Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Aligue, R.
Right arrow Articles by Russell, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Aligue, R.
Right arrow Articles by Russell, P.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


Volume 272, Number 20, Issue of May 16, 1997 pp. 13320-13325
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Regulation of Schizosaccharomyces pombe Wee1 Tyrosine Kinase*

(Received for publication, December 13, 1996, and in revised form, February 14, 1997)

Rosa Aligue Dagger , Lin Wu and Paul Russell §

From the Departments of Molecular Biology and Cell Biology, The Scripps Research Institute, La Jolla, California 92037

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

Wee1 tyrosine kinase regulates mitosis by carrying out the inhibitory tyrosine 15 phosphorylation of Cdc2 M-phase inducing kinase. Schizosaccharomyces pombe Wee1 is a large protein, consisting of a C-terminal catalytic domain of ~350 amino acids preceded by a N-terminal domain of ~550 residues. The functional properties of the Wee1 N-terminal domain were investigated by expressing truncated forms of Wee1 in S. pombe. Both positive and negative regulatory domains were identified. Sequences important for Wee1 function were mapped to a central region (residues 363-408). This region is not required for kinase activity or nuclear localization, suggesting it may be involved in substrate recognition. The negative regulatory domain resides in the N-terminal third of Wee1, Wee1 constructs lacking this domain are more effective at delaying mitosis than wild-type Wee1. The negative regulatory domain contains clusters of potential Cdc2 phosphorylation sites. Investigations to monitor the abundance of Wee1 mRNA and protein during the cell cycle were also carried out.


INTRODUCTION

A key aim of cell cycle investigations has been to fully describe the control mechanism that regulates the onset of mitosis, which is often referred to as the mitotic control. In recent years major advances have been made in understanding the mitotic control, largely as a result of the confluence of several experimental approaches, in particular genetic and in vivo biochemical studies carried out with the fission yeast Schizosaccharomyces pombe and in vitro biochemical studies carried out with extracts made from oocytes of the frog Xenopus laevis (1). These studies have led to the following understanding of the mitotic control. The initiation of mitosis is brought about by Cdc2 serine/threonine kinase, acting in obligatory association with one or more B-type cyclins. B-type cyclins that are involved in promoting mitosis are periodically destroyed upon exit from M-phase, thus progression through S and G2 is accompanied by a steady increase in the abundance of Cdc2-cyclin B complex. Activation of Cdc2 also requires phosphorylation of a threonine residue in the T-loop region (threonine 167 in S. pombe Cdc2), although this phosphorylation does not appear to have an important role in regulating the periodic activation of Cdc2 (2). Cdc2-cyclin B is maintained in a repressed state during interphase due to phosphorylation of a tyrosine residue in the N-terminal lobe of Cdc2 (3). In S. pombe phosphorylation of Cdc2 on tyrosine 15 is performed by Wee1 and Mik1 tyrosine kinases, with Wee1 having the dominant role (4-11). In animal cells this phosphorylation is carried out by Wee1 and Myt1 kinases, with the latter enzyme also phosphorylating the preceding threonine residue (7, 12-17). Dephosphorylation of these residues and consequent activation of Cdc2 is largely carried out by Cdc25 dual specificity phosphatase (18-24), although other phosphatases may weakly contribute to the activation of Cdc2-cyclin B (25, 26).

Wee1 and Cdc25, two of the major regulators of Cdc2-cyclin B kinase, are themselves regulated by phosphorylation (1). In S. pombe, Nim1 serine/threonine protein kinase contributes to the induction of mitosis by carrying out inhibitory phosphorylation of Wee1 (27-31). In Xenopus oocytes and human tissue culture cells, Wee1 is the subject of a separate form of inhibitory phosphorylation that occurs during M-phase (15, 32-34). This second mechanism of inhibitory regulation of Wee1 is either directly or indirectly controlled by Cdc2-cyclin B kinase. Cdc25 phosphatase undergoes activating phosphorylation during M-phase, also by a mechanism that is either directly or indirectly controlled by Cdc2 (35-43). This type of Cdc25 regulation has been demonstrated in mammalian tissue culture cell, Xenopus oocyte extracts, and S. pombe.

It has been proposed that the activating phosphorylation of Cdc25 and inhibitory phosphorylation of Wee1 that occurs during M phase may play an important part in promoting the onset of mitosis (1). In this positive feedback model, activation of a small fraction of Cdc2-cyclin B can be rapidly amplified into total activation by a process in which Cdc2-Cyclin B catalyzes stimulatory phosphorylation of Cdc25 and inhibitory phosphorylation of Wee1 (1). The rod-shaped fission yeast presents one of the best experimental systems to test this positive feedback model of mitotic control. In S. pombe the size at which cells initiate mitosis and undergo cell division is quite sensitive to the gene dose of wee1+, cdc25+, and nim1+, thus determination of cell length at division provides an easy measurement of mitotic timing (4, 5, 23, 30). In rich growth medium wild-type cells divide at ~15 µm in length, wee1- cells undergo division at approximately half the length of wild-type and exhibit a wee phenotype, whereas cells that have extra copies of wee1+ undergo division at longer cell lengths that are directly related to wee1+ gene dose (5).

This report deals with the function and regulation of Wee1 in S. pombe. Fission yeast Wee1 is a large protein, having a molecular mass of ~107 kDa (5). The protein kinase catalytic domain is confined to the C-terminal ~35 kDa of Wee1. Interestingly, the protein sequences of the large N-terminal domains of Wee1 homologs from S. pombe, the budding yeast Saccharomyces cerevisiae, the fruit fly Drosophila melanogaster, Xenopus, and humans are highly divergent (5, 15, 34, 44, 45). For this reason very little is known about which regions of Wee1 other than the catalytic domain are required for function in vivo. In vitro studies have shown that a truncated form of Wee1 containing only the ~35-kDa catalytic domain, produced in insect cells, is unable to phosphorylate Cdc2, although it is able to phosphorylate enolase, suggesting that some part of the N-terminal domain is important for substrate interaction (8). One feature that appears to be shared among Wee1 proteins from different species is a preponderance of serine-proline and threonine-proline dipeptides. SP and TP are the minimal consensus sequences for phosphorylation catalyzed by Cdc2 (46), thus one attractive model is that Cdc2 or another proline-directed protein kinase promotes the initiation of mitosis by carrying out inhibitory phosphorylation of Wee1. A key prediction of this model is that elimination of phosphorylation sites, either by truncation or mutation, should make Wee1 resistant to inhibition by phosphorylation and as a consequence the initiation of mitosis should be delayed or prevented.


