JBC Origene Your Gene Company

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fassler, J. S.
Right arrow Articles by Deschenes, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fassler, J. S.
Right arrow Articles by Deschenes, R. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


Volume 272, Number 20, Issue of May 16, 1997 pp. 13365-13371
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Activated Alleles of Yeast SLN1 Increase Mcm1-dependent Reporter Gene Expression and Diminish Signaling through the Hog1 Osmosensing Pathway*

(Received for publication, January 13, 1997)

Jan S. Fassler Dagger §, William M. Gray Dagger , Cheryl L. Malone par , Wei Tao par , Hong Lin par and Robert J. Deschenes par

From the Dagger  Department of Biological Sciences, University of Iowa and the par  Department of Biochemistry, University of Iowa, Iowa City, Iowa 52242

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

Two-component signal transduction systems involving histidine autophosphorylation and phosphotransfer to an aspartate residue on a receiver molecule have only recently been discovered in eukaryotes, although they are well studied in prokaryotes. The Sln1 protein of Saccharomyces cerevisiae is a two-component regulator involved in osmotolerance. Phosphorylation of Sln1p leads to inhibition of the Hog1 mitogen-activated protein kinase osmosensing pathway. We have discovered a second function of Sln1p by identifying recessive activated alleles (designated nrp2) that regulate the essential transcription factor Mcm1. nrp2 alleles cause a 5-fold increase in the activity of an Mcm1-dependent reporter, whereas deletion of SLN1 causes a 10-fold decrease in reporter activity and a corresponding decrease in expression of Mcm1-dependent genes. In addition to activating Mcm1p, nrp2 mutants exhibit reduced phosphorylation of Hog1p and increased osmosensitivity suggesting that nrp2 mutations shift the Sln1p equilibrium toward the phosphorylated state. Two nrp2 mutations map to conserved residues in the receiver domain (P1148S and P1196L) and correspond to residues implicated in bacterial receivers to control receiver phosphorylation state. Thus, it appears that increased Sln1p phosphorylation both stimulates Mcm1p activity and diminishes signaling through the Hog1 osmosensing pathway.


INTRODUCTION

Two-component regulators are a family of signal transduction molecules prevalent in prokaryotic organisms that play a major role in the adaptation of microorganisms to changes in the extracellular environment (1, 2). The response of cells to chemotactic agents, sporulation conditions, and changes in osmolarity, for example, are each governed by two-component regulators in which information about external conditions is converted via a sensor-associated kinase into high energy phosphoryl groups on histidine and aspartate side chains ultimately activating an appropriate set of genes. The "two-component" designation derives from the observation that in many cases the pertinent activities are divided between two polypeptides. One is designated the "sensor/kinase" and contains an extracellular domain (sensor) and a histidine autokinase activity (transmitter). The second is called the response regulator and is made up of a receiver domain containing a conserved aspartate residue and, in some cases, an output domain.

Two-component regulators have been recently identified in eukaryotes including Arapidopsis, Saccharomyces, Dictyostelium, and Neurospora (3). In most of these eukaryotic examples, the transmitter and the receiver domains are present in a single hybrid molecule. Examples of hybrid kinases are also known in prokaryotes, and in certain cases, the attached receiver domain is thought to regulate phosphotransfer to a cytoplasmic receiver containing an output domain (4, 5). The strength of the signal through a given pathway is determined by the stability of the phosphoryl aspartate whose susceptibility to hydrolysis depends on the tertiary or higher order structure of the receiver domain. Stability of the aspartyl phosphate may be regulated by "phosphatase" activities present either in the sensor/kinase, receiver domain, or in auxiliary factors (6, 7). Whether the role of these phosphatases is enzymatic or rather to trigger a conformational alteration that alters the exposure of the residue to water is unclear.

The yeast SLN1 gene is a member of the two-component family that encodes a hybrid kinase including sensor, histidine kinase, and receiver domains (8). Its role is to sense and respond to changes in osmolarity by regulating a MAP1 kinase pathway composed of Hog1p (MAP kinase), Pbs2p (MAP kinase kinase), and Ssk2p/Ssk22p (two MAP kinase kinase kinases) (9). Sln1p phosphorylates a second two-component molecule, Ssk1p consisting of a receiver domain, via the phosphorelay intermediate, Ypd1p (10). Under conditions of increased osmolarity, the equilibrium between phosphorylated and unphosphorylated Sln1p shifts to favor the unphosphorylated form (10), and the resulting accumulation of unphosphorylated Ssk1p leads to activation of the Hog1 MAP kinase pathway (9). Phosphorylated Hog1p, in turn, activates a set of hyperosmotic response genes necessary for survival under increased external osmotic pressure (11). Also contributing to Hog1p phosphorylation in response to hyperosmolarity is Sho1p, a putative membrane-associated molecule that interacts with the Hog1p kinase Pbs2p via its Src homology 3 domain (12).

Alleles of the SLN1 gene that increase expression of an Mcm1-dependent reporter were previously isolated in a screen for mutants that increased the activity of the CYC1-lacZ reporter gene under the control of a high affinity Mcm1 binding site (referred to as a P site) (13). Deletion of the SLN1 gene causes a 10-fold reduction in Mcm1-dependent reporter gene expression without affecting Mcm1p levels, thus Sln1p is an activator of Mcm1p or of an Mcm1p auxiliary protein, and the so-called nrp2 (negative regulator of P site) mutants are recessive activating alleles of SLN1 (13). Since deletion of the HOG1 gene has no effect on the activity of an Mcm1-dependent reporter, we suggested that Mcm1p is not directly regulated by Hog1p and that Sln1p has two separate regulatory functions (13). It is not clear, however, how Sln1p accomplishes both functions. Although the mechanism by which Sln1p regulates the Hog1 MAP kinase pathway involves phophorylation and phosphotransfer, whether the same activities are required for Sln1p regulation of Mcm1p is an open question. In addition, although we have shown that Hog1p is not required for Sln1p activation of Mcm1p, other intermediates in the Sln1-Hog1 pathway have not been tested so the point at which the two "pathways" branch has not been defined.

