![]()
|
|
||||||||
(Received for publication, October 25, 1996, and in revised form, January 24, 1997)
From the We have purified a secreted proteinase of 23 kDa
from carp head kidney by sequential column chromatography on a Reactive
Blue 72-agarose dye affinity column and an FPLC Mono-P column. The secretion of this proteinase from carp head kidney can be stimulated by
high concentrations of potassium. Since the carp proteinase is present
mainly in the head kidney, kidney, and spleen (all of which are
lymphohematopoietic organs), it is named nephrosin. The carp nephrosin
is most sensitive to metal chelators, but not to inhibitors specific
for other classes of proteinases. A cDNA clone has been isolated
from a carp head kidney cDNA library by immunoscreening with a
polyclonal antiserum raised against purified nephrosin. The cloned
cDNA is 1086 base pairs in length and has an open reading frame
encoding a protein of 273 amino acids, including a 19-amino acid signal
peptide and 56-amino acid propeptide. The deduced amino acid sequence
shows moderate levels of identity to medaka HCE1 (52.5%), medaka LCE
(50.7%), crayfish astacin (33.2%), murine meprin- Teleost head kidney consists of interrenal tissue (1-3)
homologous to the adrenal cortex, chromaffin cells (4, 5) responsible for epinephrine and norepinephrine secretion, immune cells (6-9) responsible for immunoglobulin M secretion, and hematopoietic cells (6,
10, 11). Bone marrow is not present in fish, whereas hematopoietic
tissues and lymphatic tissues co-exist in the lymphohematopoietic
organs. In addition to the head kidney, spleen and kidney are also
lymphohematopoietic organs in teleost fish (6).
The presence of four different types of cells (neurons, endocrine
cells, immune cells, and hematopoietic cells) in the head kidney
prompted us to study the secreted proteins from head kidney since these
cells are all active in secretion. Interacting molecules may be
secreted by one cell type in a paracrine mode to exert its effects on
neighboring cells or on the extracellular matrix (ECM).1 Therefore, we attempted to purify
the secreted proteins from carp head kidney and eventually to
understand the functions of the secreted molecules. Here, we report the
purification and cloning of one secreted protein, nephrosin. Nephrosin
is a zinc metalloproteinase and is present mainly in the gill, kidney,
head kidney, and spleen. We have also demonstrated that secretion of
nephrosin can be stimulated by high concentrations of extracellular
potassium. Amino acid sequence analysis reveals that nephrosin is most
closely related to medaka hatching enzymes, members of the astacin
family (12). However, our evidence suggests that nephrosin is probably
not a hatching enzyme.
Common carp (Cyprinus
carpio) purchased from a local fish market were held in plastic
tanks (40 × 45 × 80 cm) under natural temperature and
photoperiod for 1 day before experiments. Fish were decapitated between
10 and 11 a.m. The head kidney was carefully removed and placed in
the normal perfusion buffer consisting of 125 mM NaCl, 5 mM KCl, 1.5 mM CaCl2, 0.9 mM MgSO4, 10 mM glucose, and 10 mM NaPO4, pH 7.4. The setup of perfusion system
was essentially the same as described (13). Following a 90-min
stabilization period, perfusate samples were collected for eight 10-min
intervals. For the control group, tissue was perfused with the normal
perfusion medium throughout the perfusion period, whereas for the
experimental group, a high potassium perfusion medium (50 mM potassium, 80 mM NaCl, 1.5 mM
CaCl2, 0.9 mM MgSO4, 10 mM glucose, and 10 mM NaPO4, pH
7.4) was administered for 20 min starting from collection interval two.
Perfusate samples were then frozen at Carp head kidneys (20 g) were
homogenized in 200 ml of 20 mM Tris-HCl containing 5 mM EDTA, pH 8.0, by a glass homogenizer. The supernatant
was collected by centrifugation at 12,000 × g for 30 min, and 0.3 M NaCl was added to the supernatant. The
sample was then applied onto a Reactive Blue 72-agarose column
(2.5 × 10 cm; Sigma) equilibrated with 0.3 M NaCl in
the homogenization buffer and eluted stepwise by 0.3 M, 0.6 M, and 1.0 M NaCl in the homogenization buffer.