EXPERIMENTAL PROCEDURES

Yeast Strains and Media, Genetic Methods, and Cell Length Measurements

S. pombe strains are all derived from 972h- and 975h+ (47). Procedures for genetic studies in S. pombe have been described (48). YES and synthetic EMM2 media were used to grow S. pombe cells (48). Cell size measurements were determined using an eyepiece micrometer attached to a Zeiss Axioskop 20 microscope with a 100 X objective.

Wee1 Truncation and Epitope Tag Constructs

The wee1+ open reading frame was amplified by PCR1 from pWee1-1 (5) using the 5' oligonucleotide 5'-CTCCATATGAGATCTTATGGCTTACGGCGGTCC-3' (NdeI site underlined) and the 3' oligonucleotide 5'-CAGCGGCCGCCAACATTCACCTGCCAATC-3' (NotI site underlined). The wee1+ NdeI-NotI fragment was inserted downstream of the thiamine-repressible nmt1 promoter in pREP1-Ha6H (28, 49). To create wee1-Delta 1 and wee1-Delta 3, 5' primers 5'-CTCCATATGAGATCTAATGCATCTACTGGTGTA-3' and 5'-CTCCATATGAGATCTTCCATGGACTTTTTGAGG-3' (NdeI sites underlined) were used separately with the 3' primer 5'-CAGCGGCCGCCAACATTCACCTGCCAATC-3' (NotI site underlined) to amplify fragments of wee1+. The NdeI-NotI fragments were cloned into pREP1-Ha6H. pREP1wee1-Delta 4, pREP1wee1-Delta 5, and pREP1wee1-Delta 11 plasmids were obtained by deletion of the region between two internal NcoI sites from pREP1wee1-Delta 3, pREP1wee1-Delta 1, and pREP1wee1+ plasmids, respectively. Plasmids pREP1wee1-Delta 2, pREP1wee1-Delta 6, and pREP1wee1-Delta 10 plasmids were obtained by deleting the region between two internal NsiI sites from pREP1wee1-Delta 1, pREP1wee1-Delta 5, and pREP1wee1+ plasmids, respectively. To create pREP1wee1-Delta 7, the wee1 933-1224 region from pREP1wee1-Delta 2 was obtained by PCR using the 5' oligonucleotide 5'-TAATGGACCTGTTAATCGAA-3' which hybridized to the nmt1 promoter and the 3' oligonucleotide: 5'-CACCCATGGGTTTTGAAGGAGTACT-3' (NcoI site underlined). The NdeI-NcoI fragment from this PCR reaction was cloned into pREP1wee1-Delta 4 that had been digested with NdeI and NcoI. To create pREPwee1-Delta 8, the wee1 1089-1224 fragment was obtained by PCR using the 5' primer 5'-CTCAGATCTGAGTTGTTAACTACTCCC (BglII site underlined) and the 3' oligonucleotide: 5'-CACCCATGGGTTTTGAAGGAGTACT-3' (NcoI site underlined). pREPwee1-Delta 8 was constructed by inserting the wee1 1089-1224 BglII-NcoI fragment into pREP1wee1-Delta 4. To create pREPwee1-Delta 9, the wee1 1-933 fragment was obtained by PCR using the nmt1 promoter oligonucleotide 5'-TAATGGACCTGTTAATCGAA-3' and the 3' oligonucleotide: 5'-CAAAAAGTCCATGGATGCATCCTTA-3' (NsiI and NcoI sites underlined). pREP1wee1-Delta 9 was constructed by inserting the wee1 1-933 NdeI-NcoI fragment into pREP1wee1+. Plasmid pREP1wee1-Delta 12 was constructed by blunt end ligation of pREP1wee1-Delta 2 that had been digested with NcoI and NotI. All nmt1:wee1 constructs were shuttled into pUR19-ars as PstI-EcoRI fragments. Plasmid pUR19-ars was created by removing the ClaI-ClaI ars fragment from pUR19. To generate single chromosomal copies of wee1 constructs under the control of wee1 promoter, BglII-KpnI fragments from pREPwee1-Delta 1, -Delta 2, -Delta 4, and -Delta 7 were mobilized into pWee1-10 (5). Then pWee1-10, -Delta 1, -Delta 2, -Delta 4, and -Delta 7 were digested with KpnI and integrated into a wee1-50/mik1::LEU2 strain (strain PR265). The resulting strains are RA1264, RA1265, RA1263, RA1266, and RA1262, respectively.

To create a strain in which genomic wee1+ encoded a protein having three copies of the HA epitope at the C terminus, we first created a plasmid encoding wee1+-3HA. This plasmid, pSP72, has a 5.7-kb EcoRI/XhoI fragment containing wee1+-3HA. At the 3' end of the wee1 open reading frame is the sequence, GTGATTGTTGGCGGCCGCATCTTTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTGCTGTCGACTAAACCTTT. The underlined sequence are NotI and SalI sites, respectively, which were created for the purpose of directional cloning of the 3HA sequence. The bold sequence encodes three consecutive copies of the HA epitope YPYDVPDYA (50), which was derived from pGTEP1 by PCR amplification. Sequence from wee1 immediately flanks the NotI and SalI sites; the TAA termination codon is italicized. The 5.7-kb EcoRI/XhoI fragment from pSP72 was used to transform a wee1::ura4+ strain (PR47) along with the leu1-32 complementing co-transformation plasmid pART1. Ura- Leu+ transformants were identified and confirmed to have replaced wee1::ura4+ with wee1+-3HA by Southern hybridization and immunoblotting. Strain LW1585 (wee1-3Ha leu1-32 ura4-D18) was used in this study.

Immunoblotting

Frozen cell pellets were thawed and resuspended in ice-cold LYSIS-1 buffer (50 mM Tris, pH 8.0, 150 mM NaCl, 5 mM EDTA, 10% glycerol, 1 mM phenylmethylsulfonyl fluoride, 5 µg/ml each of leupeptin, pepstatin, and aprotinin). Chilled glass beads were added to the meniscus and cells were broken by vigorous shaking in a vortexer for 5 min at 4 °C. The cell extract was collected and then centrifuged at 14,000 rpm in a Eppendorf Microfuge at 4 °C for 15 min. The concentration of cell extracts was estimated by determining OD280 and then normalized by adding LYSIS-1 buffer. Immunoblots were probed with anti-HA (12CA5) monoclonal antibodies, anti-Wee1 (number 7451), or anti-Cdc2 (number 1267) rabbit polyclonal antibodies (51). Immunoblots were subsequently incubated with anti-rabbit or anti-mouse IgG antibodies and signals were visualized using the ECL detection system (Amersham). Wee1-Ha6H protein was purified in denaturing conditions using Ni-NTA-agarose beads (Qiagen) according to the manufacturer's protocol. This involved breakage of cells in highly denaturing buffer G (6 M guanidine hydrochloride, 0.1 M sodium phosphate, 50 mM Tris-HCl, pH 8.0) and therefore no phosphatase or protease inhibitors were added.