Our present results indicate that Sln1p activation of Mcm1p uses regulatory mechanisms in common with Sln1p activation of the Hog1 pathway and indicates that signaling through the two pathways may depend on the same phosphorelay capabilities of Sln1p. The hypothesis that the nrp2 mutations affect the Sln1p phosphorylation state is further supported by our finding in two instances that the amino acid changes responsible for the nrp2 mutant phenotype map to positions likely to have an effect on the equilibrium between phosphorylated and unphosphorylated Sln1p. Based on these results, we propose a model in which shifting the equilibrium of Sln1 to the phosphorylated state results in inactivation of the Hog1 pathway and activation of the Mcm1 pathway. Given the multiple roles of Mcm1p in growth control and cell physiology, this may represent an integrated mechanism by which cells respond to stress.


EXPERIMENTAL PROCEDURES

Yeast Strains and Media

Yeast strains used in this study are listed in Table I. All strains were grown at 30 °C unless indicated otherwise. Diploids containing the sln1Delta ::LEU2 or sln1Delta ::TRP1 mutations were constructed by transformation with fragments isolated from plasmids pGY143 and pGY148 as described previously (13). The SHO1 and SSK1 loci were disrupted by single step gene replacement (14) using, respectively, a SalI-NotI fragment from plasmid pDOS84 in which TRP1 is inserted between the two EcoRV sites of the SHO1 gene (gift of H. Saito) (12) and a PstI-XbaI fragment from the ssk1Delta ::LEU2 plasmid, pDSS14 (gift of H. Saito) (9). The presence of the disruption alleles was confirmed by Southern hybridization analysis.

Table I. Yeast strains used in this work

Strains used in this work are isogenic or congenic with the wild type strain S288C. Strains used in this work are isogenic or congenic with the wild type strain S288C.

Strain name Genotype

JF1331 MATa his4-917 lys2-128delta leu2 trp1Delta 1 ura3-52; plasmid pGY48
JF1356 MATa nrp2-1 his4-917 lys2-128delta leu2 ura3-52; plasmid pGY48
JF1357 MATa nrp2-2 his4-917 lys2-128delta leu2 ura3-52; plasmid pGY48
JF1358 MATa nrp2-3 his4-917 lys2-128delta leu2 ura3-52; plasmid pGY48
JF1362 hog1-Delta ::TRP1 of JF1331 (Yu et al., 1995)
JF1433 MATa nrp2-1 ssk1Delta ::LEU2 his4-917 lys2-128delta trp1Delta 1 ura3-52 leu2; plasmid pGY48
JF1455 MATa/alpha his4-917 lys2-128delta trp1Delta 1 ura3-52 leu2 SLN1/sln1Delta ::LEU2
JF1598 sho1Delta ::TRP1 of JF1331
JF1599 sho1Delta ::TRP1 of GY32
JF1600 sho1Delta ::TRP1 of GY36
JF1675 nrp2-2 of FY251a
JF1705 sln1Delta ::LEU2 of FY251xFY834 diploid
GY32 MATalpha nrp2-1 his4-917 leu2 trp1Delta 1 ura3-52; plasmid pGY48
GY36 MATalpha nrp2-3 his4-917 leu2 trp1Delta 1 ura3-52; plasmid pGY48
FY251 MATa his3Delta 200 leu2Delta 1 ura3-52 trp1Delta 63 from Fred Winston
FY834 MATalpha his3Delta 200 leu2Delta 1 ura3-52 trp1Delta 63 lys2Delta 202 from Fred Winston

a Constructed by two-step transformation using the nrp2-2 integrating plasmid, pWT5 and confirmed by direct sequence analysis of a polymerase chain reaction fragment encompassing the mutation.

The media were prepared as described by Sherman et al. (15). Plates for the detection of beta -galactosidase contained 50 µg of 5-bromo-4-chloro-3-indolyl beta -D-galactopyranoside/ml and were prepared as described by arson et al. (16).

Plasmids

Plasmids used in this work are listed in Table II. The Mcm1-dependent reporter, P-lacZ, is carried on the previously described plasmid, pGY48 (17), a derivative of the 2-µm URA3 CYC1-lacZ reporter, pLG670Z (18). pHL589 consists of the entire SLN1 gene inserted into pRS314 (19). It was constructed by a recombination strategy using KpnI-digested pHL566 as the gapped recipient vector. pHL566 consists of a 2.95-kb EagI/KpnI fragment of SLN1 inserted into the EagI and KpnI sites of pRS314 (19). KpnI-digested pHL566 was cotransformed into yeast strain JF1455 with a 2.86-kb polymerase chain reaction fragment of SLN1 generated using oligonucleotides SLN 1588F 5'-ACTATGACAGACGAATTCGACCAACATTAT-3') and OLI196 (5'-GCTCGGAATTAACCCTCACTAGGAACAAAAGCTGGTACCATCCAAATTTGTGGTTCATGCTCTC-3'). OLI196 is complementary to sequences in the 3'-untranslated region of SLN1 and contains sequences at the 5' end homologous to pRS314. Generation of a full-length functional pRS314 SLN1 clone (pHL589) was confirmed by restriction and sequence analysis, as well as by demonstrating the ability to support SLN1-dependent growth when JF1455 was sporulated. Construction of pHL592 containing a SLN1 gene lacking the receiver domain (deletion of aa 1078-1220) was done by cutting pHL589 with StuI/MluI and inserting a 2.18-kb StuI/MluI fragment obtained by digesting a polymerase chain reaction fragment generated using oligonucleotides SLN 1057F (5'-CTAGCACACTGGGAATTCCAACCAATTGTA) and SLN 3212R (5'-GATCGTACGCGTCTCAGTCTCGAGTTATCAGCGGCCGCCTGTGGGGATGTTTCTACTTG).

Table II. Plasmids used in this work

Plasmids were constructed in our laboratory unless otherwise indicated. Plasmids were constructed in our laboratory unless otherwise indicated.

