyme has similar activity. The availability of larger amounts of Appr>p also allowed us to determine the kinetic parameters for its hydrolysis by the wheat and Arabidopsis CPDases (see below). Hydrolysis of Appr>p by the Arabidopsis or wheat enzyme yielded products of identical mobility in two different TLC systems (Figs. 5, A and B, lanes 2 and 3). Following additional treatment with CIP, in both cases the compound comigrated with ADP-ribose (Fig. 5, A and B, lanes 4 and 5). Treatment of Appr>p with RNase T2 yielded the Appr-2"p isomer, which chromatographs more slowly than Appr-1"p on the polyethyleneimine plate (Fig. 5B, lane 7; Ref. 17). As expected, the RNase T2 hydrolysis product was also sensitive to CIP, yielding ADP-ribose (Fig. 5B, lane 8).


Fig. 5. Hydrolysis of Appr>p by the Arabidopsis and wheat CPDases and characterization of the hydrolysis product. Appr>p was treated with either wheat (lanes 2 and 4) or Arabidopsis (lanes 3 and 5) CPDase or with RNase T2 (lane 7). The samples in lanes 4, 5, and 8 were additionally treated with calf intestinal phosphatase (CIP). Lane 1, untreated Appr>p; lane 6, ADP-ribose marker. A, cellulose TLC in solvent A. B, polyethyleneimine-cellulose in solvent B. Appr>p was not sensitive to CIP treatment as analyzed by TLC in both systems (not shown). Note: use of parentheses indicates that no standard is available for comparison and the identification of the molecule is based on other criteria (see text).
[View Larger Version of this Image (39K GIF file)]

Reaction requirements of the Arabidopsis CPDase were determined using A>p as a substrate (Fig. 6). Triton X-100 stimulated the enzyme activity, and 0.01% detergent was included in all reactions. The amount of substrate hydrolyzed was linearly dependent on enzyme concentration up to 20 ng/20 µl. The rates of A>p hydrolysis were similar at 20, 30, and 37 °C. The optimal activity was found at pH 7.0. These reaction requirements are similar to those of the wheat enzyme (18).


Fig. 6. Hydrolysis of A>p by the Arabidopsis CPDase. A, dependence on enzyme concentration. Assays were incubated for 30 min at 30 °C. B, kinetics of hydrolysis at different temperatures. Assays (20 µl) contained 20 ng of CPDase. C, pH optimum. Assays (20 µl), containing 20 ng of CPDase, were incubated for 30 min at 30 °C. The following buffers were used: Mes-NaOH (black-square), Mops-NaOH (black-diamond ), and Tris-HCl (square ).
[View Larger Version of this Image (16K GIF file)]

The effects of mono- and divalent cations (chloride salts) and EDTA, previously tested with the wheat enzyme, were determined. Addition of NaCl to 0.2 or 0.4 M inhibited A>p hydrolysis by 15 and 31%, respectively. Cu2+ and Zn2+ at 0.5 mM inhibited A>p hydrolysis by 93 and 87%, respectively. At 0.5 mM, Mn2+ slightly stimulated (by 5%) enzyme activity, whereas Ca2+, Mg2+, Co2+, Ni2+, and EDTA showed no effect at 0.5 mM and were only weakly inhibitory at 10 mM (data not shown). All these results are consistent with those obtained for the wheat CPDase (18).

The Km and Vmax for the Arabidopsis CPDase were estimated for four nucleoside 2',3'-cyclic phosphates and Appr>p and compared with those obtained with the purified wheat enzyme (Table I). Km values for individual nucleotide substrates were comparable for both enzymes (but see legend to Table I). However, the Vmax values obtained with the Arabidopsis CPDase were 10-25 times lower than those measured with the wheat enzyme. It is possible that only a fraction of the Arabidopsis protein overexpressed in E. coli is enzymatically active. Alternatively, activity of the overexpressed enzyme may be lower due to the presence of the histidine tag or the absence of some essential modification of the protein. Based on relative Vmax/Km values, the specificity of the Arabidopsis CPDase toward the cyclic nucleotides is C>p:A>p:Appr>p:U>p:G>p = 100:54:36:6:6, whereas for the wheat CPDase the specificity is A>p:C>p:Appr>p:U>p:G>p = 100:43:39:9:7. Hence, both enzymes have similar substrate specificities with a preference for A>p, C>p, and Appr>p over U>p and G>p.