All three elution steps would desorb nephrosin from the column but the
0.6 M NaCl fractions contained nephrosin activity of the
highest purity. The 0.6 M NaCl fractions were pooled,
lyophilized, and dissolved in 25 mM imidazole/HCl buffer,
pH 7.1, and applied to an FPLC Mono P HR5/5 column (Pharmacia Biotech
Inc.). Purification was achieved by a 10-min elution with 25 mM imidazole, pH 7.1, and a 40-min elution with 10%
Polybuffer, pH 4.0 (Pharmacia Biotech Inc.) at a constant flow rate of
0.8 ml/min. The active fractions were pooled, dialyzed against 100 mM ammonium bicarbonate, and lyophilized. Proteolytic
activities of nephrosin during each purification step were monitored
with the proteolytic zymographic assay (see below). Protein
concentrations were determined by a Coomassie Blue binding assay with
bovine serum albumin (BSA) as the standard (15).
Gel electrophoresis was performed using
a Tricine SDS-PAGE system as described previously (16). The gel
concentration was 7.5%, and the bisacrylamide to acrylamide ratio was
6%. For proteolytic zymographic assay, Tricine SDS-polyacrylamide gel
was prepared as described (17, 18), except that the gel contained 0.1% reduced and carboxymethylated BSA (RCM-BSA). After electrophoresis, the
gel was incubated for 1 h at 27 °C with 2% Triton X-100 in 20 mM Tris-HCl, pH 8.0 once and Tris buffer containing 0.1 mM ZnCl2 twice, each for 90 min. The gel was
then stained with 0.2% Coomassie Blue R250 in 40% methanol, 7%
acetic acid and destained with 30% methanol, 7% acetic acid.
The effects of various
inhibitors against nephrosin were examined using RCM-BSA as a
substrate. The enzyme samples (0.1 µg in 10 µl) were preincubated
with a particular inhibitor or buffer alone (mock) on ice for 10 min,
and the reaction was initiated by the addition of 20 µl of substrate
solution (30 µg of RCM-BSA in 20 mM Tris-HCl containing
15 µM ZnCl2, pH 8.0). The reaction was
maintained at 27 °C for 1 h and stopped by the addition of 30 µl of 2 × concentrated SDS sample buffer without
2-mercaptoethanol. The reaction mixture was then boiled for 3 min. Four
µl of the sample were analyzed by SDS-PAGE, and the amounts of
residual RCM-BSA was calculated using an Imaging Densitometer (Bio-Rad GS-670). For each treatment, the amounts of RCM-BSA digested (total RCM-BSA minus residual RCM-BSA) were calculated and compared with those
of mock treatment.
The peptides (10 µg in 40 µl) were dissolved in 20 mM ammonium bicarbonate
containing 15 µM ZnCl2. The reaction was
started by adding 10 µl of enzyme solution (0.1 mg/ml) in 20 mM ammonium bicarbonate, and the mixture was incubated at
27 °C for 1 h. The reaction mixture was then lyophilized,
dissolved in 0.1% trifluoroacetic acid, and separated on a
reverse-phase C18 column eluted with a linear gradient of
acetonitrile in 0.1% trifluoroacetic acid. Each peak was collected,
lyophilized, and subjected to amino acid sequencing (model 477A;
Applied Biosystems, Forest City, CA).
The proteolytic activities of nephrosin was
determined by using the synthetic peptides,
N-tosyl-Gly-Pro-Arg-p-nitroanilide, N-succinyl-Ala-Ala-Pro-Phe-p-nitroanilide,
N-carbobenzoxy-Gly-Gly-Leu-p-nitroanilide, and
N-succinyl-Ala-Ala-Pro-Leu-p-nitroanilide,
respectively (19), as substrates.
The Mono-P fraction
was dissolved in phosphate-buffered saline (PBS) and thoroughly mixed
with an equal volume of Freund's complete adjuvant for the first
injection or Freund's incomplete adjuvant for the second and third
injections. Approximately 100 µg of nephrosin was injected
subcutaneously into the back of a guinea pig during each immunization,
biweekly. Ten days after the third injection, the blood was collected
by heart puncture and serum stored at 4 °C. Western blotting was
carried out using guinea pig anti-nephrosin antiserum (1:2000 dilution)
and horseradish peroxidase-conjugated second antibody (1:1000 dilution)
after electrotransfer to nitrocellulose paper (0.22 µm, Sartorius). Immunoreactive bands were detected by the NiCl2 enhancement
method (20).