Plasmid name Description

pBG95 SLN1 receiver domain in pSV146; HIS3, CEN
pBG94 HA tagged SLN1 receiver domain in pSP72 derivative (Promega)
pHL589 SLN1 in pRS314 (19); TRP1, CEN
pHL566 SLN1 EagI-KpnI (pGY141) in pRS314 (13); TRP1, CEN
pHL592 SLN1 lacking the receiver domain (pRS SLN1Delta R); TRP1, CEN
pGY143 sln1Delta ::LEU2 in pGEM5Zf (Promega)
pGY148 sln1Delta ::TRP1 in pGEM5Zf (Promega)
pWT5 nrp2-2 integrating plasmid; URA3
pDSS14 ssk1Delta ::LEU2 from H. Saito (9)
pDOS84 sho1Delta ::TRP1 from H. Saito (12)
pSV146 UASGa in pRS313 (19); HIS3, CEN
pGY48 UAS(P)-CYC1-lacZ in pLG670Z (13); URA3, 2-µm

a GAL10 UAS inserted into pRS313.

pBG95 containing an HA epitope-tagged Sln1 receiver domain under the control of UASG was constructed by first constructing a galactose-inducible expression vector, pSV146, by insertion of a 1.4-kb EcoRV-BamHI fragment from YEp55 (20) containing the GAL10 UAS, promoter, and ATG into the SmaI and BamHI sites of pRS313 (19). The HpaI-HinDIII fragment containing the Sln1 receiver domain was introduced into the polylinker of pSP72 (Promega), and an HA epitope tag was introduced at the SLN1 ScaI site to create pBG94. The HA-tagged receiver domain was then introduced as a HpaI-PvuII fragment into the blunted BamHI site of pSV146. pWT5 is an nrp2-2 integrating vector constructed by inserting the 2.1-kb EagI-XbaI fragment (XbaI at SLN1 1624-end of SLN1) utilizing a polylinker EagI site into EagI-XbaI of pRS406 (19). DNA was digested with BclI which recognizes a unique site in SLN1 downstream of the nrp2-2 mutation prior to transformation into the appropriate strains.

Genetic Methods and beta -Galactosidase Assays

beta -Galactosidase measurements were performed as described previously using cleared glass bead extracts from log phase cells (17). Transformation was by a modified LiOAc method (21, 22).

Receiver Domain Expression

Yeast strains containing the UASG-regulated Sln1 receiver domain (pBG95) were grown in 2% raffinose to early log phase at which time 3% galactose or 2% glucose was added. Cultures were incubated for approximately 5 h before being harvested for preparation of protein extracts. Extracts were prepared by a glass bead disruption protocol (22) and subjected to Western blot analysis with HA antibody. Following electrophoresis on 12% SDS-polyacrylamide gels and transfer to nitrocellulose, filters were blocked for 15 min at 37 °C in 5% milk powder dissolved in 0.1% Tween/phosphate-buffered saline. Filters were subsequently incubated (6 h) with HA antibody (1:1000) (Babco) followed by secondary antibody anti-mouse IgG horseradish peroxidase (1:2500) (Sigma). Immune complexes were detected by enhanced chemiluminescence according to protocols supplied by the manufacturer (Amersham Corp.).

Gap Rescue and Reconstruction of nrp2 Mutations

Three SLN1 gapped plasmids (A, B, and C) were generated by digesting pHL589 with EcoRI/StuI (A), StuI/ClaI (B), or BstEII/MluI (C). Gap rescue (23) was performed by transforming gap A, B, or C plasmids into mutant yeast strains harboring the nrp2-1 (JF1356), nrp2-2 (JF1357), or nrp2-3 (JF1358) mutations. The presence of the mutation on a rescued gap plasmid was assessed by the blue color of colonies on 5-bromo-4-chloro-3-indolyl beta -D-galactopyranoside plates. Plasmids were rescued from yeast (24) and subjected to sequence analysis. The sequence of both strands was determined. In vitro mutagenesis (nrp2-1) or subcloning of restriction fragment (nrp2-2 and nrp2-3) encompassing the presumed missense mutation was done to confirm the identity of each mutation.

Dilution Plating for Osmosensitivity Testing

Cells were cultured to early log phase (1 × 107/ml) and serially diluted 1:10 in YPD or YPD + 0.9 M NaCl. Two µl of the appropriate dilutions were spotted onto YPD and YPD + 0.9 M NaCl plates. Plates were incubated at 30 °C for up to 3 days.

Protein Extracts and Western Analysis

Cells were cultured to early log phase (7 × 106/ml) in YPD at which time solid NaCl was added to 0.4 M. 10-ml aliquots were taken at indicated times following the addition of salt. The t = 0 time point was taken prior to the addition of salt. Cells were pelleted at 4 °C at low speed and frozen in dry ice prior to storage at -70 °C. Cell pellets were washed once with 5 ml of cold protease inhibitor mixture (50 µg/ml leupeptin, 23 µg/ml aprotinin, 1 µg/ml pepstatin, 20 µg/ml chymostatin, 2 mM phenylmethylsulfonyl fluoride in water). Extracts were processed for antiphosphotyrosine immunoblots essentially as described by Maeda et al. (9). Proteins were resolved by electrophoresis on 10% SDS acrylamide gels (6% stacking gel) and electroblotted to 0.45 µm nitrocellulose (Protrans, Schliecher & Schuell). The nitrocellulose filter was blocked overnight at 4 °C in TBST (10 mM Tris, pH 8.0, 150 mM NaCl, and 0.05% Tween 20) + 4% bovine serum albumin, washed twice for 10 min in TBST, incubated for 2 h at 4 °C with RC20 recombinant antiphosphotyrosine antibody conjugated to horseradish peroxidase (Transduction Laboratories, Lexington, KY) diluted 1:2500 in TBST + 4% bovine serum albumin, and washed twice with TBST. Immune complexes were visualized by enhanced chemiluminescence (Amersham Corp.).