Northern Hybridization Analysis

Cell pellets were resuspended in HE buffer (50 mM Hepes-NaOH, pH 7.9, 5 mM Na2EDTA, 100 mM NaCl) and cells were lysed by vortexing at 4 °C in the presence of glass beads. Supernatants were transferred to tubes containing an equal volume of HES buffer (200 mM Hepes-NaOH, pH 7.9, 10 mM Na2EDTA, 200 mM NaCl, 2% SDS) and incubated at 37 °C for 1 h. RNA was purified by phenol/chloroform extraction and ethanol precipitation. Pellets were resuspended in water and RNA concentration was determined by measuring absorbance at 260 nm. Equivalent amounts of total RNA were loaded onto agarose/formaldehyde gels run and transferred to nylon membranes. Probe was made from the 8-kb genomic fragment containing wee1 and flanking sequences in the plasmid pWEE1-1 (5).

Immunofluorescence Microscopy

A 30% (w/v) solution of paraformaldehyde was dissolved into 20 ml of PEM buffer (100 mM Pipes, pH 6.9, 1 mM EGTA, 1 mM MgSO4) by incubation at 65 °C for 30 min. This solution was diluted 10-fold into a growing culture to fix cells. After 1 h, cells were collected and washed in PEM. Cells were resuspended into PEMS (PEM + 1 M sorbitol) with 0.625 mg/ml Zymolyase-20T (20,000 units/g, Seikagaku Corp.), 0.1 mg/ml NovoZymTM (Novo), and incubated for 0.5 to 1 h at 37 °C. Cells were collected and resuspended into PEMS supplemented with 1% Triton X-100 for 1 min. Cells were then washed three times with PEM and incubated in PEMBAL (1% bovine serum albumin, 0.1% sodium azide, 100 mM L-lysine monohydrochloride, pH 6.9) for 1 h at room temperature. Affinity purified anti-Wee1 (number 7451) antibodies were added in PEMBAL and the samples were incubated overnight at room temperature. After washing three times with PEMBAL, cells were incubated for 1 h at room temperature in PEMBAL containing fluorescein isothiocyanate-conjugated goat anti-rabbit IgG antibody (1/50 dilution) and RNase A (200 µg/ml). After the final wash with PEMBAL, samples were resuspended in phosphate-buffered saline containing 0.1% sodium azide and 4 µg/ml propidium iodide. SlowFadeTM Antifade Kit (Molecular Probes, Inc.) was used for mounting.


RESULTS

Identification of a Central Region of Wee1 Protein That Is Critical for in Vivo Function

The major aim of this study was to evaluate the functional and regulatory roles of the N-terminal domain of Wee1. As shown in Fig. 1, the protein kinase catalytic domain of Wee1 occupies the C-terminal third of the 881-amino acid protein. There are 15 serine-proline or threonine-proline dipeptides located in the N-terminal 300 amino acids of Wee1; these are potential sites of inhibitory phosphorylation carried out by Cdc2-Cyclin B or other proline-directed kinases. A series of wee1 constructs encoding proteins having N-terminal truncations or internal deletions were produced (see "Experimental Procedures") and placed under the control of the thiamine (vitamin B1)-repressible nmt1 promoter (49). Plasmids containing these constructs were integrated at the wee1 locus in wild-type and wee1-50 mik1::ura4+ strains, in each case leaving the genomic copy of wee1+ or wee1-50 intact. Note that wee1-50 is a temperature-sensitive mutation, thus wee1-50 mik1::ura4+ cells are viable and only slightly smaller than wild-type at the permissive temperature of 25 °C, but undergo mitotic catastrophe when incubated at temperatures above 30 °C (11). Southern hybridization analysis confirmed that these strains contained a single integrated copy of the plasmids. At the outset we noticed that the full-length version of nmt1:wee1+ caused a moderate cell elongation phenotype in the wee1-50 Delta mik1 background when these cells grown in medium that represses the nmt1 promoter (Fig. 1). Septated cells were ~21 µm in length, versus ~15 µm for wild-type cells. This suggests that the repressed nmt1+ promoter is severalfold more active than the wee1+ promoter, underscoring the fact that wee1+ expression is normally quite low.


Fig. 1. Map of nmt1:wee1 truncation constructs and table of phenotypes. The linear map of the 881-amino acid Wee1 polypeptide and extent of various truncation and/or deletions is shown at the right. Numbers refer to amino positions that correspond to various truncation and internal deletion positions. Protein kinase domain (gray area) refers to the region having homology to catalytic regions of serine/threonine protein kinases. Black area indicates 363-408 region that when fused to the catalytic domain (construct wee1-Delta 8) restores ability to cause cdc arrest when overproduced from nmt1 promoter and to rescue wee1-50 Delta mik1 mitotic catastrophe when grown in nmt1 repressing medium. Hatched area indicates the region that when deleted (construct wee1-Delta 9) severely comprises the ability of Wee1 protein to inhibit mitosis. Constructs were integrated at single copy into wild-type and wee1-50 Delta mik1 backgrounds. Phenotypes were evaluated in nmt1 derepressing conditions ("on") and repressing conditions ("off"). Integrants in the wild-type background were grown at 30 °C, integrants in the wee1-50 Delta mik1 background were grown at 35.5 °C. Phenotypes were scored and classified into the following categories: approximately wild-type in length (~14 µm) at division, approximately 50% longer than wild-type (~21 µm) at division, approximately 100% longer than wild-type (~28 µm) at division, cells underwent cell division arrest (cdc), cells underwent division at an extremely small size and exhibited a typical mitotic catastrophe phenotype (mc) as described previously (11, 23), strain not constructed and phenotype not determined (n.d.).
[View Larger Version of this Image (27K GIF file)]