Female carp were injected twice at
the base of pectoral fin with PBS homogenate of one pituitary, each
6 h apart. Ovulation occurred 12 h after the first injection
(21). Ovulated eggs were collected and mixed with spontaneously
spermiated milt for 5 min and then dispersed with tap water. Fertilized
eggs were then allowed to develop at 25 °C with constant compressed
air bubbling, and water was replaced twice a day. Embryos were
harvested between 70 and 72 h after fertilization and frozen in
liquid nitrogen. Hatching liquid was collected at 82 h when more
than 80% of the embryos completed hatching, and then frozen at
Standard procedures in
molecular biology were used for preparation of plasmid DNA, restriction
enzyme digestion, DNA agarose gel electrophoresis, DNA ligation, and
the transformation of bacteria (22).
A
carp head kidney cDNA library prepared from poly(A)-enriched RNA by
unidirectional insertion of cDNA into Plasmids carrying
cDNA inserts were sequenced in both directions using the T7
Sequenase version 2.0 (U.S. Biochemical Corp.) and the dideoxy chain
termination method (24). A search for related sequences in GenBankTM,
EMBL, SWISS-PROT, and Protein Identification Resource was carried out
with an IFIND program using the FASTA algorithm of Pearson and Lipman
(25). Alignment of the deduced amino acid sequences with known members
of the astacin family was accomplished with the Clustal W multiple
alignment program (26).
Total RNA was isolated from carp
blood cells, brain, gill, heart, head kidney, intestine, kidney, liver,
ovary, spleen, and late embryos with the RNAzol B kit (Biotecx,
Houston, TX). Twenty µg of total RNA from each tissue was
fractionated on 1% formaldehyde-agarose gel in MOPS buffer and
transferred onto a Hybond-N membrane (Amersham Corp.). Following
prehybridization for 1 h in 50% formamide, 5 × SSC, 2%
blocking reagent (Boehringer Mannheim), 0.1%
N-laurylsarcosine, 0.02% SDS at 50 °C for 1 h,
blots were hybridized with a polymerase chain reaction-generated
digoxigenin (DIG)-labeled cDNA probe for 20 h under identical
conditions. Blots were washed twice for 5 min with 2 × SSC
containing 0.1% SDS at room temperature and twice for 15 min at
68 °C with 0.1 × SSC containing 0.1% SDS. Detection of DIG
signals was accomplished using the DIG luminescent detection kit
(Boehringer Mannheim). The cDNA probe used for Northern blotting
was synthesized by the polymerase chain reaction DIG probe synthesis
kit (Boehringer Mannheim) with two primers derived from nephrosin
sequence; F1, CGGAGCCGTCCTGTTGAGGA (nucleotides 75-94) and R1,
CCCCGTAAAGGAGTTTAGGCC (nucleotides 378-397).
During the perfusion of carp head
kidney, the spontaneous release of proteins or leakage of proteins due
to handling damage of the tissue tended to decrease with time (data not
shown). However, in response to a 50 mM potassium
stimulation, higher amounts of protein were released by the carp head
kidney (Fig. 1). The amounts of protein of 15, 23 (p23),
28, 64, and 70 kDa in the perfusate samples following the potassium
treatment were elevated for 20-30 min and then returned to a lower
level. Using a zymographic assay, we found that a proteinase activity
was associated with the electrophoretic mobility of p23. Therefore, we
attempted to purify this secreted proteinase from carp head kidney. By
sequential chromatography on a Reactive Blue 72-agarose (Fig.
2A) and a FPLC-Mono P column (Fig.
2B), we purified the 23-kDa proteinase to near homogeneity (Fig. 2C and Table I). N-terminal protein
sequencing of this protein revealed a single sequence:
NADPXTARRXKWRKSRNGLV-. The low recovery of
nephrosin by the purification procedures was because we collected the
fraction with the highest purity (0.6 M NaCl) only.
However, by this purification scheme, the whole procedure can be
accomplished within 10 days.
Table I.