Table I. Substrate specificity of the Arabidopsis and wheat CPDases

Parameters in the table are the weighted means, together with their standard errors, of at least two determinations. In the case of A>p, G>p, and C>p, the Km and Vmax values determined with the wheat CPDase differ from the values obtained previously by Tyc et al. (18) (their Km and Vmax values were: 13.1 and 2094 (A>p), 9.2 and 276 (G>p), 25.2 and 2140 (C>p)). The reason for the discrepancy is not known. Note that A>p, G>p, and C>p used in this work were purified by HPLC (see "Experimental Procedures"). Based on the Vmax/Km values, determined previously (18) and now, the relative specificities of the wheat enzyme toward four nucleoside 2',3'-cyclic phosphates are comparable. Parameters in the table are the weighted means, together with their standard errors, of at least two determinations. In the case of A>p, G>p, and C>p, the Km and Vmax values determined with the wheat CPDase differ from the values obtained previously by Tyc et al. (18) (their Km and Vmax values were: 13.1 and 2094 (A>p), 9.2 and 276 (G>p), 25.2 and 2140 (C>p)). The reason for the discrepancy is not known. Note that A>p, G>p, and C>p used in this work were purified by HPLC (see "Experimental Procedures"). Based on the Vmax/Km values, determined previously (18) and now, the relative specificities of the wheat enzyme toward four nucleoside 2',3'-cyclic phosphates are comparable.

Substrate Arabidopsis
Wheat
Vmax Km Vmax/Km Vmax Km Vmax/Km

µmol/min/mg mM × 103 µmol/min/mg mM × 103
A>p 25  ± 2 1.34  ± 0.24 18.5  ± 3.7 597  ± 29 1.09  ± 0.13 547  ± 72
G>p 37  ± 4 16.86  ± 2.57 2.2  ± 0.4 917  ± 121 24.44  ± 3.77 37  ± 7
C>p 79  ± 7 2.38  ± 0.39 33.3  ± 6.2 695  ± 40 3.01  ± 0.27 231  ± 24
U>p 47  ± 3 17.67  ± 1.61 2.6  ± 0.3 762  ± 116 15.16  ± 2.85 50  ± 12
Appr>p 16  ± 2 1.35  ± 0.19 12.1  ± 2.2 261  ± 34 1.21  ± 0.23 216  ± 49

Expression of the CPDase Gene

The CPDase gene copy number was estimated in a Southern blot analysis. Only one hybridizing band was detected in DNA digests carried out with three different restriction enzymes, consistent with the existence of a single-copy gene (Fig. 7).


Fig. 7. Southern blot of the Arabidopsis genomic DNA. Digestions were performed with NcoI (lane 1), EcoRI (lane 2), and EcoRV (lane 3) and hybridized with the CPDase-specific cDNA probe. Positions of size markers (in base pairs) are indicated.
[View Larger Version of this Image (40K GIF file)]

Expression of the CPDase gene in various tissues of Arabidopsis plants and in germinating seeds and young plantlets was analyzed by Northern blotting (Fig. 8A). The CPDase mRNA is relatively low in abundance, consistent with the results of Western analysis (see above). Roots contained slightly higher levels of mRNA than other tissues analyzed. Still higher levels of mRNA were found in 3-week-old Arabidopsis plantlets.