RESULTS

nrp2 Mutations Cause an Osmosensitive Phenotype

Activation of the Hog1 MAP kinase pathway depends on the phospho-relay capabilities of the Sln1p hybrid kinase (9). Mutation of either the phosphorylated histidine or the phosphorylated aspartate confers a phenotype equivalent to the null, indicating the requirement of these residues for signaling (9). Activation of Mcm1-dependent transcription may likewise involve Sln1p phosphorylation and phosphotransfer to downstream molecules. Alternatively, activation of Mcm1p may be independent of the phosphorylation state of Sln1p. Assessment of Mcm1p activity in the null or in phosphorylation defective mutants is difficult since the SLN1 deletion mutation causes lethality on rich media and extremely slow growth on minimal media in some genetic backgrounds (13) and unconditional lethality in other genetic backgrounds (9). To circumvent these difficulties, we tested the involvement of Sln1p phospho-intermediates in Mcm1 signaling by examining the effect of the nrp2 mutations on the ability of cells to respond to osmotic stress. If the stimulating effect of nrp2 mutations on Mcm1-dependent transcription is due to a shift in the Sln1p equilibrium to the phosphorylated state, for example, the resulting decrease in unphosphorylated Sln1p might limit the amount of unphosphorylated Ssk1p available to trigger a normal osmotic response. To test this idea, we examined the osmotic sensitivity of our nrp2 mutants. To render the cell completely dependent on Sln1p signaling for its response to hyperosmolarity (12), it was necessary to first delete the SHO1 gene which encodes a second osmosensor. The SHO1 gene was deleted by one-step disruption in nrp2-1 and nrp2-3 strains. The osmotolerance of isogenic nrp2-1 and nrp2-1 sho1-Delta strains and isogenic sho1-Delta and wild type strains was compared by spotting serial dilutions of cells on 0.9 M NaCl plates or on unsupplemented YPD media. SHO1+ SLN1+ cells exhibited normal viability on 0.9 M NaCl although colony size was reduced. Strains lacking the Hog1 MAP kinase, on the other hand, were extremely sensitive to this condition (Fig. 1). Both nrp2-1 and sho1-Delta single mutants grew with wild type viability on 0.9 M NaCl plates at 30 °C; however, the plating efficiency of the nrp2-1sho1 double mutants was reduced approximately 100-fold (Fig. 1). Likewise, the nrp2-3 mutant was partially sensitive to 0.9 M NaCl, and SHO1 deletion exacerbated the effect (Fig. 1). The enhanced osmosensitivity of the double nrp2 sho1 mutant is consistent with nrp2 mutations shifting the Sln1 equilibrium to favor the phosphorylated form, thus diminishing or inhibiting the normal effect of increased osmolarity on the activity of the sensor/kinase.


Fig. 1. nrp2 mutants are sensitive to 0.9 M NaCl in a sho1Delta background. Cells of the designated genotype were diluted serially in YPD + 0.9 M NaCl and spotted onto YPD + 0.9 M NaCl plates (A) or diluted in YPD and spotted onto YPD plates (B). SLN1 SHO1 (JF1331), sho1Delta (JF1598), nrp2-1 (GY32), nrp2-1 sho1Delta (JF1599), nrp2-3 (GY36), nrp2-3 sho1Delta (JF1600), hog1Delta (JF1362).
[View Larger Version of this Image (55K GIF file)]

To examine in more detail the basis for the osmosensitivity of nrp2 mutants, we examined the tyrosine phosphorylation of Hog1p in the nrp2 sho1 double mutant and sho1 and nrp2 single mutants. Strains were grown in rich media, and NaCl was added to 0.4 M at time 0. Aliquots were taken over time for immediate processing, denaturing gel electrophoresis, and immunoblot analysis with antiphosphotyrosine antibody. As expected, a 50-kDa band corresponding to Hog1p was apparent in wild type strains at the earliest point assayed (5 min) after addition of salt (Fig. 2). Likewise, in sho1 deletion and nrp2 single mutants, Hog1p phosphorylation was rapidly induced and persisted for 15-20 min. In contrast, in the nrp2 sho1 double mutants, Hog1 phosphorylation was not detectable (Fig. 2). Taken together, these studies indicate that Mcm1-dependent transcription is stimulated by phosphorylation of Sln1p.


Fig. 2. Hog1 phosphorylation is dramatically reduced in nrp2 sho1 double mutants. Extracts were prepared from cultures of the designated genotypes at various times (0, 5, 10, 15, 20, 30, and 40 min) after the addition of NaCl to 0.4 M. Antiphosphotyrosine immunoblots were performed as described under "Experimental Procedures." The position corresponding to the 50-kDa Hog1 protein is indicated by an arrow. Strains used in this experiment are listed in the legend to Fig. 1.
[View Larger Version of this Image (91K GIF file)]

The nrp2 Mutations Map to the Receiver Domain (of Sln1p) and to the Linker Region Between the Transmembrane and Histidine Kinase Domain of Sln1p

To determine if the proposed effects of the nrp2 mutations on Sln1p phosphorylation state could be understood at the molecular level, we used gap rescue to localize the mutations and sequence analysis to pinpoint the alterations. Plasmids expressing the nrp2 mutant alleles were constructed by in vitro mutagenesis or by swapping the appropriate restriction fragments into the context of wild type SLN1 sequences carried on pHL589. The phenotype of the reconstructed nrp2 alleles was evaluated in a sln1-Delta background following transformation and sporulation of a sln1-Delta /SLN1+ heterozygous diploid (JF1455). Two of the nrp2 alleles, nrp2-2 and nrp2-3, were found to be point mutations leading to changes in conserved proline residues just downstream of the aspartate residue in the Sln1p receiver domain which is the target for phosphorylation (Fig. 3). nrp2-2 is a change to serine at P1148 and nrp2-3 is a change to leucine at P1196. The third nrp2 mutation, nrp2-1, is a T550I change in the non-conserved region upstream of the histidine kinase domain in the region linking the kinase to the presumed membrane spanning domains (Fig. 3). The significance of the base pair changes in the nrp2-2 and nrp2-3 mutants can be evaluated by comparison of the Sln1p receiver domain to the bacterial receiver, CheY, for which a crystallographic structure is available. As described in detail below (see "Discussion"), the alignment of Sln1p and CheY receiver domains shows that the nrp2-2 and nrp2-3 mutations map to positions that are likely to affect Sln1p function and are consistent with changes in Sln1p phosphorylation state.