Summary of purification of nephrosin from carp head kidney
The proteolytic activity
of nephrosin could be demonstrated using SDS-PAGE zymography with
gelatin, RCM-BSA, or RCM-fibrin as a substrate(data not shown). To
determine the preference of cleavage sites by nephrosin, we examined
various peptide-nitroanilides and peptides. None of the
peptide-nitroanilides, including tosyl-GPK-NA, succinyl-AAPF-NA,
succinyl-AAPL-NA and N-carbobenzoxy-GGL-NA, were digested by
nephrosin (Table II). Obviously, nephrosin did not
hydrolyze the amide bond of these nitroanilides. However, nephrosin
cleaved certain peptide bonds of synthetic substance P and
Lys-bradykinin. When bradykinin derivatives of different length were
tested for their digestion by nephrosin, it was found that there is a
length requirement for being a substrate. Nephrosin did not cleave the
terminal peptide bonds of bradykinin 1-5 and bradykinin 1-6. Among
the digestible substrates, nephrosin cleaved at the Gln-Phe and Phe-Phe
bonds of substance P and at the Gly-Phe and Phe-Ser bonds of bradykinin
derivatives with a preference for phenylalanine at the P1
position and proline at the
P2/P3/P4 position. Therefore,
nephrosin mainly functions as an endopeptidase with little exopeptidase
or amidase activity.
Table II.
Digestion of synthetic peptide substrates by nephrosin
Volume 272, Number 21,
Issue of May 23, 1997
pp. 13772-13778
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
§,
,
and
**
Graduate Institute of Biochemical Sciences
and ¶ Department of Zoology,
Institute of Biological Chemistry,
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENT
REFERENCES
(34%), and
murine meprin-
(33.5%), all members of the astacin family of zinc
endopeptidases. Nephrosin is the first member of the astacin family
found in lymphohematopoietic tissues.
Perfusion of Carp Head Kidney
20 °C until use for
immunoblot, zymographic (see below), and lactate dehydrogenase assay
(14).
70 °C.
-ZAP II (23) was purchased
from Stratagene (La Jolla, CA). The
-ZAP phages were plated at a
density of 5 × 104 plaques/agar plate (150 mm, inner
diameter). A total of 60 plates was screened. After incubation for
3 h at 42 °C, the plates were overlaid with nitrocellulose
filters (pore size, 0.45 µm; Micron Separations, Westboro, MA) that
had been impregnated with 10 mM isopropyl-1-thio-
-D-galactopyranoside. Incubation was
continued overnight at 37 °C. The filters were then removed, washed
with PBS at room temperature, and blocked with 3% skim milk in PBS for
1 h at room temperature. Following blocking, filters were probed
with a polyclonal antiserum specific for carp nephrosin at a 1:500
dilution in PBS containing 3 mg/ml bovine serum albumin, 1 mM EDTA, and 0.4% Triton X-100 at 4 °C for 16 h.
The filters were then washed three times at room temperature in PBS and
incubated with horseradish peroxidase-conjugated anti-guinea pig IgG
(Sigma) for 1 h at room temperature. After three washes with PBS,
the immune complexes were incubated in PBS containing 0.2 mg/ml
diaminobenzamidine and revealed by adding H2O2
(10 µl in 10 ml of PBS). Phages displaying stronger signals were
isolated for secondary screening. One positive clone was isolated after
screening 3 × 106 plaques, and pBluescript plasmids
containing cDNA inserts were obtained by in vivo
excision according to the protocols provided by Stratagene.
Purification of Nephrosin
Fig. 1.
Secretion of proteins from carp head kidney
perfused in vitro. After tissue was equilibrated with
fish saline for 90 min, samples of perfusate were collected for eight
10-min intervals. Perfusion medium was changed from normal fish saline
to that containing 50 mM potassium for 20 min at the
beginning of interval 2. The perfusate samples were analyzed by
SDS-PAGE and silver staining.
[View Larger Version of this Image (71K GIF file)]
Fig. 2.
A and B, elution profiles of
nephrosin from Reactive Blue 72-agarose (A) and Mono-P
columns (B). Head kidney extract (200 ml) was
chromatographed on a Reactive Blue 72-agarose column. Fractions of 6 ml
were collected at a flow rate of 25 ml/h. Proteins obtained from the
first column (80 µg) were chromatographed on a Mono-P column
equilibrated with 20 mM imidazole, pH 7.1, and eluted with
10% Polybuffer, pH 4.0. Fractions containing nephrosin were collected
as indicated by bar on the figure. Crude extract (lane
1) and samples from the Reactive Blue 72-agarose column (lane 2) and from Mono-P column (lane 3) were
analyzed by SDS-PAGE and silver staining (C).