Fig. 8. CPDase mRNA accumulation in various Arabidopsis organs (A) and during reinitiation of mitotic activity in leaf strip cultures (B). A, total RNA extracted from leaves, stems, roots, floral buds, 7-day-old germinating seeds, and 3-week-old plantlets was blotted and hybridized with the Arabidopsis CPDase-specific cDNA probe (upper panel) and the 25S rRNA probe (lower panel). B, total RNA extracted from Arabidopsis leaves (L; lane 1) and from leaf strips (LS) incubated in a medium suitable for cell division for 0, 24, 48, and 72 h (lanes 2-5, respectively). The blot was probed successively with the Arabidopsis CPDase, histone H4, and actin cDNA probes and with the tomato 25 S rRNA probe.
[View Larger Version of this Image (35K GIF file)]

Expression of the CPDase gene was also investigated during re-initiation of mitotic activity in leaf strip cultures. When Arabidopsis leaf strips are incubated in a culture medium containing 1 mg/liter of the auxin analogue 2,4-dichlorophenoxyacetic acid, the cells start to proliferate very rapidly. [3H]Thymidine incorporation and Northern blot hybridization, performed with the histone H4 cDNA as a probe, have shown that 48 h after starting the culture most of the cells are in the S phase (40) (see also Fig. 8B). Using this experimental system, the highest CPDase mRNA level was found at 72 h (Fig. 8B), a time when a high number of cell divisions is observed.2 RNase A/T1 mapping, performed with the antisense RNA probe covering the coding region of the CPDase cDNA, also indicated that after 72-h incubation, the level of the CPDase mRNA is approximately five times higher than at the start of the culture (data not shown). The significance of this mRNA accumulation is not understood at present.

Cellular Localization of the CPDase Protein Studied by Indirect Immunofluorescence

The intracellular localization of the Arabidopsis CPDase was determined by an epitope tagging approach combined with indirect immunofluorescence. The coding sequence of the CPDase cDNA was cloned in a plant expression vector with an influenza hemagglutinin (flu) epitope fused in frame to the C terminus of the protein. The plasmid expressing the tagged protein was transfected into mesophyll protoplasts of N. plumbaginifolia. The protoplasts were processed for immunofluorescence microscopy, using a rabbit anti-flu polyclonal antibody and fluorescein isothiocyanate-conjugated goat anti-rabbit antibody. Indirect immunofluorescence showed that the protein is cytoplasmic (Fig. 9B). No staining was seen in untransfected protoplasts visible in the same field (A and B) or in mock-transfected protoplasts (data not shown). Transfected protoplasts (B), in which the nucleus was localized by staining with Hoechst 33258 (A), were also examined by confocal microscopy. The expressed tagged protein was clearly excluded from the nucleus and the chloroplasts (C). In control experiments, in which the flu tag was fused to the protein N-RBP43 known to be targeted to the nucleus,3 immunofluorescence was predominantly nuclear (D-F). These results indicate that the CPDase is a cytoplasmic protein.


Fig. 9. Immunolocalization of the CPDase in protoplasts of Nicotiana plumbaginifolia. Protoplasts were transfected with constructs pHATCPDase (A-C) and pNRBP43 (D-F) expressing the flu-epitope-tagged CPDase and the RNA binding nuclear protein, N-RBP43, respectively. The tagged proteins were immunoprobed with the polyclonal rabbit antibody HA-11, specific for the flu epitope. The fluorescein isothiocyanate-conjugated goat anti-rabbit antibody was used as a secondary antibody. Slides were examined with the Zeiss Axiophot microscope (A, B, D, and E) and the Leica confocal scanning laser microscope (C and F). A and D represent the same fields as B and E, respectively, but were visualized by staining with Hoechst 33258. The cell analyzed in C by confocal microscopy represents the transfected cell present in A and B. Bar represents 10 µm.
[View Larger Version of this Image (74K GIF file)]

The Arabidopsis CPDase Does Not Share Significant Sequence Similarity with Other Known Phosphodiesterases

A search of current sequence data bases did not reveal any proteins having significant sequence similarity with the Arabidopsis CPDase. The consensus signature motifs of 3',5'-cyclic nucleotide phosphodiesterases (41, 42) are not present in the Arabidopsis enzyme. Cyclic phosphodiesterases from brain (43, 44), and tRNA ligase (45), two proteins having 3'-phosphodiesterase activity, also have no significant similarity with the plant protein.