Most of the wee1 constructs caused cell cycle arrest when expressed from the induced nmt1 promoter in the wild-type and wee1-50 Delta mik1 backgrounds. These included the wee1-Delta 2 construct, which lacked the N-terminal 310 amino acids, as well as the wee1-Delta 7 construct, which lacked the N-terminal 310 and internal 408-520 amino acids (Fig. 1). Constructs which failed to cause a cell cycle arrest when highly overexpressed included wee1-Delta 3, which lacked the N-terminal 460 amino acids, wee1-Delta 4, which lacked the N-terminal 520 amino acids, and wee1-Delta 9, which lacked the internal 310-460 amino acids. The failure of constructs such as wee1-Delta 3 to cause cell cycle arrest could not be attributed to a problem with protein expression; in fact, the amount of Wee1 protein detected in cells expressing inactive constructs such as wee1-Delta 3 and wee1-Delta 4 was much higher than in cells expressing active constructs such as wee1-Delta 1 and wee1-Delta 2 (Fig. 2), which in turn expressed higher levels of Wee1 protein than cells expressing full-length wee1+ from the nmt1 promoter.2 It appears that cells expressing active Wee1 constructs experience growth defects caused by a massive increase in size long before the nmt1 promoter is fully derepressed, this may explain why inactive Wee1 constructs appear to be more abundant that active Wee1 constructs. It is also possible the shorter Wee1 constructs are more stable proteins. Nor could the properties of inactive constructs be attributed to loss of kinase activity per se, as the minimal catalytic domain of Wee1 (residues 520-877, equivalent to wee1-Delta 4), when produced in an insect cell expression system, retains vigorous autophosphorylation activity (8). This finding was confirmed for the wee1-Delta 3 and wee1-Delta 4 constructs expressed in S. pombe, which also retained vigorous autophosphorylation activity.2 It should be noted that high overexpression of even the wee1-Delta 3, wee1-Delta 4, and wee1-Delta 9 constructs caused a moderate elongation of cell length at division in wild-type cells and these constructs were able to rescue wee1-50 Delta mik1 (Fig. 1), indicating that these truncated forms of Wee1 were not completely inactive in vivo.


Fig. 2. Immunoblot detection of Wee1 constructs. N-terminal truncation constructs were expressed for 16 h in derepressing medium (EMM2 without B1) at 30 °C or maintained in repressing medium (EMM2 with thiamine). Total protein extracts were analyzed by immunoblotting using anti-Wee1 antibody. The Wee1-Delta 3 and Wee1-Delta 4 proteins were highly abundant, showing that their inability to cause cdc arrest was not for lack of expression.
[View Larger Version of this Image (88K GIF file)]

The inability of the wee1-Delta 9 construct to cause cell cycle arrest when expressed from the nmt1 promoter strongly suggested that amino acids 310-460 are critical for Wee1 function in vivo. Indeed, construct wee1-Delta 6, which consists of the 310-460 region fused to the catalytic domain (residues 520-881), was able to cause cell cycle arrest when overexpressed from the nmt1 promoter (Fig. 1). The important sequences in the 310-460 region were further delineated by testing the activity of the wee1-Delta 7 construct, which contained amino acids 310-408 fused to the catalytic domain (Fig. 1). This construct also was active, causing cell cycle arrest when overexpressed from the nmt1 promoter and rescuing wee1-50 Delta mik1 when cells were grown in nmt1 repressing medium. We finally tested the activity of construct wee1-Delta 8, which contained amino acids 363-408 fused to C-terminal protein kinase domain. This construct also caused cell cycle arrest when expressed from the nmt1 promoter and rescued wee1-50 Delta mik1 when cells were grown in nmt1 repressing medium (Fig. 1). These findings indicate that N-terminal sequences that are critical for Wee1 function are located in the 363-408 amino acid region.

The Critical Central Region of Wee1 Is Not Required for Proper Localization of Wee1 Protein

Cdc2-Cdc13 complex is predominantly and perhaps exclusively localized in the nucleus during G2 (52-54). We therefore expected that Wee1 would also be a nuclear protein. This was investigated by carrying out immunolocalization studies of Wee1. Anti-Wee1 antibodies produced no signal in wild-type cells, presumably because of the very low abundance of Wee1 protein. To circumvent this problem we overexpressed wee1-K596L, which encodes a catalytically inactive form of Wee1 (6, 55). Staining with anti-Wee1 antibodies produced a strong signal that closely coincided with the nuclear DNA signal produced by staining with DAPI (Fig. 3, top panels). The nmt1:wee1K596L construct was expressed from an episomal plasmid that was frequently lost during mitotic divisions, therefore only a subset of cells stained with the anti-Wee1 antibody. These observations indicate that Wee1 protein is localized in the nucleus, a finding consistent with immunolocalization studies of overexpressed Wee1 protein encoded by wee1-50 (56).


Fig. 3. Immunolocalization of Wee1 in S. pombe. Cells transformed with episomal plasmids containing nmt1:wee1-K596L (top panels), nmt1:wee1-Delta 4 (middle panels), and nmt1:wee1-Delta 9 (lower panels) were grown in nmt1 derepressing medium, fixed, stained with 4',6-diamidino-2-phenylindole to detect DNA and anti-Wee1 antibody to detect Wee1 protein. Wee1-K596L protein was predominantly localized in the nucleus, whereas Wee1-Delta 4 was dispersed throughout the cell and may be less abundant in the nucleus. In contrast, Wee1-Delta 9 was predominantly localized in the nucleus, showing that amino acids 310-460 are not essential for nuclear localization.
[View Larger Version of this Image (56K GIF file)]

The critical central region of Wee1 contains a stretch of basic amino acids 387-LSKQHRPRKNT-397 (basic residues underlined) that potentially could be involved in directing the nuclear localization of Wee1 (57). This possibility was initially supported by the observation that Wee1-Delta 4 protein, which consists only of the catalytic domain of Wee1, was predominantly localized in the cytoplasm (Fig. 3, middle panels). Immunolocalization analysis of Wee1-Delta 9 protein, which specifically lacks the critical central region together with some flanking sequence (Fig. 3, bottom panels), provided a more direct test of this hypothesis. This analysis showed that Wee1-Delta 9 protein was predominantly localized to the nucleus, producing a signal that was very similar to that observed with Wee1-K596L. These findings suggest that the 363-408 amino acid region is not essential for nuclear localization, although it may be capable of promoting nuclear localization in vivo.

The Region Comprising the N-terminal ~300 Amino Acids of Wee1 Has a Negative Effect on Total Wee1 Activity in Vivo