[View Larger Version of this Image (19K GIF file)]
Step
Volume
Protein
Activitya
Specific
activity
Yield
Purification
ml
mg
units
units/mg
%
-fold
Extractb
200
2207
119.2
0.054
100
1
Dye column
48
0.376
6.28
16.70
5.27
172
Mono-P
4
0.098
1.78
18.16
1.49
187
a
One unit of activity is defined as the amount of
nephrosin causing the same proteolytic activity as 1 unit of
chymotrypsin in the RCM-BSA zymographic assay.
b
A total of 20 g of carp head kidney was used in this
preparation.
Substrates
Sequencesa
Hydrolysis
Tosyl-GPK-NA
GPK
NDb
Suc-AAPF-NA
AAPF
ND b
Suc-AAPL-NA
AAPL
ND b
Cbz-GGL-NA
GGL
ND b
Substance
P
RPKPQQ
F
FGLM-NH2Complete
Lys-Bradykinin
KRPPG
F
SPFRComplete
Bradykinin 1-5
RPPGF
ND b
Bradykinin 1-6
RPPGFS
ND b
Bradykinin 1-7
RP
PGFSPPartial
Des-Arg-bradykinin
PP
GFSPFRComplete
a
indicates bonds cleaved by carp nephrosin, and
indicates major cleavage site.
b
ND, nondetectable in 60 min.
Various inhibitors were tested for their effects on nephrosin with RCM-BSA as a substrate (Table III). The chelating agents including 1,10-phenanthroline, EDTA, captopril, and diethyldithiocarbamic acid inhibited the proteolytic activity of nephrosin to a great extent, especially 1,10-phenanthroline and diethyldithiocarbamic acid. Inhibitors of other classes of proteinases were ineffective. The results indicate that nephrosin is a metalloproteinase.
|
|||||||||||||||||||||||||||||||||||||||||||||||||||
After screening 3 × 106 plaques with a polyclonal antiserum raised against
purified nephrosin, one positive clone was isolated. The nucleotide
sequence and the deduced amino acid sequence are shown in Fig.
3. The clone has an insert of 1086 bp including 32 bp of
the 5
-untranslated region, an open reading frame of 821 bp, and 232 bp
of the 3
-untranslated region. The putative initiating ATG codon, which
agrees with Kozak's rule (27), is at nucleotide 33. The open reading
frame is predicted to encode a protein of 273 amino acids, including a
19-amino acid signal peptide and a 56-amino acid propeptide. The
N-terminal 20 amino acid residues determined from purified nephrosin
matched with the deduced amino acid sequence. The deduced amino acid
sequence also confirms the presence of a propeptide sequence (see also sequence comparison data). The theoretical molecular mass of the mature
protein is 23089.35 Da, which is close to the estimated molecular mass
from SDS-PAGE analysis.
Sequence Homology
The deduced amino acid of nephrosin shows
moderate sequence identity (29-52.5%) with members of the astacin
family (Fig. 4) such as medaka HCE1 (52.5%), LCE
(50.7%; Ref. 28), crayfish astacin (33.2%; Ref. 29), murine
meprin-
(34%; Ref. 30), and murine meprin-
(33.5%; Ref. 31).
The N-terminal regions, including the signal peptide and propeptide
sequences, are most variable. All members are likely to be secreted and
further processed as evidenced by the presence of the signal and
propeptide sequences. The junction for the propeptide and mature
protein in nephrosin is at a similar position to that in other members.
Stretches of highly conserved sequences were found, especially in the
unique zinc binding motif,
HEXXHALGFXHEXXRXDRD. From
x-ray structural analyses of crayfish astacin (32), zinc ion is ligated
by three histidine residues, one tyrosine residue, and one water
molecule H-bonded to a glutamic acid residue. Five residues involved in the penta-coordination of zinc are conserved in all members. Most members of the family have extra domains C-terminal to the proteinase domain except crayfish astacin, medaka hatching enzymes, and carp nephrosin, which consist of only ~200 amino acid residues in the mature forms.
, mouse meprin-
; MuMep-
, mouse
meprin-
; DrTlr-1, Drosophila Tolloid-related-1; DrTld, Drosophila Tolloid;
HuBMP-1, human bone morphogenetic protein-1;
SpAN, sea urchin SpAN; BP10, sea urchin blastula
protease-10; HMP1, hydra metalloproteinase 1;
astacin, crayfish astacin. The degree of overall identity to
carp nephrosin is shown at the end.