DISCUSSION

Removal of the 2'-phosphate group present in the products of tRNA splicing (see Introduction) is catalyzed by a specific phosphotransferase, first identified in yeast and vertebrates by Phizicky and co-workers (14, 15). In this reaction, the 2'-phosphate from tRNA is transferred to give a cyclic phosphate at the 1"-2" positions of NAD, yielding an unusual ADP-ribose derivative, Appr>p, and nicotinamide (16). Culver et al. (46) have recently cloned the gene encoding this enzyme in yeast and demonstrated that it is essential for viability. We describe here isolation of the Arabidopsis cDNA and properties of the encoded enzyme that metabolizes Appr>p to Appr-1"p. Phosphodiesterases that hydrolyze Appr>p to Appr-1"p have been previously characterized biochemically in both yeast and wheat (17). The purified wheat enzyme also hydrolyzes nucleoside 2',3'-cyclic phosphates in addition to Appr>p. The enzyme partially purified from yeast does not accept nucleoside 2',3'-cyclic phosphates as substrates, but otherwise, its properties are similar to that of the wheat protein (17).

Evidence presented here indicates that the protein encoded by the Arabidopsis cDNA and the protein purified previously from wheat (17, 18) are equivalent. Both enzymes have similar substrate specificity, showing preference for A>p, C>p, and Appr>p over U>p and G>p. Significantly, neither of the enzymes ring-opens the 2',3'-cyclic phosphate group of pG>p or at the terminus of an oligoribonucleotide (Ref. 18; this work), a property that distinguishes these enzymes from other known cyclic nucleotide 3'-phosphodiesterases (see below). The Arabidopsis and wheat proteins have similar molecular weights, show immunological cross-reactivity, and, based on the limited sequence information available for the wheat protein (Fig. 2), are structurally related. Finally, the reactions catalyzed by both enzymes have identical pH and temperature dependence and are similarily affected by various inhibitors.

Southern analysis has indicated that CPDase in Arabidopsis is encoded by a single copy gene (Fig. 7). In previous experiments, only single enzymatic activity for the hydrolysis of Appr>p has been observed upon fractionation of yeast extracts, while chromatography of the wheat germ extract on DEAE-cellulose yielded two pools of CPDase, having similar specificity toward N>p and Appr>p substrates (17, 18). It is not known whether the two active pools represent products of two separate genes or two forms of the same protein.

With respect to substrate specificity, the plant CPDase studied in this work is clearly different from that of other known proteins possessing cyclic 3'-phosphodiesterase activity. The RNA ligase involved in tRNA splicing, extensively characterized for yeast and wheat (see Introduction), efficiently hydrolyzes terminal 2',3'-cyclic phosphates in oligoribonucleotides (10, 47) but is only poorly active on 2',3'-cyclic mononucleotides (18). The vertebrate cyclic nucleotide phosphodiesterase (CNPase), isolated from brain, hydrolyzes 2',3'-cyclic phosphates in both mono- and oligoribonucleotides (48, 49) (for activity of CNPase with oligonucleotide substrates, see also Refs. 47 and 50). Most importantly, however, neither of the two enzymes mentioned above accepts Appr>p as a substrate (17), in marked contrast to the plant CPDase. Based on substrate specificity and generated products, the plant enzymes also differ from the broad specificity vertebrate cyclic phosphodiesterase described by Helfman and Kuo (51).

Consistant with the differences discussed above, the Arabidopsis CPDase does not have recognizable structural similarity or motifs in common with the phosphodiesterase domain of the tRNA ligase (52), with brain CNPase (43, 44), or with other known cyclic phosphodiesterases or RNases, acting on either nucleoside 3',5'- or 2',3'-phosphates (41, 53) or on inositol 1',2'-phosphate (54). Despite the fact that plant and yeast CPDase share many characteristics (17), a search of the yeast fully sequenced genome with the Arabidopsis protein sequence as a query did not identify a candidate gene coding for the CPDase in yeast. This is perhaps not surprising, seeing that even wheat and Arabidopsis sequences diverge considerably (Fig. 2). A search of the public data bases also did not reveal proteins having significant sequence similarity with the Arabidopsis enzyme. Thus, the CPDase characterized in this work belongs to a new group of cyclic phosphodiesterases.