Fig. 3. Domain organization of the Sln1 protein showing the locations of the nrp2 mutations. The two presumed transmembrane spanning regions are indicated by black boxes; the transmitter and receiver domains are gray and striped boxes, respectively. H represents the phosphorylated histidine in the transmitter domain of Sln1 (aa 576), and D represents the phosphorylated aspartate in the receiver domain (aa 1144). Partial sequence of the SLN1 receiver domain is aligned with the sequence of the bacterial chemotaxis two-component receiver module, CheY. Numbers above the alignment refer to CheY amino acids. Positions of SLN1 receiver mutants, nrp2-2 and nrp2-3 are shown below the alignment.
[View Larger Version of this Image (17K GIF file)]

The Sln1 Pathways Branch Prior to Ssk1p

Since phosphorylated Sln1p inhibits the activity of the Hog1 pathway but appears to stimulate the activity of the Mcm1 pathway, it seemed possible that phosphorylated and unphosphorylated Ssk1p might likewise play opposing roles in regulating the two pathways. We tested the importance of Ssk1p in Sln1-Mcm1 signaling by measuring the effect of an SSK1 deletion on the activity of the Mcm1-dependent reporter, P-lacZ (P = Mcm1 binding site). Unlike the SLN1 deletion which causes constitutive activation of the Hog1 pathway, and perhaps, as a result, lethality, SSK1 deletion is not lethal. In the absence of Ssk1p, the Hog1 pathway fails to be activated by the Sln1 pathway but is under normal regulation via Sho1p-Pbs2p interactions. If the presence of Ssk1p is required for signaling to Mcm1p, deletion of SSK1 would be expected to prevent the activation of the Mcm1-dependent reporter by nrp2 mutations. To examine the involvement of Ssk1p in Sln1-Mcm1 signaling, we deleted the SSK1 gene by one-step transformation of wild type and nrp2-1 mutant strains. We found that the activity of our reporter was virtually unchanged as a result of SSK1 deletion in either wild type or nrp2 backgrounds (Table III).

Table III. SSK1 mutations do not significantly affect P-lacZ activity


Straina Relative beta -galactosidase activity,b P-lacZ

Wild type 100
ssk1-Delta 116
nrp2-1 408.5
nrp2-1 ssk1-Delta 688

a Strains were as follows: wild type (JF1331); nrp2-1 (JF1359); ssk1-Delta (ssk1-Delta derivatives of JF1331); nrp2-1 ssk1-Delta (ssk1-Delta derivatives of JF1359).
b Activities are the averages of at least four measurements. Standard deviations are less than 25% of the average. Average activities were normalized to wild type.

The Sln1p C-terminal Receiver Domain Has an Essential Role in Signal Transmission

The absence of an effect of the Ssk1p receiver on Sln1-Mcm1 signaling suggested the possibility that Sln1p itself interacts with downstream non-two-component signaling molecules. In this case, the receiver domain of the Sln1p hybrid kinase may be an important signaling intermediate rather than an inhibitory domain as postulated for other hybrid kinases. We examined this possibility by deleting the receiver domain from Sln1p and separately expressing it under the control of an inducible promoter. Before evaluating the effect of expressing the transmitter in the absence of the receiver, it was necessary to establish that the two separated domains were functional. We tested whether the two half-molecules could function in trans by simultaneously introducing plasmid pHL592 carrying a receiverless Sln1p (aa 1-1077) and plasmid pBG95 carrying the galactose-inducible receiver (aa 1037-1220, end) into a diploid strain (JF1705) heterozygous for a LEU2 marked sln1-Delta allele. The sln1-Delta heterozygote was then sporulated and dissected on media prepared with galactose instead of glucose. The appearance of both Leu+ (sln1-Delta ) and Leu- (SLN1+) viable spores at equal frequencies (Table IV) and indistinguishable growth rates suggests that the two plasmids fully complemented the sln1-Delta mutant phenotype. Next, we asked whether either domain alone was able to complement the sln1-Delta lethality. To this end we compared the frequency of plasmid loss in Leu+ (sln1-Delta ) and Leu- (SLN1+) spore colonies. After 8 h of growth in non-selective media, 40% of the cells in a culture from a Leu- colony had lost either the plasmid carrying the N-terminal (marked with TRP1) or the C-terminal (marked with HIS3) SLN1 portion. In contrast, no His- or Trp- segregants were present in a culture from a Leu+ (sln1-Delta ) colony (Table V). This result indicates that both the transmitter kinase and receiver domains are required for Sln1 function. Neither the C terminus nor the N terminus alone is sufficient for complementation. Further evidence that the receiver domain is essential for viability comes from the failure of a sln1Delta ::LEU2 strain carrying the UASG receiver and transmitter plasmids to survive when shifted from galactose to glucose media (data not shown).

Table IV. Frequency of Leu+ segregants from a sln1Delta ::LEU2/SLN1+ heterozygote carrying Sln1 transmitter and receiver domain plasmids

sln1Delta ::LEU2/SLN1+ heterozygote, JF1705 was transformed with appropriate plasmids and following sporulation, dissected onto SC galactose -His, Trp plates. Spore colonies were replicated to SC-Leu plates to determine their Leu phenotype. sln1Delta ::LEU2/SLN1+ heterozygote, JF1705 was transformed with appropriate plasmids and following sporulation, dissected onto SC galactose -His, Trp plates. Spore colonies were replicated to SC-Leu plates to determine their Leu phenotype.

Transmitter plasmid:a None Vector SLN1 Delta R SLN1 Delta R
Receiver plasmid:a None UASG receiver Vector UASG receiver
Leu+b Leu- Leu+c Leu- Leu+ Leu- Leu+d Leu-
0 12 0 8 0 11 19 18

a Transmitter plasmids were SLN1 Delta R (pHL592) or the parental vector pRS314 (vector). Receiver plasmids were UASG receiver (pBG95) or the parental vector, pSV146 (vector).
b A total of six tetrads from the untransformed JF1705 (sln1Delta ::LEU2/SLN1+) were dissected onto YPD plates.
c Total number of surviving spore colonies out of 20 tetrads dissected onto SC galactose -His, Trp plates is the sum of the Leu+ and Leu- progeny. The number of survivors was low due to the simultaneous selection for both plasmids.
d Total number of surviving spore colonies out of 40 tetrads dissected onto SC galactose -HIS, Trp plates is the sum of the Leu+ and Leu- progeny. The number of survivors was low due to the simultaneous selection for both plasmids.

Table V. Frequency of plasmid loss by sln1Delta ::LEU2 and SLN1+ strains carrying the Sln1 transmitter and Sln1 receiver domain plasmids


Phenotype of starting colonya Plasmid loss events
Total colonies examined
Hisb Trpb

Leu+ 0 0 182
Leu- 107 113 270

a One Leu+ and one Leu- spore colony were chosen from the segregants of JF1705 carrying plasmids pBG95 (UASG receiver) and pHL592 (pRS SLN1Delta R) for this analysis. Each colony was cultured in YPD medium overnight and plated on YPD medium for single colonies. Single colonies were replica-plated to SC-His and SC-Trp plates.
b Single colonies that failed to grow on SC-His plates or on SC-Trp plates are presumed to stem from individual cells in which the receiver domain (HIS3) or transmitter domain (TRP1) plasmids have been lost.