Tissue Distribution
The presence of nephrosin in different
tissues was examined by immunoblotting (Fig. 5) with a
polyclonal antiserum against purified nephrosin and by Northern
blotting (Fig. 6) with nephrosin partial cDNA as a
probe. Only samples of gill, kidney, head kidney, and spleen contained
an immunoreactive protein of a similar molecular mass. Because of the
limited distribution of nephrosin in the kidney, head kidney, and
spleen, it was named nephrosin herein until we discover the true
physiological functions of this metalloproteinase. The DIG-labeled
cDNA probe for nephrosin hybridized with a single 1.2-kilobase band
in all samples except intestine and ovary, and with highest levels in
head kidney and kidney. This size of mRNA is in good agreement with
that of nephrosin clone (1086 bp). The lack of a protein signal in
heart extract is unusual, since its mRNA level was similar to that
of spleen.
Absence of Nephrosin in Carp Embryos
Due to the highest
sequence identity to medaka hatching enzymes (HCE2, HCE1, and LCE), we
wish to determine whether nephrosin is a carp hatching enzyme. Soluble
proteins and total RNA were prepared from 70-h embryos (a 80-h hatching
procedure) and subjected to immunoblot and Northern blot analysis (Fig.
7). In addition, hatching liquid was also harvested
after most embryos completed hatching. Using a comparable amount of
protein and RNA, both protein and mRNA signals were observed in
head kidney, but not in carp embryos or hatching liquid. Therefore, the
data suggest that nephrosin is unlikely to be a hatching enzyme
analogue, and that carp embryos at this stage expressed very little
nephrosin, if any.
Secretion of Nephrosin
Release of immunoassayable
nephrosin from carp head kidney fragments was measured using an
in vitro perfusion system. Fig. 8 shows the
effect of potassium-induced secretion of nephrosin. Nephrosin and a
degraded product of nephrosin were detected by immunoblotting following
a 50 mM potassium treatment (Fig. 8, upper
panel). The release of nephrosin was almost instantly following induction. The identity of nephrosin in the perfusate samples was
confirmed by SDS-PAGE zymography (Fig. 8, lower panel). The release of nephrosin was not due to damage of the perfused tissue since
lactate dehydrogenase activities in the perfusate samples were not
changed during the perfusion experiment (data not shown). The results
suggest that nephrosin is secreted by excitable cells in the head
kidney in response to membrane depolarization caused by the potassium
treatment.
Nephrosin is a new member of the astacin family of metalloproteinases based on the following observations: First, the activity of nephrosin is inhibited by metal chelators but not by inhibitors of other classes of proteinases, suggesting that it is a metalloproteinase. Second, cDNA encoding the purified protein was isolated from a carp head kidney cDNA library. One segment of the deduced amino acid sequence matches perfectly with the first 20 amino acids determined from the purified nephrosin. Bacterially expressed protein encoded by the cloned cDNA can be recognized by the same antiserum used for immunoscreening. In addition, the polyclonal antiserum raised against this recombinant protein recognized native nephrosin.2 Finally, the deduced primary structure of nephrosin resembles members of the astacin family. The most distinguished zinc-binding motif, HEXXHXXGFXHEXXRXDR, is also present in nephrosin. Astacin family members are all secreted proteinases containing a proteinase domain of approximately 200 amino acid residues (23 kDa). Most of the known members contain one or more copies of interaction domains such as EGF (epidermal growth factor)-like or CUB (complement/sea urchin EGF/BMP-1) that are C-terminal to the proteinase domain (12). However, the mature form of nephrosin does not contain any extra sequences C-terminal to the proteinase domain as with astacin and hatching enzymes (HCE1, HCE2, and LCE).
From sequence comparisons, nephrosin is most closely related to medaka hatching enzymes with >50% identity in amino acid sequence. Hatching enzymes are expressed in late stages of embryos in anticipation of hatching and can therefore be harvested from late embryos and hatching liquid (28, 33). However, we were not able to detect nephrosin in late embryos (mRNA and protein) or hatching liquid (protein). Therefore, the high degree of identity between nephrosin and medaka hatching enzymes most likely results from the fact that they are the only sequences from teleost in the astacin family, but not that nephrosin represents a carp hatching enzyme.