The nmt1:wee1 truncation and deletion constructs divided into four classes when assayed for their ability to rescue wee1-50 Delta mik1 in nmt1-repressing medium (Fig. 1). The wee1-Delta 3 and wee1-Delta 4 constructs failed to rescue wee1-50 Delta mik1, constructs wee1-Delta 6, -Delta 7, and -Delta 8 rescued but did not cause an elongated phenotype; full-length wee1+ caused cells to divide at ~21 µm, whereas three of the constructs having an N-terminal deletion (i.e. wee1-Delta 1, -Delta 2, and -Delta 5) caused cell elongation phenotype that was more severe than that caused by full-length wee1+. The phenotypes caused by the wee1-Delta 1, -Delta 2, and -Delta 5 constructs suggested that the N-terminal domain of Wee1 might have an inhibitory effect on Wee1 activity. This was more carefully investigated by integrating a subset of wee1 truncation constructs, expressed from the wee1+ promoter, into a wee1-50 Delta mik1 background. Integrants were analyzed by Southern hybridization to confirm that they has a single copy of the wee1 truncation constructs. The activity of the constructs was first assayed by determining whether they rescued the mitotic catastrophe phenotype observed in wee1-50 Delta mik1 cells incubated at the restrictive temperature of 35.5 °C. The wee1-Delta 4 construct failed to rescue the mitotic catastrophe phenotype, whereas the wee1-Delta 1, wee1-Delta 2, and wee1-Delta 7 constructs complemented the defect (Table I). These findings are consistent with the behavior of the nmt1:wee1 constructs as described in Fig. 1. Cell size measurements were then carried out with cultures grown at 25 °C. This analysis showed that cells having single integrated copies of wee1-Delta 1, wee1-Delta 2, or wee1-Delta 7 were significantly longer at division (22.4 ± 1.0, 23.9 ± 1.2, and 21.6 ± 0.9 µm, respectively), than were cells having a single integrated copy of wee1+ (16.8 ± 2.4 µm). On average the cells expressing the activated truncation alleles of wee1 were 35% larger than cells expressing wee1+. These findings show that truncation of the N-terminal ~300 amino acids of Wee1 results in a greater amount of Wee1 activity in vivo. This may be due either to increased specific activity of Wee1 or to greater stability of Wee1 protein.

Table I. Single copy integrants in a wee1-50 mik1::LEU2 background


25 °C 35 °C

Control 16.1  ± 1.2 µm Mitotic catastrophe
Wee1+ 16.8  ± 2.4 µm Viable
Wee1-Delta 1 22.4  ± 1.0 µm Viable
Wee1-Delta 2 23.9  ± 1.2 µm Viable
Wee1-Delta 4 15.9  ± 0.9 µm Mitotic catastrophe
Wee1-Delta 7 21.6  ± 0.9 µm Viable

Measurements of the Abundance of wee1+ mRNA and Wee1 Protein during the Cell Cycle

The timing of mitosis is very sensitive to the gene dose of wee1+, therefore periodic changes in the cellular concentration of Wee1 would be predicted to affect mitotic timing. For this reason a secondary aim of our studies was to determine whether the amount of wee1 mRNA or Wee1 protein change during the cell cycle. We first measured wee1 mRNA expression during the cell cycle. A synchronous culture of wild-type cells was prepared by centrifugal elutriation. This method separates cells on the basis of size, generating a pure population of small cells that are in early G2 (58). These cells were cultured for two cell cycles. At regular intervals samples were collected for RNA preparation and Northern blot analysis. Cell cycle periodicity was monitored by counting the septation index. In agreement with previous studies (5), two wee1 specific mRNA transcripts were detected, a more prominent ~4.0-kb species and a less abundant ~3.4-kb form (Fig. 4). As expected, these mRNA species were absent in a strain in which the wee1+ open reading frame was replaced with the ura4+ gene (wee1::ura4+). As shown in Fig. 4, the level of wee1+ mRNA did not appear to fluctuate during two synchronous rounds of division.


Fig. 4. Northern blot analysis of wee1 mRNA abundance during the cell cycle. A synchronous culture of wild-type cells (PR109) was produced by centrifugal elutriation; cell cycle synchrony was monitored by counting the septation index (lower panel). The Northern blot was probed with the 5-kb EcoRI/XhoI DNA fragment covering the wee1 open reading frame and ~1.5 kb of downstream flanking sequence (upper panel). Lane 0 contains RNA from a wee1::ura4+ strain, showing that ~4.0-kb mRNA and a less abundant ~3.4-kb species are derived from wee1. A smaller mRNA species from an adjacent gene was detected with the probe and thus served as one loading control; the Northern blot was also probed with adh1 probe to confirming equal loading. The abundance of wee1 mRNA species appeared constant during the cell cycle.
[View Larger Version of this Image (62K GIF file)]

Experiments designed to monitor the abundance of Wee1 protein during the cell cycle were problematic because of the extreme paucity of Wee1 protein. Wild-type levels of Wee1 could not be reliably detected by standard immunoblotting methods. Wee1 is a dose-dependent inhibitor of mitosis, therefore the Wee1 detection problem could not be solved by increasing wee1+ copy number. We initially solved this problem by creating a strain in which the genomic copy of wee1+ was replaced with a version of wee1+ that encoded Wee1 protein having an C-terminal extension consisting of three copies of the Ha epitope, which is recognized by 12CA5 monoclonal antibodies (anti-Ha). Cell size was not noticeably affected by the replacement of wild-type wee1+ with the wee1+-3HA allele. A synchronous culture of the wee1+-3HA strain was made by centrifugal elutriation. Immunoblot analysis showed that a Wee1 signal was present throughout the cell cycle, but it appeared to undergo a moderate oscillation (Fig. 5). The Wee1 signal was highest in samples 1-3 and 7-11, these samples correspond to S and G2 phases. In the first cell cycle the initial decrease in the Wee1 signal, occurring in samples 3-4, immediately preceded the rise in septation index. Septation follows the onset of mitosis in S. pombe, thus the decrease in the Wee1 signal closely corresponds to M and G1 phases.


Fig. 5. Immunoblot analysis of Wee1 protein during the cell cycle. This experiment used a strain (LW1585) in which the genomic wee1+ encoded Wee1 protein having three copies of the HA epitope at the C terminus of the protein. A synchronous culture of these cells was produced by centrifugal elutriation; cell cycle synchrony was monitored by counting the septation index (lower panel). The immunoblot was probed with anti-HA monoclonal antibody 12CA5 (top panel) and anti-Cdc2 polyclonal antibody (middle panel). Lane 0 contains protein extract from a wild-type strain which produces untagged Wee1. The Wee1 signal appeared to oscillate during the two cell cycles, being lowest in the samples corresponding to M and/or G1.
[View Larger Version of this Image (34K GIF file)]


DISCUSSION

In this study we have focused on several key issues relevant to the structure and function of S. pombe Wee1 tyrosine kinase. One aim of our studies was to identify regions of the Wee1 N-terminal noncatalytic domain that are important for Wee1 function in vivo. As noted above, there are no obvious sequence homologies between N-terminal domains of Wee1-like proteins isolated from divergent species, therefore it was unclear which sequences of the N-terminal domain would have functional importance. In fact, our studies indicate that only a small region of the N-terminal domain is of critical importance. By testing various N-terminal truncations and internal deletions the critical region was initially localized to amino acids 310-460. We proceeded to show that the wee1-Delta 8 construct, containing only residues 363-408 fused to the catalytic domain (residues 520-881), retained the ability to cause cdc arrest when overexpressed from the derepressed nmt1 promoter. Moreover, wee1-Delta 8 also rescued wee1-50 Delta mik1 mitotic catastrophe when expressed from the repressed nmt1 promoter.