Receiver Domain Overexpression Has No Effect on Growth or P-lacZ Activity

To further examine the role of the receiver domain in signal transduction, the Sln1 receiver domain was overexpressed in both wild type (SLN1+) and nrp2 strains. If the receiver plays an inhibitory role, overexpression had the potential both to diminish phosphorylation of Ssk1 and therefore activate the Hog1 pathway (causing lethality) and to diminish signaling to Mcm1. We found that galatose-induced overexpression of the UASG-regulated Sln1 C-terminal receiver domain had no effect on doubling time nor on the P-lacZ reporter gene activity of SLN1+ cells (Table VI). Taking advantage of a 9-aa hemagglutinin epitope tag (YPYDVPDYA) inserted at aa 1065, it was possible to confirm by Western analysis the presence of high levels of the receiver domain (a single species migrating at 22 kDa) in extracts prepared from galactose grown cells and not in extracts prepared from glucose grown cells (data not shown). A second indication that the liberated receiver molecule was indeed capable of interacting and functioning with the intact Sln1p molecule, albeit inefficiently, was the observation that the overexpressed receiver domain partially complemented the activation phenotype of the nrp2-2 mutant (Table VI). Thus, the absence of an effect of overexpressing the Sln1p receiver on viability and Mcm1-dependent transcription again argues that the Sln1 receiver domain is likely to play a positive and not a negative role in signal transduction.

Table VI. Effects of receiver domain overexpression on P-lacZ activity


Genomic SLN1a Plasmidb Growth conditionc  beta -gal. activityd (S.D.) (n)

SLN1+ Vector Glucose 215.0 (33) (4)
SLN1+ UASG receiver Glucose 187.4 (17) (7)
nrp2-2 Vector Glucose 658.9 (91) (8)e
nrp2-2 UASG receiver Glucose 620.4 (89) (8)e
SLN1+ Vector Galactose 115.5 (25.9) (4)
SLN1+ UASG receiver Galactose 104.7 (19.6) (7)
nrp2-2 Vector Galactose 437.5 (66) (8)e
nrp2-2 UASG receiver Galactose 259.0 (38.4) (8)e

a The nrp2-2 strain (JF1675) is an isogenic derivative of the SLN1+ strain, FY251, created by two-step transformation using plasmid pWT5. Each strain carries the P-lacZ reporter, pGY48.
b Vector, pSV146; UASG receiver, pBG95.
c Cells were cultured overnight in SC raffinose -Ura His to maintain selection for the P-lacZ reporter and the receiver domain plasmid and then subcultured into SC galactose -Ura His or SC glucose -Ura His media and incubated for 5 h at 30 °C.
d beta -Galactosidase activity is expressed in Miller units as the average of (n) measurements. S.D., standard deviation of the mean is shown in parentheses.
e Ten trials were performed; however, the high and low values were not included in calculating the average or the standard deviation.


DISCUSSION

Sln1p Phosphorylation Controls Two Pathways

The phosphotransfer capabilities of Sln1p have been shown to be important for regulation of the Hog1 MAP kinase osmotic response pathway, and it is clear that hyperosmotic conditions promote the accumulation of unphosphorylated Sln1p (9). We previously showed that Sln1p separately regulates the activity of Mcm1-dependent genes and suggested that this function of Sln1p might involve the phosphorylated form of Sln1p (13). To provide evidence for this assertion and to determine whether activation of the Mcm1 pathway, like activation of the Hog1 pathway, involves the phosphotransfer capabilities of Sln1p, we investigated the effect of nrp2 mutations on the capacity of the cell to respond to osmotic stress. The osmotic phenotype of nrp2 mutants suggests that activation of the Mcm1 pathway by the nrp2 mutations decreases the unphosphorylated Ssk1p that is available to stimulate the Hog1 pathway. The absence of Hog1p phosphorylation in the nrp2 strains is consistent with this interpretation. These results demonstrate that phosphorylation of Sln1p has at least two functions: one is to turn off the Hog1 pathway through the action of the receiver, Ssk1p, and the other is to activate Mcm1p. This is accomplished in an Ssk1p-independent manner. These results do not distinguish whether Mcm1p activation is dependent on the phosphotransfer capabilities of Sln1p or if it simply depends on histidine phosphorylation of Sln1p. For example, Sln1p phosphorylation may be required to induce a conformational change which in turn mediates a particular protein-protein interaction. However, the location of the nrp2-2 and nrp2-3 mutations in the receiver domain at positions likely to affect the stability of the aspartyl phosphate suggests that Sln1p-H to Sln1p-D phosphotransfer as well as the histidine autokinase activities of Sln1p are important for Mcm1p activation. In vitro phosphorylation and phosphotransfer experiments are underway that will further test this idea.

nrp2 Mutations Are Localized in Both the Transmitter Kinase and Receiver Domains of Sln1p

Two of three nrp2 alleles are changes in proline residues in positions highly conserved between other two-component receivers. In CheY, these residues are postulated to be critical for the conformation of the CheY receiver. The nrp2-2 mutation is a P right-arrow S mutation at residue 1148 of Sln1p. This position, four amino acids downstream of the phosphoryl aspartate residue, corresponds to P61 of CheY. This residue is part of a structurally important gamma -turn loop. The proximity of this base pair to the phosphorylation domain, as well as its solvent accessibility and high degree of conservation, has led to the suggestion that this loop region of response regulators is likely to be important for recognition by kinases (25).

The nrp2-3 mutation is a P right-arrow L mutation at residue 1196 of Sln1p. This position corresponds to the highly conserved P110 of CheY which makes a cis-peptide bond with the absolutely conserved Lys-109 residue to form a rigid beta 5-alpha 5 loop that is postulated to be important in propagating conformational changes as a result of activation (25). The side chain of Lys-109 interacts with Asp-57 in the acidic pocket in the structure of unphosphorylated CheY (26). Although detailed structural information is unavailable for the phosphorylated form of CheY, phosphorylation is expected to perturb the Lys-109-Asp-57 interaction, initiating the switch to the active conformation. The beta 5-alpha 5 loop also contributes to the solvent accessible face that interacts alternately with CheA and the flagellar motor proteins (27). Interestingly, the K109R mutation in CheY blocks the interaction of P-CheY with the phosphatase, CheZ, and therefore results in substantial decreases in dephosphorylation rates as well as decreased phosphorylation rates (25, 28).

In contrast to nrp2-2 and nrp2-3, the nrp2-1 mutation is not located in the receiver domain. nrp2-1 is a T right-arrow I mutation located in the linker region between the histidine kinase domain and the transmembrane domains. The position of this mutation is reminiscent of activating mutations in bvgS, a hybrid two-component regulator involved in virulence from Bordetella pertussis and narX, an Escherichia coli sensor involved in regulation of anaerobic respiratory genes. Constitutive mutations in these proteins have been mapped to a flexible linker region between the transmembrane domains and the histidine kinase domain (29, 30). This type of mutation may trigger signal transmission in a signal-independent fashion by mutational simulation of an appropriate conformational state. Alternatively, in the case of Sln1p, phosphorylation of the affected threonine may normally modulate the activity of the histidine kinase.

An explanation of the activating phenotype of nrp2 mutations we have identified must account for the fact that they are recessive. An increase in receiver phosphorylation can occur by either increased rate of phosphorylation or a decreased rate of dephosphorylation. We do not believe that the nrp2 mutations increase kinase activity because it is not apparent how an increase in kinase activity could be recessive (13). The recessiveness of the nrp2 mutations is more consistent with a defect in a postulated Sln1p-associated aspartyl-directed phosphatase-like activity. Perhaps the receiver domain mutations nrp2-2 and nrp2-3 cause decreased sensitivity to a phosphatase. These mutations lie within the exposed gamma  and beta 5-alpha 5 loops which are postulated to define a surface involved in protein-protein interactions. On the other hand, since many bacterial transmitter kinases possess inherent phosphatase activity toward their respective receivers, the nrp2-1 mutant may be defective in a putative Sln1p transmitter kinase-associated phosphatase activity (7, 31, 32). Since Sln1p, like other two-component regulators appears to function as a dimer (9), functional interactions with a phosphatase may be provided in trans and thus account for the recessiveness of the nrp2 activating phenotype.

Two Possible Roles of the Sln1p Receiver Domain Regulatory Versus Signaling

Since SSK1 has no apparent role in signaling to Mcm1p, we considered a possible role for the Sln1p receiver domain in signaling to the Mcm1p branch of the pathway. The role of the attached receiver domain in hybrid kinases is not clear. In the case of VirA and ArcB and others, it appears to have at least in part an inhibitory role, since deletion of the domain leads to increased signaling (4, 5). Thus the attached receiver domain appears to prevent phosphotransfer to the cytoplasmic response regulator and to downstream targets until signal-mediated histidine autophosphorylation and internal phosphotransfer leads to a change in conformation that allows phosphotransfer to a second substrate. An alternate, but not necessarily mutually exclusive, role for the attached receiver is in signal transmission. Phosphorylation of the attached receiver may be required for subsequent phosphorylation of the cytoplasmic receiver or other downstream molecules. The observation that mutation of the Sln1p aspartate target from aspartate to asparagine (D1144N) has a phenotype equivalent to the SLN1 null (9) indicates that Asp-1144 is important but does not distinguish between the two models. If the role of Sln1p Asp-1144 is in inhibiting phosphotransfer to a second molecule, removal of that domain might be expected to relieve the inhibition and promote phosphorylation of Ssk1p. Hyperphosphorylation of Ssk1p might inhibit the activation of the Hog1 pathway in response to salt but would not be lethal. Hence the requirement for the Sln1p receiver domain to support viability in a sln1-Delta mutant argues that the Sln1p receiver domain must have a role in signal transmission. The signaling role of the Sln1p receiver is consistent with conclusions from a very recent study by Saito and colleagues (10) in which an in vitro system was used to demonstrate transfer of the histidine phosphate from the transmitter kinase to the receiver aspartate followed by transfer to the histidine of a phosphorelay intermediate, Ypd1p, and finally to the aspartate of Ssk1p (10).

In conclusion, our analysis of the nrp2 alleles of SLN1 has shown that phosphorylation of Sln1p has two effects in the cell, inhibition of the Hog1 MAP kinase pathway and activation of Mcm1-dependent transcription. It is interesting to speculate that the linkage of Mcm1p activation to the Hog1 osmosensing pathway through Sln1p may indicate that the cell must regulate the activity of Mcm1p in response to changes in environmental osmolarity. Since Mcm1p is suspected or known to be involved in regulating a large number of different physiological processes including cell cycle, cell wall structure, metabolism, and cell type (33-37), regulation of Mcm1p activity may coordinate the physiology of the cell under hyperosmotic conditions.


FOOTNOTES

*   This work was supported by Grant VM148 from the American Cancer Society (to J. S. F. and R. J. D.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§   To whom correspondence should be addressed. Tel.: 319-335-1542; Fax: 319-335-1069; E-mail: jan{at}biovax.biology.uiowa.edu.
   Current address: Dept. of Biology, Indiana University, Bloomington, IN 47405.
1   The abbreviations used are: MAP kinase, mitogen-activated protein kinase; P, Mcm1 binding site; P-lacZ, Mcm1-dependent reporter; kb, kilobase pair(s); UAS, upstream activation sequence; UASG, upstream activation sequence from the GAL1, 10 genes; HA, hemagglutinin; aa, amino acid.

ACKNOWLEDGEMENTS

Many thanks to our generous colleagues, H. Saito and Fred Winston for strains and plasmids, to J. Hoch for insightful discussions, and to P. Geyer for critical comments on the manuscript.


REFERENCES

  1. Parkinson, J. S. (1993) Cell 73, 857-871 [CrossRef][Medline] [Order article via Infotrieve]
  2. Stock, J. B., Stock, A. M., and Mottonen, J. M. (1990) Nature 344, 395-400 [CrossRef][Medline] [Order article via Infotrieve]
  3. Swanson, R. V., Alex, L. A., and Simon, M. I. (1994) Trends Biochem. Sci. 19, 485-490 [CrossRef][Medline] [Order article via Infotrieve]
  4. Iuchi, S. (1993) J. Biol. Chem. 268, 23972-23980 [Abstract/Free Full Text]
  5. Chang, C.-H., and Winans, S. (1992) J. Bacteriol. 174, 7033-7039 [Abstract/Free Full Text]
  6. Perego, M., and Hoch, J. A. (1996) Trends Genet. 12, 97-101 [CrossRef][Medline] [Order article via Infotrieve]
  7. Stock, J. B., Surett, M. G., Levit, M., and Park, P. (1995) in Two-component Signal Transduction (Hoch, J. A., and Silhavy, T. J., eds), pp. 25-51, American Society for Microbiology, Washington, D. C.
  8. Ota, I. M., and Varshavsky, A. (1993) Science 262, 566-568 [Abstract/Free Full Text]
  9. Maeda, T., Wurgler-Murphy, S., and Saito, H. (1994) Nature 369, 242-245 [CrossRef][Medline] [Order article via Infotrieve]
  10. Posas, F., Wurgler-Murphy, S. M., Maeda, T., Witten, E. A., Thai, T. C., and Saito, H. (1996) Cell 86, 865-875 [CrossRef][Medline] [Order article via Infotrieve]
  11. Brewster, J. L., de Valoir, T., Dwyer, N. D., Winter, E., and Gustin, M. C. (1993) Science 259, 1760-1762 [Abstract/Free Full Text]
  12. Maeda, T., Takekawa, M., and Saito, H. (1995) Science 269, 554-558 [Abstract/Free Full Text]
  13. Yu, G., Deschenes, R. J., and Fassler, J. S. (1995) J. Biol. Chem. 270, 8739-8743 [Abstract/Free Full Text]
  14. Rothstein, R. J. (1983) Methods Enzymol. 101, 202-209 [Medline] [Order article via Infotrieve]
  15. Sherman, F., Fink, G. R., and Hicks, J. B. (1986) Methods in Yeast Genetics, Revised Ed., pp. 163-167, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York
  16. Larson, G. P., Itakura, K., Ito, H., and Rossi, J. J. (1983) Gene (Amst.) 22, 31-39 [CrossRef][Medline] [Order article via Infotrieve]
  17. Yu, G., and Fassler, J. S. (1993) Mol. Cell. Biol. 13, 63-71 [Abstract/Free Full Text]
  18. Guarente, L., and Ptashne, M. (1981) Proc. Natl. Acad. Sci. U. S. A. 78, 2199-2203 [Abstract/Free Full Text]
  19. Sikorski, R. S., and Hieter, P. (1989) Genetics 122, 19-27 [Abstract/Free Full Text]
  20. Rose, A. B., and Broach, J. R. (1990) Methods Enzymol. 185, 234-279 [Medline] [Order article via Infotrieve]
  21. Ito, H., Fukuda, Y., Murata, K., and Kimura, A. (1983) J. Bacteriol. 153, 163-168 [Abstract/Free Full Text]
  22. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. E., Seidman, J. G., Smith, J. A., and Struhl, K. (1989) Current Protocols in Molecular Biology, Vol. 2, pp. 13.7.1-13.7.2, John Wiley & Sons, Inc., New York
  23. Rothstein, R. (1991) Methods Enzymol. 194, 281-301 [CrossRef][Medline] [Order article via Infotrieve]
  24. Hoffman, C. S., and Winston, F. (1987) Gene (Amst.) 57, 267-272 [CrossRef][Medline] [Order article via Infotrieve]
  25. Volz, K. (1995) in Two-component Signal Transduction (Hoch, J. A., and Silhavy, T. J., eds), pp. 53-64, American Society for Microbiology, Washington, D. C.
  26. Bellsolell, L., Prieto, J., Serrano, L., and Coll, M. (1994) J. Mol. Biol. 238, 489-495 [CrossRef][Medline] [Order article via Infotrieve]
  27. Shukla, D., and Matsumura, P. (1995) J. Biol. Chem. 270, 24414-24419 [Abstract/Free Full Text]
  28. Blat, Y., and Eisenbach, M. (1994) Biochemistry 33, 902-906 [CrossRef][Medline] [Order article via Infotrieve]
  29. Miller, J. F., Johnson, S. A., Black, W. J., Beattie, D. T., Mekalanos, J. J., and Falkow, S. (1992) J. Bacteriol. 174, 970-979 [Abstract/Free Full Text]
  30. Kalman, L. V., and Gunsalus, R. P. (1990) J. Bacteriol. 172, 7049-7056 [Abstract/Free Full Text]
  31. Igo, M. M., Ninfa, A. J., Stock, J. B., and Silhavy, T. J. (1989) Genes Dev. 3, 1725-1734 [Abstract/Free Full Text]
  32. Aiba, H., Nakasai, F., Mizushima, S., and Mizuno, T. (1989) J. Biol. Chem. 264, 14090-14094 [Abstract/Free Full Text]
  33. Chen, Y., and Tye, B.-K. (1995) Mol. Cell. Biol. 15, 4631-4639 [Abstract]
  34. Althoefer, H., Schleiffer, A., Wassman, K., Nordheim, A., and Ammerer, G. (1995) Mol. Cell. Biol. 15, 5917-5928 [Abstract]
  35. Kuo, M. H., and Grayhack, E. (1994) Mol. Cell. Biol. 14, 348-359 [Abstract/Free Full Text]
  36. Maher, M., Cong, F., Kindelberger, D., Nasmyth, K., and Dalton, S. (1995) Mol. Cell. Biol. 15, 3129-3137 [Abstract]
  37. Lydall, D., Ammerer, G., and Nasmyth, K. (1991) Genes Dev. 5, 2405-2419 [Abstract/Free Full Text]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
S. S. Narang, C. L. Malone, R. J. Deschenes, and J. S. Fassler
Modulation of Yeast Sln1 Kinase Activity by the Ccw12 Cell Wall Protein
J. Biol. Chem., January 25, 2008; 283(4): 1962 - 1973.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
A. Yoshimi, K. Kojima, Y. Takano, and C. Tanaka
Group III Histidine Kinase Is a Positive Regulator of Hog1-Type Mitogen-Activated Protein Kinase in Filamentous Fungi
Eukaryot. Cell, November 1, 2005; 4(11): 1820 - 1828.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.