The finding that the 3',5'-phosphodiester, 2'-phosphomonoester-forming pathway of RNA ligation is conserved in vertebrates, despite the fact that most of the tRNA splicing in these organisms proceeds via a different route (see Introduction), led to speculation that production of Appr>p or Appr-1"p may be important for the cell (2, 16, 17). Other ADP-ribose and NAD derivatives such as cyclic adenosine 5'-diphosphate ribose (cADPR) (55, 56) or nicotinic acid adenine dinucleotide phosphate (NAADP) (57, 58) are known to act as potent Ca2+ release agents in sea urchin eggs and microsomes and, as demonstrated for cADPR, also in mammalian and plant cells (59, 60). Using purified CPDase and chemically synthesized Appr>p, we have produced Appr-1"p, and both compounds were tested for calcium mobilizing activity in sea urchin egg homogenates. Neither Appr>p nor Appr-1"p were found to effect calcium release or modify calcium release induced by cADPR.4 Cloning of the cDNA from Arabidopsis should allow the use of reverse genetics to manipulate levels of CPDase in this organism and test whether Appr>p or Appr-1"p serve any regulatory function. Availability of this cDNA could also be of help in investigating a potential role of nucleoside 2',3'-cyclic phosphates or nucleoside 2'-phosphates in plants. Schildknecht (61) has reported that G>p and A>p may function as turgor-regulating leaf movement factors in mimosa plants.

It is equally possible that neither substrates or products of the plant CPDase are biologically active, and the CPDase is a catabolic enzyme channeling Appr>p and 2',3'-cyclic nucleotides, the latter being produced by degradation of cellular RNAs by cyclizing endoribonucleases (62-65), into respective degradation pathways (17, 18).


FOOTNOTES

*   The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Dagger    Supported by a long term EMBO fellowship. Present address: Inst. de Biologie Moléculaire des Plantes du C.N.R.S., 12 rue du Général Zimmer, 67084 Strasbourg, France.
   To whom correspondence should be addressed: Friedrich Miescher-Institut, P. O. Box 2543, 4002 Basel, Switzerland. Tel.: 41-61-69-741-28; Fax: 41-61-69-739-76; E-mail: filipowi{at}fmi.ch.
1   The abbreviations used are: Appr>p, ADP-ribose 1",2"-cyclic phosphate; Appr-1"p, ADP-ribose 1"-phosphate; Appr-2"p, ADP-ribose 2"-phosphate; N, any of four (A, G, C, U) nucleosides; pN, N3'p, N2'p, and N>p, nucleosides 5'-, 3'-, 2'-, and 2',3'-cyclic phosphate, respectively; pG>p, guanosine 5'-phosphate, 2',3'-cyclic phosphate; CIP, calf intestine phosphatase; CNPase, 2',3'-cyclic nucleotide 3'-phosphodiesterase; CPDase, cyclic phosphodiesterase; EST, expressed sequence tag; Mes, 2-(N-morpholino)ethanesulfonic acid; Mops, 3-(N-morpholino)propanesulfonic acid; HPLC, high pressure liquid chromatography; PAGE, polyacrylamide gel electrophoresis; PCR, polymerase chain reaction; RACE, rapid amplification of cDNA ends; TLC, thin layer chromatography.
2   P. Genschik, A. Durr, and J. Fleck, unpublished results.
3   M. Hemmings-Mieszczak, U. Klahre, and W. Filipowicz, unpublished results.
4   A. Galione and A. A. Genazzani, personal communication.

ACKNOWLEDGEMENTS

We thank the Arabidopsis Biological Resource Center at Ohio State University (Columbus, OH) for providing the Arabidopsis EST clone, S. Burkhardt for assistance with Appr>p synthesis, M. Swianiewicz and H. Ryan for assistance with some experiments, Dr. A. Galione (University of Oxford, Oxford, United Kingdom) for testing Appr>p and Appr-1"p for calcium release activity, Dr. J. Hofsteenge for valuable discussions, and Drs. F. Dragon and J. Hofsteenge for critical reading of the manuscript.


REFERENCES

  1. Phizicky, E. M., and Greer, C. (1993) Trends Biochem. Sci. 18, 31-34 [CrossRef][Medline] [Order article via Infotrieve]
  2. Westaway, S. K., and Abelson, J. (1995) in tRNA: Structure, Biosynthesis and Function (Soell, D., and RajBhandary, U. L., eds), pp. 79-92, American Society for Microbiology, Washington, D. C.
  3. Filipowicz, W., and Shatkin, A. J. (1983) Cell 32, 547-557 [CrossRef][Medline] [Order article via Infotrieve]
  4. Laski, F. A., Fire, A. Z., RajBhandary, U. L., and Sharp, P. A. (1983) J. Biol. Chem. 258, 11974-11980 [Abstract/Free Full Text]
  5. Peebles, C. L., Gegenheimer, P., and Abelson, J. (1983) Cell 32, 525-536 [CrossRef][Medline] [Order article via Infotrieve]
  6. Gandini-Attardi, D., Margarit, I., and Tocchini-Valentini, G. P. (1985) EMBO J. 4, 3289-3297 [Medline] [Order article via Infotrieve]
  7. Rauhut, R., Green, P. R., and Abelson, J. (1990) J. Biol. Chem. 265, 18180-18184 [Abstract/Free Full Text]
  8. Konarska, M., Filipowicz, W., Domdey, H., and Gross, H. J. (1981) Nature 293, 112-116 [CrossRef][Medline] [Order article via Infotrieve]
  9. Greer, C. L., Peebles, C. L., Gegenheimer, P., and Abelson, J. (1983) Cell 32, 537-546 [CrossRef][Medline] [Order article via Infotrieve]
  10. Phizicky, E. M., Schwartz, R. C., and Abelson, J. (1986) J. Biol. Chem. 261, 2978-2986 [Abstract/Free Full Text]
  11. Stange, N., and Beier, H. (1987) EMBO J. 6, 2811-2818 [Medline] [Order article via Infotrieve]
  12. Zillmann, M., Gorovsky, M. A., and Phizicky, E. M. (1991) Mol. Cell. Biol. 11, 5410-5416 [Abstract/Free Full Text]
  13. Nishikura, K., and DeRobertis, E. M. (1981) J. Mol. Biol. 145, 405-420 [CrossRef][Medline] [Order article via Infotrieve]
  14. McCraith, S. M., and Phizicky, E. M. (1991) J. Biol. Chem. 266, 11986-11992 [Abstract/Free Full Text]
  15. Zillmann, M., Gorovsky, M. A., and Phizicky, E. M. (1992) J. Biol. Chem. 267, 10289-10294 [Abstract/Free Full Text]
  16. Culver, G. M., McCraith, S. M., Zillmann, M., Kierzek, R., Michaud, N., LaReau, R. D., Turner, D. H., and Phizicky, E. M. (1993) Science 261, 206-208 [Abstract/Free Full Text]
  17. Culver, G. M., Consaul, S. A., Tycowski, K. T., Filipowicz, W., and Phizicky, E. M. (1994) J. Biol. Chem. 269, 24928-24934 [Abstract/Free Full Text]
  18. Tyc, K., Kellenberger, C., and Filipowicz, W. (1987) J. Biol. Chem. 262, 12994-13000 [Abstract/Free Full Text]
  19. Murashige, T., and Skoog, F. (1962) Physiol. Plant. 15, 473-497 [CrossRef]