What function is provided by the 363-408 region of Wee1? Previous studies showed that a purified ~37-kDa C-terminal construct of Wee1 was able to phosphorylate enolase but not Cdc2-cyclin B in vitro (8). In contrast, purified full-length Wee1 phosphorylated Cdc2 (when complexed to cyclin B) but did not phosphorylate enolase (8). These results strongly suggest that the Wee1 N-terminal regulatory sequences are not required for Wee1 protein kinase activity per se. Our in vivo studies extend these findings by showing that the wee1-Delta 4 construct, which encodes the same protein as the aforementioned ~37-kDa Wee1 truncation, is extremely defective at inhibiting mitosis in vivo. Fusion of the 363-408 region to ~37 kDa Wee1 restores in vivo mitotic inhibition activity to a level that is near wild-type levels. It is likely that the 363-408 sequence is important for substrate recognition. In this regard it is worth recalling that previous in vitro studies showed that monomeric Cdc2 is a very poor substrate for Wee1, whereas Wee1 readily phosphorylates Cdc2 that is bound to cyclin B (8). This raises the question of whether cyclin-B forms all or part of the structure recognized by Wee1, or whether the primary affect of cyclin B is to induce a conformational change in the structure of Cdc2 such that the region encompassing tyrosine 15 is exposed to Wee1 (and Cdc25).

A second major aim of our studies was to determine whether the N-terminal region of Wee1 contains domains of inhibitory regulation and to evaluate the affect of deleting those domains on the mitotic control. We found that truncation of amino acids 1-153 or 1-310 (wee1-Delta 1 and wee1-Delta 2) led to a delay of the onset of mitosis, as shown by an increase of the length of cells at division. This was observed both for cells having nmt1:wee1 constructs that were grown in nmt1 repressing conditions, as well as for cells having single integrated copies of the wee1 constructs expressed from the wee1 promoter. The observed cell elongation is roughly equivalent to that observed in cells carrying 2-3 extra copies of wee1+ integrated at the wee1+ locus (5). Thus we may surmise that by truncating Wee1 we have interfered with the mechanism of mitotic timing. None of the constructs caused a cell cycle arrest when expressed from the wee1+ promoter at single copy. This may indicate that negative regulation of Wee1 mediated through the N-terminal domain has a modulatory effect but is not essential for the induction of mitosis. As noted above, our findings do not necessarily imply that the specific activity of Wee1 is increased by truncation of the N-terminal region of Wee1, since it is also possible that the truncation stabilizes Wee1 protein, leading to an increased level of Wee1 kinase in vivo.

A third aim of our studies was to provide some basic information about the regulation of wee1+ mRNA and protein expression during the cell cycle. We found that the wee1+ mRNA Northern blot signal did not fluctuate during the cell cycle, whereas the Wee1 protein immunoblot signal did undergo a moderate oscillation. The decrease in the Wee1 immunoblot signal appeared to coincide with M-phase, thus our data suggest that Wee1 might be degraded during this phase of the cell cycle. Experiments are currently underway to determine whether Wee1 is destabilized in cells that are arrested in M-phase. Our data do not suggest that Wee1 abundance changes prior to the onset of mitosis, thus we do not believe that oscillation of Wee1 protein plays a role in determining the timing of mitosis.


FOOTNOTES

*   This work was supported in part by a grant from the National Institutes of Health (GM41281) (to P. R.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Dagger    Recipient of postdoctoral fellowships from EMBO and MEC/Spain. Current address: Dept. Biologia Cellular Facultat De Medicina, Universitat De Barcelona, Barcelona, Spain.
§   To whom correspondence should be addressed. Tel.: 619-784-8273; Fax: 619-784-2265; E-mail: prussell{at}riscsm.scripps.edu.
1   The abbreviations used are: PCR, polymerase chain reaction; kb, kilobase(s); Pipes, 1,4-piperazinediethanesulfonic acid.
2   R. Aligue and P. Russell, unpublished observations.

ACKNOWLEDGEMENTS

We thank Clare McGowan, Odile Mondesert, and Kazuhiro Shiozaki and all members of the Scripps Cell Cycle Groups for their advice and encouragement. We thank G. Feiser and Ian Wilson for antibody reagents, George Tokiwa and Bruce Futcher for pGTEP1, and Kinsey Maundrell for pREP and pRIP plasmids.