Most members of the astacin family are involved in developmental processes. They are hatching enzymes of medaka involved in degrading the egg shell of embryos (28, 33, 34), hydra HMP1 in head regeneration and tentacle differentiation (35), human BMP-1 in bone formation (36, 37), Drosophila Tolloid in dorsal-ventral pattern formation (38), and sea urchin BP10 and SpAN in differentiation of ectodermal lineages (39, 40). Few members of the astacin family are expressed in mature organisms in a tissue-specific manner. For examples, crayfish astacin is synthesized in the crayfish hepatopancreas and functions as a digestive enzyme (41). Mammalian meprins are expressed as dimeric proteins (42, 43) in the brush border membranes of kidney and intestine (44, 45). Along with these limited precedents, nephrosin is expressed in the gill, head kidney, kidney, and spleen of mature carp. Although nephrosin and meprins are all present in the kidney, they are not identical as suggested by differences in the primary structure and in the forms of mature protein (dimeric membrane protein versus monomeric soluble protein). In addition, meprin exhibits an arylamidase activity toward peptide-p-nitroanilide substrates (43) that are shown to be very poor substrates for nephrosin.
Our data show that nephrosin is secreted from carp head kidney and its secretion can be regulated by manipulation of the membrane potentials. The fact that nephrosin is present in the kidney, head kidney, and spleen suggests a role of nephrosin in the lymphohematopoietic system. Whether nephrosin is expressed by the immune system and/or by the hematopoietic system requires critical examinations. We are currently preparing antisera against proteins derived from both systems as cell type markers. Along with the antiserum against nephrosin, we may be in a better position to solve this problem by immunohistochemical staining procedures.
We speculate that expression of nephrosin at high levels in the lymphohematopoietic tissues suggests that the proteinase may function in ECM remodeling. One most striking feature pertaining to the tissues is the frequent migration of cells out of and into these sites (46). ECM proteins provide multiple interaction domains mediating adhesion of cells and ECM (47). Although studies on proteolytic remodeling of ECM have been focused largely on matrix metalloproteinases (48), meprin (49), and HMP1 (35) of the astacin family are also effective in degrading ECM proteins. In a preliminary experiment,3 we also found that nephrosin was able to degrade mammalian fibronectin, but not laminin or type IV collagen. In addition, nephrosin can degrade mammalian gelatin in a SDS-PAGE zymographic assay. We are now repeating these experiments using carp ECM as substrates.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) U62621[GenBank].
We are indebted to Dr. Chung-Ho Chang for critical comments on this manuscript.
This article has been cited by other articles:
![]() |
A. Harlin-Cognato, E. A. Hoffman, and A. G. Jones Gene cooption without duplication during the evolution of a male-pregnancy gene in pipefish PNAS, December 19, 2006; 103(51): 19407 - 19412. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kijimoto, M. Watanabe, K. Fujimura, M. Nakazawa, Y. Murakami, S. Kuratani, Y. Kohara, T. Gojobori, and N. Okada cimp1, A Novel Astacin Family Metalloproteinase Gene from East African Cichlids, Is Differentially Expressed Between Species During Growth Mol. Biol. Evol., August 1, 2005; 22(8): 1649 - 1660. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-D. Song, X.-J. Sun, M. Deng, G.-W. Zhang, Y. Zhou, X.-Y. Wu, Y. Sheng, Y. Chen, Z. Ruan, C.-L. Jiang, et al. Hematopoietic gene expression profile in zebrafish kidney marrow PNAS, November 16, 2004; 101(46): 16240 - 16245. [Abstract] [Full Text] [PDF] |
||||
![]() |
P.-L. Tsai, C.-H. Chen, C.-J. Huang, C.-M. Chou, and G.-D. Chang Purification and Cloning of an Endogenous Protein Inhibitor of Carp Nephrosin, an Astacin Metalloproteinase J. Biol. Chem., March 19, 2004; 279(12): 11146 - 11155. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Shibata, T. Iwamatsu, Y. Oba, D. Kobayashi, M. Tanaka, Y. Nagahama, N. Suzuki, and M. Yoshikuni Identification and cDNA Cloning of Alveolin, an Extracellular Metalloproteinase, Which Induces Chorion Hardening of Medaka (Oryzias latipes) Eggs upon Fertilization J. Biol. Chem., March 17, 2000; 275(12): 8349 - 8354. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Schissel, G. A. Keesler, E. H. Schuchman, K. J. Williams, and I. Tabas The Cellular Trafficking and Zinc Dependence of Secretory and Lysosomal Sphingomyelinase, Two Products of the Acid Sphingomyelinase Gene J. Biol. Chem., July 17, 1998; 273(29): 18250 - 18259. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||