  20. Nagy, J. J., and Maliga, P. (1976) Z. Pflanzenphysiol. 78, 453-455
  21. Ausubel, F., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (eds) (1990) Current Protoclos in Molecular Biology, Greene Publishing, New York
  22. Dumas, J. B., Edwards, M., Delort, J., and Mallet, J. (1991) Nucleic Acids Res. 19, 5227-5232 [Abstract/Free Full Text]
  23. Triglia, T., Peterson, M. G., and Kemp, D. J. (1988) Nucleic Acids Res. 16, 8186 [Free Full Text]
  24. Hall, T. C., Ma, Y., Buchbinder, B. U., Pyne, J. W., Sun, S. M., and Bliss, F. A. (1978) Proc. Natl. Acad. Sci. U. S. A. 75, 3196-3200 [Abstract/Free Full Text]
  25. Kiss, T., Kis, M., and Solymosy, F. (1989) Nucleic Acids Res. 17, 796 [Free Full Text]
  26. Chaboute, M. E., Chaubet, N., Philipps, G., Ehling, M., and Gigot, C. (1987) Plant Mol. Biol. 8, 179-191
  27. Nairn, C. J., Winesett, L., and Ferl, R. J. (1988) Gene (Amst.) 65, 247-257 [CrossRef][Medline] [Order article via Infotrieve]
  28. Murray, M. G., and Thompson, W. F. (1980) Nucleic Acids Res. 8, 4321-4325 [Abstract/Free Full Text]
  29. Feinberg, A. P., and Vogelstein, B. (1983) Anal. Biochem. 132, 6-13 [CrossRef][Medline] [Order article via Infotrieve]
  30. Kunkel, T. A., Roberts, J. D., and Zakour, R. A. (1987) Methods Enzymol. 154, 367-382 [Medline] [Order article via Infotrieve]
  31. Bradford, M. M. (1976) Anal. Biochem. 72, 248-254 [CrossRef][Medline] [Order article via Infotrieve]
  32. Polson, A., von Wechmar, M. B., and van Regenmortel, M. H. V. (1980) Immunol. Commun. 9, 475-493 [Medline] [Order article via Infotrieve]
  33. Hall, J., Genschik, P., and Filipowicz, W. (1996) Helv. Chim. Acta 79, 1005-1010 [CrossRef]
  34. Filipowicz, W., and Vicente, O. (1990) Methods Enzymol. 181, 499-510 [Medline] [Order article via Infotrieve]
  35. Hess, H. H., and Derr, J. E. (1975) Anal. Biochem. 63, 607-613 [CrossRef][Medline] [Order article via Infotrieve]
  36. Goodall, G. J., Wiebauer, K., and Filipowicz, W. (1990) Methods Enzymol. 181, 148-161 [Medline] [Order article via Infotrieve]
  37. Cairns, E., Gschwender, H. H., Primke, M., Yamakawa, M., Traub, P., and Schweiger, H. G. (1978) Proc. Natl. Acad. Sci. U. S. A. 75, 5557-5559 [Abstract/Free Full Text]
  38. Neuhaus, G., Neuhaus-Url, G., Gruss, P., and Schweiger, H. G. (1984) EMBO J. 3, 2169-2172 [Medline] [Order article via Infotrieve]
  39. Lütcke, H. A., Chow, K. C., Mickel, F. S., Moss, K. A., Kern, H. F., and Scheele, G. A. (1987) EMBO J. 6, 43-48 [Medline] [Order article via Infotrieve]
  40. Genschik, P., Jamet, E., Philipps, G., Parmentier, Y., Gigot, C., and Fleck, J. (1994) Plant J. 6, 537-546 [CrossRef][Medline] [Order article via Infotrieve]
  41. Bentley, J. K., and Beavo, J. A. (1992) Curr. Opin. Cell Biol. 4, 233-240 [CrossRef][Medline] [Order article via Infotrieve]
  42. Charbonneau, H., Breier, N., Walsh, K. A., and Beavo, J. A. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 9308-9312 [Abstract/Free Full Text]
  43. Kurihara, T., Takahashi, Y., Nishiyama, A., and Kumanishi, T. (1988) Biochem. Biophys. Res. Commun. 152, 837-842 [CrossRef][Medline] [Order article via Infotrieve]
  44. Monoh, K., Kurihara, T., Sakimura, K., and Takahashi, Y. (1989) Biochem. Biophys. Res. Commun. 165, 1213-1220 [CrossRef][Medline] [Order article via Infotrieve]
  45. Westaway, S. K., Phizicky, E. M., and Abelson, J. (1988) J. Biol. Chem. 263, 3171-3176 [Abstract/Free Full Text]
  46. Culver, G. M., McCraith, S. M., Consaul, S. A., Stanford, D. R., and Phizicky, E. M. (1997) J. Biol. Chem. 272, 13203-13210 [Abstract/Free Full Text]
  47. Pick, L., Furneaux, H., and Hurwitz, J. (1986) J. Biol. Chem. 261, 6694-6704 [Abstract/Free Full Text]
  48. Olafson, R. W., Drummond, G. I., and Lee, J. F. (1969) Can. J. Biochem. 47, 961-966 [Medline] [Order article via Infotrieve]
  49. Sims, N. R., and Carnegie, P. R. (1979) in Advances in Neurochemistry (Agranoff, B. W., and Aprison, M. H., eds), Vol. 3, pp. 1-41, Plenum Publishing Corp., New York
  50. Filipowicz, W., Konarska, M., Gross, H. J., and Shatkin, A. J. (1983) Nucleic Acids Res. 11, 1405-1418 [Abstract/Free Full Text]
  51. Helfman, D., M., and Kuo, J., F. (1982) J. Biol. Chem. 257, 1044-1047 [Abstract/Free Full Text]
  52. Apostol, B. L., Westaway, S. K., Abelson, J., and Greer, C. L. (1991) J. Biol. Chem. 266, 7445-7455 [Abstract/Free Full Text]
  53. Liu, J., and Beacham, I. R. (1990) Mol. & Gen. Genet. 222, 161-165
  54. Ross, T. S., Tait, J. F., and Majerus, P. W. (1990) Science 248, 605-607 [Abstract/Free Full Text]
  55. Clapper, D. L., Walseth, T. F., Dargie, P. J., and Lee, H. C. (1987) J. Biol. Chem. 262, 9561-9568 [Abstract/Free Full Text]
  56. Lee, H. C., Aarhus, R., and Levitt, D. (1994) Nat. Stuct. Biol. 1, 143-144 [CrossRef][Medline] [Order article via Infotrieve]
  57. Genazzani, A. A., Empson, R. M., and Galione, A. (1996) J. Biol. Chem. 271, 11599-11602 [Abstract/Free Full Text]
  58. Lee, H. C., and Aarhus, R. (1995) J. Biol. Chem. 270, 2152-2157 [Abstract/Free Full Text]
  59. Allen, G. J., Muir, S. R., and Sanders, D. (1995) Science 268, 735-737 [Abstract/Free Full Text]
  60. Galione, A., and White, A. (1994) Trends Cell Biol. 4, 431-436 [CrossRef][Medline] [Order article via Infotrieve]
  61. Schildknecht, H. (1983) Angew. Chem. Int. Ed. Engl. 22, 695-710 [CrossRef]
  62. Tang, W. J., and Maretzki, A. (1970) Biochim. Biophys. Acta 212, 300-307 [Medline] [Order article via Infotrieve]
  63. Torti, G., Mapelli, S., and Soave, C. (1973) Biochim. Biophys. Acta 324, 254-266 [Medline] [Order article via Infotrieve]
  64. McKeon, T. A., Lyman, M. L., and Prestamo, G. (1991) Arch. Biochem. Biophys. 290, 303-311 [CrossRef][Medline] [Order article via Infotrieve]
  65. Löffler, A., Abel, S., Jost, W., Beintema, J. J., and Glund, K. (1992) Plant Physiol. (Bethesda) 98, 1472-1478 [Abstract/Free Full Text]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.