REFERENCES

  1. Dunphy, W. G. (1994) Trends Cell Biol. 4, 202-207 [CrossRef][Medline] [Order article via Infotrieve]
  2. Gould, K. L., Moreno, S., Owen, D. J., Sazer, S., and Nurse, P. (1991) EMBO J. 10, 3297-3309 [Medline] [Order article via Infotrieve]
  3. Gould, K. L., and Nurse, P. (1989) Nature 342, 39-45 [CrossRef][Medline] [Order article via Infotrieve]
  4. Nurse, P. (1975) Nature 256, 547-551 [CrossRef][Medline] [Order article via Infotrieve]
  5. Russell, P., and Nurse, P. (1987) Cell 49, 559-567 [CrossRef][Medline] [Order article via Infotrieve]
  6. Featherstone, C., and Russell, P. (1991) Nature 349, 808-811 [CrossRef][Medline] [Order article via Infotrieve]
  7. McGowan, C. H., and Russell, P. (1993) EMBO J. 12, 75-85 [Medline] [Order article via Infotrieve]
  8. Parker, L. L., Atherton-Fessler, S., and Piwnica-Worms, H. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 2917-2921 [Abstract/Free Full Text]
  9. Parker, L. L., Atherton-Fessler, S., Lee, M. S., Ogg, S., Falk, J. L., Swenson, K. I., and Piwnica-Worms, H. (1991) EMBO J. 10, 1255-1263 [Medline] [Order article via Infotrieve]
  10. Lee, M. S., Enoch, T., and Piwnica-Worms, H. (1994) J. Biol. Chem. 269, 30530-30537 [Abstract/Free Full Text]
  11. Lundgren, K., Walworth, N., Booher, R., Dembski, M., Kirschner, M., and Beach, D. (1991) Cell 64, 1111-1122 [CrossRef][Medline] [Order article via Infotrieve]
  12. Parker, L. L., and Piwnica-Worms, H. (1992) Science 257, 1955-1957 [Abstract/Free Full Text]
  13. Norbury, C., Blow, J., and Nurse, P. (1991) EMBO J. 10, 3321-3329 [Medline] [Order article via Infotrieve]
  14. Krek, W., and Nigg, E. A. (1991) EMBO J 10, 305-316 [Medline] [Order article via Infotrieve]
  15. Mueller, P. R., Coleman, T. R., and Dunphy, W. G. (1995) Mol. Biol. Cell 6, 119-134 [Abstract]
  16. Mueller, P. R., Coleman, T. R., Kumagai, A., and Dunphy, W. G. (1995) Science 270, 86-90 [Abstract/Free Full Text]
  17. Campbell, S. D., Sprenger, F., Edgar, B. A., and O'Farrell, P. H. (1995) Mol. Biol. Cell 6, 1333-1347 [Abstract]
  18. Dunphy, W. G., and Kumagai, A. (1991) Cell 67, 189-196 [CrossRef][Medline] [Order article via Infotrieve]
  19. Gautier, J., Solomon, M. J., Booher, R. N., Bazan, J. F., and Kirschner, M. W. (1991) Cell 67, 197-211 [CrossRef][Medline] [Order article via Infotrieve]
  20. Kumagai, A., and Dunphy, W. G. (1991) Cell 64, 903-914 [CrossRef][Medline] [Order article via Infotrieve]
  21. Lee, M. S., Ogg, S., Xu, M., Parker, L. L., Donoghue, D. J., Maller, J. L., and Piwnica-Worms, H. (1992) Mol. Biol. Cell 3, 73-84 [Abstract]
  22. Millar, J. B. A., McGowan, C. H., Lenaers, G., Jones, R., and Russell, P. (1991) EMBO J. 10, 4301-4309 [Medline] [Order article via Infotrieve]
  23. Russell, P., and Nurse, P. (1986) Cell 45, 145-153 [CrossRef][Medline] [Order article via Infotrieve]
  24. Strausfeld, U., Labbe, J. C., Fesquet, D., Cavadore, J. C., Picard, A., Sadhu, K., Russell, P., and Doree, M. (1991) Nature 351, 242-245 [CrossRef][Medline] [Order article via Infotrieve]
  25. Mondesert, O., Moreno, S., and Russell, P. (1994) J. Biol. Chem. 269, 27996-27999 [Abstract/Free Full Text]
  26. Millar, J. B. A., Lenaers, G., and Russell, P. (1992) EMBO J. 11, 4933-4941 [Medline] [Order article via Infotrieve]
  27. Coleman, T. R., Tang, Z., and Dunphy, W. G. (1993) Cell 72, 919-929 [CrossRef][Medline] [Order article via Infotrieve]
  28. Wu, L., and Russell, P. (1993) Nature 363, 738-741 [CrossRef][Medline] [Order article via Infotrieve]
  29. Parker, L. L., Walter, S. A., Young, P. G., and Piwnica-Worms, H. (1993) Nature 363, 736-738 [CrossRef][Medline] [Order article via Infotrieve]
  30. Russell, P., and Nurse, P. (1987) Cell 49, 569-576 [CrossRef][Medline] [Order article via Infotrieve]
  31. Feilotter, H., Nurse, P., and Young, P. (1991) Genetics 127, 309-318 [Abstract]
  32. Tang, Z., Coleman, T. R., and Dunphy, W. G. (1993) EMBO J. 12, 3427-3436 [Medline] [Order article via Infotrieve]
  33. McGowan, C. H., and Russell, P. (1995) EMBO J. 14, 2166-2175 [Medline] [Order article via Infotrieve]
  34. Watanabe, N., Broome, M., and Hunter, T. (1995) EMBO J. 14, 1878-1891 [Medline] [Order article via Infotrieve]
  35. Kumagai, A., and Dunphy, W. G. (1992) Cell 70, 139-151 [CrossRef][Medline] [Order article via Infotrieve]
  36. Kumagai, A., and Dunphy, W. G. (1995) Mol. Biol. Cell 6, 199-213 [Abstract]
  37. Izumi, T., Walker, D. H., and Maller, J. L. (1992) Mol. Biol. Cell 3, 927-939 [Abstract]
  38. Izumi, T., and Maller, J. L. (1993) Mol. Biol. Cell 4, 1337-1350 [Abstract]
  39. Kovelman, R., and Russell, P. (1996) Mol. Cell. Biol. 16, 86-93 [Abstract]
  40. Kuang, J., Ashorn, C. L., Gonzalez-Kuyvenhoven, M., and Penkala, J. E. (1994) Mol. Biol. Cell 5, 135-145 [Abstract]
  41. Strausfeld, U., Fernandez, A., Capony, J.-P., Girard, F., Lautredou, N., Derancourt, J., Labbe, J.-C., and Lamb, N. J. C. (1994) J. Biol. Chem. 269, 5989-6000 [Abstract/Free Full Text]
  42. Hoffmann, I., Clarke, P. R., Marcote, M. J., Karsenti, E., and Draetta, G. (1993) EMBO J. 12, 53-63 [Medline] [Order article via Infotrieve]
  43. Clarke, P. R., Hoffmann, I., Draetta, G., and Karsenti, E. (1993) Mol. Biol. Cell 4, 397-411 [Abstract]
  44. Booher, R. N., Deshaies, R. J., and Kirschner, M. W. (1993) EMBO J. 12, 3417-3426 [Medline] [Order article via Infotrieve]
  45. Igarashi, M., Nagata, A., Jinno, S., Suto, K., and Okayama, H. (1991) Nature 353, 80-83 [CrossRef][Medline] [Order article via Infotrieve]
  46. Nigg, E. A. (1993) Trends Cell Biol. 3, 296-301 [CrossRef][Medline] [Order article via Infotrieve]
  47. Mitchison, J. M. (1970) Methods Cell Physiol. 4, 131-146
  48. Moreno, S., Klar, A., and Nurse, P. (1991) Methods Enzymol. 194, 795-823 [Medline] [Order article via Infotrieve]
  49. Maundrell, K. (1993) Gene (Amst.) 123, 127-130 [CrossRef][Medline] [Order article via Infotrieve]
  50. Field, J.-I., Nikawa, J., Broek, D., MacDonald, B., Rodgers, L., Wilson, I. A., Lerner, R. A., and Wigler, M. (1988) Mol. Cell. Biol. 8, 2159-2165 [Abstract/Free Full Text]
  51. Harlow, E., and Lane, D. (1988) Antibodies, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York
  52. Booher, R. N., Alfa, C. E., Hyams, J. S., and Beach, D. H. (1989) Cell 58, 485-497 [CrossRef][Medline] [Order article via Infotrieve]
  53. Alfa, C. E., Ducommun, B., Beach, D., and Hyams, J. S. (1990) Nature 347, 680-682 [CrossRef][Medline] [Order article via Infotrieve]
  54. Gallagher, I. M., Alfa, C. E., and Hyams, J. S. (1993) Mol. Biol. Cell 4, 1087-1096 [Abstract]
  55. Russell, P., Moreno, S., and Reed, S. I. (1989) Cell 57, 295-303 [CrossRef][Medline] [Order article via Infotrieve]
  56. Wu, L., Shiozaki, K., Aligue, R., and Russell, P. (1996) Mol. Biol. Cell 7, 1749-1758 [Abstract]
  57. Kalderon, D., Richardson, W. D., Markham, A. F., and Smith, A. E. (1984) Nature 311, 33-38 [CrossRef][Medline] [Order article via Infotrieve]
  58. Creanor, J., and Mitchison, J. M. (1982) J. Cell Sci. 58, 263-282 [Abstract]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
GeneticsHome page
F. R. Balestra and J. Jimenez
A G2-Phase Microtubule-Damage Response in Fission Yeast
Genetics, December 1, 2008; 180(4): 2073 - 2080.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Okamoto and N. Sagata
Mechanism for inactivation of the mitotic inhibitory kinase Wee1 at M phase
PNAS, March 6, 2007; 104(10): 3753 - 3758.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
C. Sgarlata and J. Perez-Martin
Inhibitory phosphorylation of a mitotic cyclin-dependent kinase regulates the morphogenesis, cell size and virulence of the smut fungus Ustilago maydis
J. Cell Sci., August 15, 2005; 118(16): 3607 - 3622.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
J. L. Morrell, C. B. Nichols, and K. L. Gould
The GIN4 family kinase, Cdr2p, acts independently of septins in fission yeast
J. Cell Sci., October 15, 2004; 117(22): 5293 - 5302.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
D. R. Kellogg
Wee1-dependent mechanisms required for coordination of cell growth and cell division
J. Cell Sci., December 15, 2003; 116(24): 4883 - 4890.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
N. Cueille, E. Salimova, V. Esteban, M. Blanco, S. Moreno, A. Bueno, and V. Simanis
Flp1, a fission yeast orthologue of the S. cerevisiae CDC14 gene, is not required for cyclin degradation or rum1p stabilisation at the end of mitosis
J. Cell Sci., March 9, 2002; 114(14): 2649 - 2664.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
J. Lee, A. Kumagai, and W. G. Dunphy
Positive Regulation of Wee1 by Chk1 and 14-3-3 Proteins
Mol. Biol. Cell, March 1, 2001; 12(3): 551 - 563.
[Abstract] [Full Text]


Home page
JCBHome page
D. Perez-Mongiovi, C. Beckhelling, P. Chang, C. C. Ford, and E. Houliston
Nuclei and Microtubule Asters Stimulate Maturation/M Phase Promoting Factor (MPF) Activation in Xenopus Eggs and Egg Cytoplasmic Extracts
J. Cell Biol., September 5, 2000; 150(5): 963 - 974.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Sveiczer, A. Csikasz-Nagy, B. Gyorffy, J. J. Tyson, and B. Novak
Modeling the fission yeast cell cycle: Quantized cycle times in wee1- cdc25Delta mutant cells
PNAS, July 5, 2000; 97(14): 7865 - 7870.
[Abstract] [Full Text] [PDF]


Home page
Cell Growth Differ.Home page
Y. Wang, C. Jacobs, K. E. Hook, H. Duan, R. N. Booher, and Y. Sun
Binding of 14-3-3{beta} to the Carboxyl Terminus of Wee1 Increases Wee1 Stability, Kinase Activity, and G2-M Cell Population
Cell Growth Differ., April 1, 2000; 11(4): 211 - 219.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. U. Christensen, N. J. Bentley, R. G. Martinho, O. Nielsen, and A. M. Carr
Mik1 levels accumulate in S phase and may mediate an intrinsic link between S phase and mitosis
PNAS, March 14, 2000; 97(6): 2579 - 2584.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
N. Nakajo, S. Yoshitome, J. Iwashita, M. Iida, K. Uto, S. Ueno, K. Okamoto, and N. Sagata
Absence of Wee1 ensures the meiotic cell cycle in Xenopus oocytes
Genes & Dev., February 1, 2000; 14(3): 328 - 338.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
J.-M. Brondello, M. N. Boddy, B. Furnari, and P. Russell
Basis for the Checkpoint Signal Specificity That Regulates Chk1 and Cds1 Protein Kinases
Mol. Cell. Biol., June 1, 1999; 19(6): 4262 - 4269.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Y. Sun, B. P. Dilkes, C. Zhang, R. A. Dante, N. P. Carneiro, K. S. Lowe, R. Jung, W. J. Gordon-Kamm, and B. A. Larkins
Characterization of maize (Zea mays L.) Wee1 and its activity in developing endosperm
PNAS, March 30, 1999; 96(7): 4180 - 4185.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
M. S. Murakami, T. D. Copeland, and G. F. Vande Woude
Mos positively regulates Xe-Wee1 to lengthen the first mitotic cell cycle of Xenopus
Genes & Dev., March 1, 1999; 13(5): 620 - 631.
[Abstract] [Full Text]


Home page
Mol. Biol. CellHome page
J. Kanoh and P. Russell
The Protein Kinase Cdr2, Related to Nim1/Cdr1 Mitotic Inducer, Regulates the Onset of Mitosis in Fission Yeast
Mol. Biol. Cell, December 1, 1998; 9(12): 3321 - 3334.
[Abstract] [Full Text]


Home page
Mol. Biol. CellHome page
C. S. Breeding, J. Hudson, M. K. Balasubramanian, S. M. Hemmingsen, P. G. Young, and K. L. Gould
The cdr2+ Gene Encodes a Regulator of G2/M Progression and Cytokinesis in Schizosaccharomyces pombe
Mol. Biol. Cell, December 1, 1998; 9(12): 3399 - 3415.
[Abstract] [Full Text]


Home page
JCBHome page
J. N. McMillan, R. A.L. Sia, and D. J. Lew
A Morphogenesis Checkpoint Monitors the Actin Cytoskeleton in Yeast
J. Cell Biol., September 21, 1998; 142(6): 1487 - 1499.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
P. Kaiser, R. A.L. Sia, E. G.S. Bardes, D. J. Lew, and S. I. Reed
Cdc34 and the F-box protein Met30 are required for degradation of the Cdk-inhibitory kinase Swe1
Genes & Dev., August 15, 1998; 12(16): 2587 - 2597.
[Abstract] [Full Text]


Home page
ScienceHome page
M. N. Boddy, B. Furnari, O. Mondesert, and P. Russell
Replication Checkpoint Enforced by Kinases Cds1 and Chk1
Science, May 8, 1998; 280(5365): 909 - 912.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Aligue, R.
Right arrow Articles by Russell, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Aligue, R.
Right arrow Articles by Russell, P.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement