Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow An addition or correction has been published
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hung, C.-H.
Right arrow Articles by Chang, G.-D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hung, C.-H.
Right arrow Articles by Chang, G.-D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


Volume 272, Number 21, Issue of May 23, 1997 pp. 13772-13778
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Purification and Cloning of Carp Nephrosin, a Secreted Zinc Endopeptidase of the Astacin Family*

(Received for publication, October 25, 1996, and in revised form, January 24, 1997)

Ching-Hsiang Hung Dagger §, Hon-Ren Huang §, Chang-Jen Huang par , Fore-Lien Huang par and Geen-Dong Chang Dagger **

From the Dagger  Graduate Institute of Biochemical Sciences and  Department of Zoology, National Taiwan University, Taipei 10098 and the par  Institute of Biological Chemistry, Academia Sinica, Taipei 115, Taiwan

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENT
REFERENCES


ABSTRACT

We have purified a secreted proteinase of 23 kDa from carp head kidney by sequential column chromatography on a Reactive Blue 72-agarose dye affinity column and an FPLC Mono-P column. The secretion of this proteinase from carp head kidney can be stimulated by high concentrations of potassium. Since the carp proteinase is present mainly in the head kidney, kidney, and spleen (all of which are lymphohematopoietic organs), it is named nephrosin. The carp nephrosin is most sensitive to metal chelators, but not to inhibitors specific for other classes of proteinases. A cDNA clone has been isolated from a carp head kidney cDNA library by immunoscreening with a polyclonal antiserum raised against purified nephrosin. The cloned cDNA is 1086 base pairs in length and has an open reading frame encoding a protein of 273 amino acids, including a 19-amino acid signal peptide and 56-amino acid propeptide. The deduced amino acid sequence shows moderate levels of identity to medaka HCE1 (52.5%), medaka LCE (50.7%), crayfish astacin (33.2%), murine meprin-alpha (34%), and murine meprin-beta (33.5%), all members of the astacin family of zinc endopeptidases. Nephrosin is the first member of the astacin family found in lymphohematopoietic tissues.


INTRODUCTION

Teleost head kidney consists of interrenal tissue (1-3) homologous to the adrenal cortex, chromaffin cells (4, 5) responsible for epinephrine and norepinephrine secretion, immune cells (6-9) responsible for immunoglobulin M secretion, and hematopoietic cells (6, 10, 11). Bone marrow is not present in fish, whereas hematopoietic tissues and lymphatic tissues co-exist in the lymphohematopoietic organs. In addition to the head kidney, spleen and kidney are also lymphohematopoietic organs in teleost fish (6).

The presence of four different types of cells (neurons, endocrine cells, immune cells, and hematopoietic cells) in the head kidney prompted us to study the secreted proteins from head kidney since these cells are all active in secretion. Interacting molecules may be secreted by one cell type in a paracrine mode to exert its effects on neighboring cells or on the extracellular matrix (ECM).1 Therefore, we attempted to purify the secreted proteins from carp head kidney and eventually to understand the functions of the secreted molecules. Here, we report the purification and cloning of one secreted protein, nephrosin. Nephrosin is a zinc metalloproteinase and is present mainly in the gill, kidney, head kidney, and spleen. We have also demonstrated that secretion of nephrosin can be stimulated by high concentrations of extracellular potassium. Amino acid sequence analysis reveals that nephrosin is most closely related to medaka hatching enzymes, members of the astacin family (12). However, our evidence suggests that nephrosin is probably not a hatching enzyme.


EXPERIMENTAL PROCEDURES

Perfusion of Carp Head Kidney

Common carp (Cyprinus carpio) purchased from a local fish market were held in plastic tanks (40 × 45 × 80 cm) under natural temperature and photoperiod for 1 day before experiments. Fish were decapitated between 10 and 11 a.m. The head kidney was carefully removed and placed in the normal perfusion buffer consisting of 125 mM NaCl, 5 mM KCl, 1.5 mM CaCl2, 0.9 mM MgSO4, 10 mM glucose, and 10 mM NaPO4, pH 7.4. The setup of perfusion system was essentially the same as described (13). Following a 90-min stabilization period, perfusate samples were collected for eight 10-min intervals. For the control group, tissue was perfused with the normal perfusion medium throughout the perfusion period, whereas for the experimental group, a high potassium perfusion medium (50 mM potassium, 80 mM NaCl, 1.5 mM CaCl2, 0.9 mM MgSO4, 10 mM glucose, and 10 mM NaPO4, pH 7.4) was administered for 20 min starting from collection interval two. Perfusate samples were then frozen at -20 °C until use for immunoblot, zymographic (see below), and lactate dehydrogenase assay (14).

Purification of Nephrosin

Carp head kidneys (20 g) were homogenized in 200 ml of 20 mM Tris-HCl containing 5 mM EDTA, pH 8.0, by a glass homogenizer. The supernatant was collected by centrifugation at 12,000 × g for 30 min, and 0.3 M NaCl was added to the supernatant. The sample was then applied onto a Reactive Blue 72-agarose column (2.5 × 10 cm; Sigma) equilibrated with 0.3 M NaCl in the homogenization buffer and eluted stepwise by 0.3 M, 0.6 M, and 1.0 M NaCl in the homogenization buffer. All three elution steps would desorb nephrosin from the column but the 0.6 M NaCl fractions contained nephrosin activity of the highest purity. The 0.6 M NaCl fractions were pooled, lyophilized, and dissolved in 25 mM imidazole/HCl buffer, pH 7.1, and applied to an FPLC Mono P HR5/5 column (Pharmacia Biotech Inc.). Purification was achieved by a 10-min elution with 25 mM imidazole, pH 7.1, and a 40-min elution with 10% Polybuffer, pH 4.0 (Pharmacia Biotech Inc.) at a constant flow rate of 0.8 ml/min. The active fractions were pooled, dialyzed against 100 mM ammonium bicarbonate, and lyophilized. Proteolytic activities of nephrosin during each purification step were monitored with the proteolytic zymographic assay (see below). Protein concentrations were determined by a Coomassie Blue binding assay with bovine serum albumin (BSA) as the standard (15).

Gel Electrophoresis

Gel electrophoresis was performed using a Tricine SDS-PAGE system as described previously (16). The gel concentration was 7.5%, and the bisacrylamide to acrylamide ratio was 6%. For proteolytic zymographic assay, Tricine SDS-polyacrylamide gel was prepared as described (17, 18), except that the gel contained 0.1% reduced and carboxymethylated BSA (RCM-BSA). After electrophoresis, the gel was incubated for 1 h at 27 °C with 2% Triton X-100 in 20 mM Tris-HCl, pH 8.0 once and Tris buffer containing 0.1 mM ZnCl2 twice, each for 90 min. The gel was then stained with 0.2% Coomassie Blue R250 in 40% methanol, 7% acetic acid and destained with 30% methanol, 7% acetic acid.

Effects of Proteinase Inhibitors

The effects of various inhibitors against nephrosin were examined using RCM-BSA as a substrate. The enzyme samples (0.1 µg in 10 µl) were preincubated with a particular inhibitor or buffer alone (mock) on ice for 10 min, and the reaction was initiated by the addition of 20 µl of substrate solution (30 µg of RCM-BSA in 20 mM Tris-HCl containing 15 µM ZnCl2, pH 8.0). The reaction was maintained at 27 °C for 1 h and stopped by the addition of 30 µl of 2 × concentrated SDS sample buffer without 2-mercaptoethanol. The reaction mixture was then boiled for 3 min. Four µl of the sample were analyzed by SDS-PAGE, and the amounts of residual RCM-BSA was calculated using an Imaging Densitometer (Bio-Rad GS-670). For each treatment, the amounts of RCM-BSA digested (total RCM-BSA minus residual RCM-BSA) were calculated and compared with those of mock treatment.

Hydrolysis of Small Peptides

The peptides (10 µg in 40 µl) were dissolved in 20 mM ammonium bicarbonate containing 15 µM ZnCl2. The reaction was started by adding 10 µl of enzyme solution (0.1 mg/ml) in 20 mM ammonium bicarbonate, and the mixture was incubated at 27 °C for 1 h. The reaction mixture was then lyophilized, dissolved in 0.1% trifluoroacetic acid, and separated on a reverse-phase C18 column eluted with a linear gradient of acetonitrile in 0.1% trifluoroacetic acid. Each peak was collected, lyophilized, and subjected to amino acid sequencing (model 477A; Applied Biosystems, Forest City, CA).

Chromogenic Assay with Peptide-p-nitroanilide Substrates

The proteolytic activities of nephrosin was determined by using the synthetic peptides, N-tosyl-Gly-Pro-Arg-p-nitroanilide, N-succinyl-Ala-Ala-Pro-Phe-p-nitroanilide, N-carbobenzoxy-Gly-Gly-Leu-p-nitroanilide, and N-succinyl-Ala-Ala-Pro-Leu-p-nitroanilide, respectively (19), as substrates.

Immunization and Immunoblot Analysis

The Mono-P fraction was dissolved in phosphate-buffered saline (PBS) and thoroughly mixed with an equal volume of Freund's complete adjuvant for the first injection or Freund's incomplete adjuvant for the second and third injections. Approximately 100 µg of nephrosin was injected subcutaneously into the back of a guinea pig during each immunization, biweekly. Ten days after the third injection, the blood was collected by heart puncture and serum stored at 4 °C. Western blotting was carried out using guinea pig anti-nephrosin antiserum (1:2000 dilution) and horseradish peroxidase-conjugated second antibody (1:1000 dilution) after electrotransfer to nitrocellulose paper (0.22 µm, Sartorius). Immunoreactive bands were detected by the NiCl2 enhancement method (20).

Artificial Insemination

Female carp were injected twice at the base of pectoral fin with PBS homogenate of one pituitary, each 6 h apart. Ovulation occurred 12 h after the first injection (21). Ovulated eggs were collected and mixed with spontaneously spermiated milt for 5 min and then dispersed with tap water. Fertilized eggs were then allowed to develop at 25 °C with constant compressed air bubbling, and water was replaced twice a day. Embryos were harvested between 70 and 72 h after fertilization and frozen in liquid nitrogen. Hatching liquid was collected at 82 h when more than 80% of the embryos completed hatching, and then frozen at -70 °C.

General Methods in Molecular Biology

Standard procedures in molecular biology were used for preparation of plasmid DNA, restriction enzyme digestion, DNA agarose gel electrophoresis, DNA ligation, and the transformation of bacteria (22).

Immunoscreening of a Carp Head Kidney cDNA Library

A carp head kidney cDNA library prepared from poly(A)-enriched RNA by unidirectional insertion of cDNA into lambda -ZAP II (23) was purchased from Stratagene (La Jolla, CA). The lambda -ZAP phages were plated at a density of 5 × 104 plaques/agar plate (150 mm, inner diameter). A total of 60 plates was screened. After incubation for 3 h at 42 °C, the plates were overlaid with nitrocellulose filters (pore size, 0.45 µm; Micron Separations, Westboro, MA) that had been impregnated with 10 mM isopropyl-1-thio-beta -D-galactopyranoside. Incubation was continued overnight at 37 °C. The filters were then removed, washed with PBS at room temperature, and blocked with 3% skim milk in PBS for 1 h at room temperature. Following blocking, filters were probed with a polyclonal antiserum specific for carp nephrosin at a 1:500 dilution in PBS containing 3 mg/ml bovine serum albumin, 1 mM EDTA, and 0.4% Triton X-100 at 4 °C for 16 h. The filters were then washed three times at room temperature in PBS and incubated with horseradish peroxidase-conjugated anti-guinea pig IgG (Sigma) for 1 h at room temperature. After three washes with PBS, the immune complexes were incubated in PBS containing 0.2 mg/ml diaminobenzamidine and revealed by adding H2O2 (10 µl in 10 ml of PBS). Phages displaying stronger signals were isolated for secondary screening. One positive clone was isolated after screening 3 × 106 plaques, and pBluescript plasmids containing cDNA inserts were obtained by in vivo excision according to the protocols provided by Stratagene.

DNA Sequencing and Sequence Analysis

Plasmids carrying cDNA inserts were sequenced in both directions using the T7 Sequenase version 2.0 (U.S. Biochemical Corp.) and the dideoxy chain termination method (24). A search for related sequences in GenBankTM, EMBL, SWISS-PROT, and Protein Identification Resource was carried out with an IFIND program using the FASTA algorithm of Pearson and Lipman (25). Alignment of the deduced amino acid sequences with known members of the astacin family was accomplished with the Clustal W multiple alignment program (26).

Northern Blot Analysis

Total RNA was isolated from carp blood cells, brain, gill, heart, head kidney, intestine, kidney, liver, ovary, spleen, and late embryos with the RNAzol B kit (Biotecx, Houston, TX). Twenty µg of total RNA from each tissue was fractionated on 1% formaldehyde-agarose gel in MOPS buffer and transferred onto a Hybond-N membrane (Amersham Corp.). Following prehybridization for 1 h in 50% formamide, 5 × SSC, 2% blocking reagent (Boehringer Mannheim), 0.1% N-laurylsarcosine, 0.02% SDS at 50 °C for 1 h, blots were hybridized with a polymerase chain reaction-generated digoxigenin (DIG)-labeled cDNA probe for 20 h under identical conditions. Blots were washed twice for 5 min with 2 × SSC containing 0.1% SDS at room temperature and twice for 15 min at 68 °C with 0.1 × SSC containing 0.1% SDS. Detection of DIG signals was accomplished using the DIG luminescent detection kit (Boehringer Mannheim). The cDNA probe used for Northern blotting was synthesized by the polymerase chain reaction DIG probe synthesis kit (Boehringer Mannheim) with two primers derived from nephrosin sequence; F1, CGGAGCCGTCCTGTTGAGGA (nucleotides 75-94) and R1, CCCCGTAAAGGAGTTTAGGCC (nucleotides 378-397).


RESULTS

Purification of Nephrosin

During the perfusion of carp head kidney, the spontaneous release of proteins or leakage of proteins due to handling damage of the tissue tended to decrease with time (data not shown). However, in response to a 50 mM potassium stimulation, higher amounts of protein were released by the carp head kidney (Fig. 1). The amounts of protein of 15, 23 (p23), 28, 64, and 70 kDa in the perfusate samples following the potassium treatment were elevated for 20-30 min and then returned to a lower level. Using a zymographic assay, we found that a proteinase activity was associated with the electrophoretic mobility of p23. Therefore, we attempted to purify this secreted proteinase from carp head kidney. By sequential chromatography on a Reactive Blue 72-agarose (Fig. 2A) and a FPLC-Mono P column (Fig. 2B), we purified the 23-kDa proteinase to near homogeneity (Fig. 2C and Table I). N-terminal protein sequencing of this protein revealed a single sequence: NADPXTARRXKWRKSRNGLV-. The low recovery of nephrosin by the purification procedures was because we collected the fraction with the highest purity (0.6 M NaCl) only. However, by this purification scheme, the whole procedure can be accomplished within 10 days.


Fig. 1. Secretion of proteins from carp head kidney perfused in vitro. After tissue was equilibrated with fish saline for 90 min, samples of perfusate were collected for eight 10-min intervals. Perfusion medium was changed from normal fish saline to that containing 50 mM potassium for 20 min at the beginning of interval 2. The perfusate samples were analyzed by SDS-PAGE and silver staining.
[View Larger Version of this Image (71K GIF file)]


Fig. 2. A and B, elution profiles of nephrosin from Reactive Blue 72-agarose (A) and Mono-P columns (B). Head kidney extract (200 ml) was chromatographed on a Reactive Blue 72-agarose column. Fractions of 6 ml were collected at a flow rate of 25 ml/h. Proteins obtained from the first column (80 µg) were chromatographed on a Mono-P column equilibrated with 20 mM imidazole, pH 7.1, and eluted with 10% Polybuffer, pH 4.0. Fractions containing nephrosin were collected as indicated by bar on the figure. Crude extract (lane 1) and samples from the Reactive Blue 72-agarose column (lane 2) and from Mono-P column (lane 3) were analyzed by SDS-PAGE and silver staining (C).
[View Larger Version of this Image (19K GIF file)]

Table I. Summary of purification of nephrosin from carp head kidney


Step Volume Protein Activitya Specific activity Yield Purification

ml mg units units/mg % -fold
Extractb 200 2207 119.2 0.054 100 1
Dye column 48 0.376 6.28 16.70 5.27 172
Mono-P 4 0.098 1.78 18.16 1.49 187

a One unit of activity is defined as the amount of nephrosin causing the same proteolytic activity as 1 unit of chymotrypsin in the RCM-BSA zymographic assay.
b A total of 20 g of carp head kidney was used in this preparation.

Substrate Specificity of Nephrosin

The proteolytic activity of nephrosin could be demonstrated using SDS-PAGE zymography with gelatin, RCM-BSA, or RCM-fibrin as a substrate(data not shown). To determine the preference of cleavage sites by nephrosin, we examined various peptide-nitroanilides and peptides. None of the peptide-nitroanilides, including tosyl-GPK-NA, succinyl-AAPF-NA, succinyl-AAPL-NA and N-carbobenzoxy-GGL-NA, were digested by nephrosin (Table II). Obviously, nephrosin did not hydrolyze the amide bond of these nitroanilides. However, nephrosin cleaved certain peptide bonds of synthetic substance P and Lys-bradykinin. When bradykinin derivatives of different length were tested for their digestion by nephrosin, it was found that there is a length requirement for being a substrate. Nephrosin did not cleave the terminal peptide bonds of bradykinin 1-5 and bradykinin 1-6. Among the digestible substrates, nephrosin cleaved at the Gln-Phe and Phe-Phe bonds of substance P and at the Gly-Phe and Phe-Ser bonds of bradykinin derivatives with a preference for phenylalanine at the P1 position and proline at the P2/P3/P4 position. Therefore, nephrosin mainly functions as an endopeptidase with little exopeptidase or amidase activity.

Table II. Digestion of synthetic peptide substrates by nephrosin


Substrates Sequencesa Hydrolysis

Tosyl-GPK-NA GPK NDb
Suc-AAPF-NA AAPF ND b
Suc-AAPL-NA AAPL ND b
Cbz-GGL-NA GGL ND b
Substance P RPKPQQdown-arrow FDown-arrow FGLM-NH2 Complete
Lys-Bradykinin KRPPGdown-arrow FDown-arrow SPFR Complete
Bradykinin 1-5   RPPGF ND b
Bradykinin 1-6   RPPGFS ND b
Bradykinin 1-7   RPdown-arrow PGFSP Partial
Des-Arg-bradykinin   PPdown-arrow GFSPFR Complete

a down-arrow indicates bonds cleaved by carp nephrosin, and Down-arrow  indicates major cleavage site.
b ND, nondetectable in 60 min.

Effects of Proteinase Inhibitors

Various inhibitors were tested for their effects on nephrosin with RCM-BSA as a substrate (Table III). The chelating agents including 1,10-phenanthroline, EDTA, captopril, and diethyldithiocarbamic acid inhibited the proteolytic activity of nephrosin to a great extent, especially 1,10-phenanthroline and diethyldithiocarbamic acid. Inhibitors of other classes of proteinases were ineffective. The results indicate that nephrosin is a metalloproteinase.

Table III. Effect of proteinase inhibitors on the enzymatic activities of nephrosin

The purified enzyme was preincubated with each reagent at the indicated concentration for 10 min at 0 °C and then with RCM-BSA for 1 h at 27 °C. Residual enzyme activities were calculated as the ratio of the amount of RCM-BSA digested in the presence of inhibitor to that in the absence of inhibitor. The purified enzyme was preincubated with each reagent at the indicated concentration for 10 min at 0 °C and then with RCM-BSA for 1 h at 27 °C. Residual enzyme activities were calculated as the ratio of the amount of RCM-BSA digested in the presence of inhibitor to that in the absence of inhibitor.

Inhibitor Concentration Residual activity

mM %
None 100
1,10-Phenanthroline 5 8.2
1.25 19
EDTA 5 26
2.5 35
Captopril 5 15
2.5 61
Diethyldithiocarbamate 5 6.2
2.5 23
Pepstatin 20 µg/ml 90
PMSF 5 100
Iodoacetate 10 70
5.5 67

cDNA Cloning of Nephrosin

After screening 3 × 106 plaques with a polyclonal antiserum raised against purified nephrosin, one positive clone was isolated. The nucleotide sequence and the deduced amino acid sequence are shown in Fig. 3. The clone has an insert of 1086 bp including 32 bp of the 5'-untranslated region, an open reading frame of 821 bp, and 232 bp of the 3'-untranslated region. The putative initiating ATG codon, which agrees with Kozak's rule (27), is at nucleotide 33. The open reading frame is predicted to encode a protein of 273 amino acids, including a 19-amino acid signal peptide and a 56-amino acid propeptide. The N-terminal 20 amino acid residues determined from purified nephrosin matched with the deduced amino acid sequence. The deduced amino acid sequence also confirms the presence of a propeptide sequence (see also sequence comparison data). The theoretical molecular mass of the mature protein is 23089.35 Da, which is close to the estimated molecular mass from SDS-PAGE analysis.


Fig. 3. Nucleotide sequence and predicted amino acid sequence of nephrosin. The open reading frame encodes a protein of 273 amino acids, including a 19-amino acid signal peptide and a 56-amino acid propeptide. Amino acid residues in boldface match with those determined from purified protein. Potential N-glycosylation sites are indicated by squares.
[View Larger Version of this Image (58K GIF file)]

Sequence Homology

The deduced amino acid of nephrosin shows moderate sequence identity (29-52.5%) with members of the astacin family (Fig. 4) such as medaka HCE1 (52.5%), LCE (50.7%; Ref. 28), crayfish astacin (33.2%; Ref. 29), murine meprin-alpha (34%; Ref. 30), and murine meprin-beta (33.5%; Ref. 31). The N-terminal regions, including the signal peptide and propeptide sequences, are most variable. All members are likely to be secreted and further processed as evidenced by the presence of the signal and propeptide sequences. The junction for the propeptide and mature protein in nephrosin is at a similar position to that in other members. Stretches of highly conserved sequences were found, especially in the unique zinc binding motif, HEXXHALGFXHEXXRXDRD. From x-ray structural analyses of crayfish astacin (32), zinc ion is ligated by three histidine residues, one tyrosine residue, and one water molecule H-bonded to a glutamic acid residue. Five residues involved in the penta-coordination of zinc are conserved in all members. Most members of the family have extra domains C-terminal to the proteinase domain except crayfish astacin, medaka hatching enzymes, and carp nephrosin, which consist of only ~200 amino acid residues in the mature forms.


Fig. 4. Sequence comparison of members of the astacin family. Sequences of the proteinase domain of the astacin family members were aligned by Clustal W, version 1.6 (26). Alignments highlight residues that are in the majority for all sequences. Nep, nephrosin; LCE, medaka low choriolytic enzyme; HCE-1, medaka high choriolytic enzyme-1; QuCAM-1, quail chorioallantoic metalloproteinase-1; MuMep-alpha , mouse meprin-alpha ; MuMep-beta , mouse meprin-beta ; DrTlr-1, Drosophila Tolloid-related-1; DrTld, Drosophila Tolloid; HuBMP-1, human bone morphogenetic protein-1; SpAN, sea urchin SpAN; BP10, sea urchin blastula protease-10; HMP1, hydra metalloproteinase 1; astacin, crayfish astacin. The degree of overall identity to carp nephrosin is shown at the end.
[View Larger Version of this Image (57K GIF file)]

Tissue Distribution

The presence of nephrosin in different tissues was examined by immunoblotting (Fig. 5) with a polyclonal antiserum against purified nephrosin and by Northern blotting (Fig. 6) with nephrosin partial cDNA as a probe. Only samples of gill, kidney, head kidney, and spleen contained an immunoreactive protein of a similar molecular mass. Because of the limited distribution of nephrosin in the kidney, head kidney, and spleen, it was named nephrosin herein until we discover the true physiological functions of this metalloproteinase. The DIG-labeled cDNA probe for nephrosin hybridized with a single 1.2-kilobase band in all samples except intestine and ovary, and with highest levels in head kidney and kidney. This size of mRNA is in good agreement with that of nephrosin clone (1086 bp). The lack of a protein signal in heart extract is unusual, since its mRNA level was similar to that of spleen.


Fig. 5. Tissue distribution of nephrosin as revealed by immunoblotting. Proteins from various tissue extracts (10 µg) were electrophoresed on a SDS-polyacrylamide gel and subjected to immunoblotting with an antiserum against purified nephrosin.
[View Larger Version of this Image (37K GIF file)]


Fig. 6. Tissue distribution of nephrosin as revealed by Northern blotting. Total RNA (20 µg) from different tissues were fractionated on a 1% formaldehyde-agarose gel and blotted onto a Hybond-N membrane. The blot was hybridized with a DIG-labeled nephrosin cDNA probe and visualized with luminescent detection.
[View Larger Version of this Image (31K GIF file)]

Absence of Nephrosin in Carp Embryos

Due to the highest sequence identity to medaka hatching enzymes (HCE2, HCE1, and LCE), we wish to determine whether nephrosin is a carp hatching enzyme. Soluble proteins and total RNA were prepared from 70-h embryos (a 80-h hatching procedure) and subjected to immunoblot and Northern blot analysis (Fig. 7). In addition, hatching liquid was also harvested after most embryos completed hatching. Using a comparable amount of protein and RNA, both protein and mRNA signals were observed in head kidney, but not in carp embryos or hatching liquid. Therefore, the data suggest that nephrosin is unlikely to be a hatching enzyme analogue, and that carp embryos at this stage expressed very little nephrosin, if any.


Fig. 7. Absence of nephrosin in the carp embryos. Protein (10 µg) from head kidney, 70-h embryos, and hatching liquid were electrophoresed on a 7.5% gel and detected by immunoblotting (left panel). Total RNA (20 µg) from head kidney and 70-h embryos were subjected to formaldehyde-agarose electrophoresis in the presence of ethidium bromide (middle panel), transferred to a Hybond-N membrane, and probed with a DIG-labeled nephrosin cDNA probe (right panel).
[View Larger Version of this Image (27K GIF file)]

Secretion of Nephrosin

Release of immunoassayable nephrosin from carp head kidney fragments was measured using an in vitro perfusion system. Fig. 8 shows the effect of potassium-induced secretion of nephrosin. Nephrosin and a degraded product of nephrosin were detected by immunoblotting following a 50 mM potassium treatment (Fig. 8, upper panel). The release of nephrosin was almost instantly following induction. The identity of nephrosin in the perfusate samples was confirmed by SDS-PAGE zymography (Fig. 8, lower panel). The release of nephrosin was not due to damage of the perfused tissue since lactate dehydrogenase activities in the perfusate samples were not changed during the perfusion experiment (data not shown). The results suggest that nephrosin is secreted by excitable cells in the head kidney in response to membrane depolarization caused by the potassium treatment.


Fig. 8. Secretion of nephrosin from carp head kidney perfused in vitro. After tissue was equilibrated with fish saline for 90 min, the perfusate samples were collected for nine 10-min intervals. Perfusion medium was changed from normal fish saline to that containing 50 mM potassium for 20 min at the beginning of interval 2. The perfusate samples were analyzed by immunoblotting (upper panel) and by proteolytic zymograph (lower panel).
[View Larger Version of this Image (31K GIF file)]


DISCUSSION

Nephrosin is a new member of the astacin family of metalloproteinases based on the following observations: First, the activity of nephrosin is inhibited by metal chelators but not by inhibitors of other classes of proteinases, suggesting that it is a metalloproteinase. Second, cDNA encoding the purified protein was isolated from a carp head kidney cDNA library. One segment of the deduced amino acid sequence matches perfectly with the first 20 amino acids determined from the purified nephrosin. Bacterially expressed protein encoded by the cloned cDNA can be recognized by the same antiserum used for immunoscreening. In addition, the polyclonal antiserum raised against this recombinant protein recognized native nephrosin.2 Finally, the deduced primary structure of nephrosin resembles members of the astacin family. The most distinguished zinc-binding motif, HEXXHXXGFXHEXXRXDR, is also present in nephrosin. Astacin family members are all secreted proteinases containing a proteinase domain of approximately 200 amino acid residues (23 kDa). Most of the known members contain one or more copies of interaction domains such as EGF (epidermal growth factor)-like or CUB (complement/sea urchin EGF/BMP-1) that are C-terminal to the proteinase domain (12). However, the mature form of nephrosin does not contain any extra sequences C-terminal to the proteinase domain as with astacin and hatching enzymes (HCE1, HCE2, and LCE).

From sequence comparisons, nephrosin is most closely related to medaka hatching enzymes with >50% identity in amino acid sequence. Hatching enzymes are expressed in late stages of embryos in anticipation of hatching and can therefore be harvested from late embryos and hatching liquid (28, 33). However, we were not able to detect nephrosin in late embryos (mRNA and protein) or hatching liquid (protein). Therefore, the high degree of identity between nephrosin and medaka hatching enzymes most likely results from the fact that they are the only sequences from teleost in the astacin family, but not that nephrosin represents a carp hatching enzyme.

Most members of the astacin family are involved in developmental processes. They are hatching enzymes of medaka involved in degrading the egg shell of embryos (28, 33, 34), hydra HMP1 in head regeneration and tentacle differentiation (35), human BMP-1 in bone formation (36, 37), Drosophila Tolloid in dorsal-ventral pattern formation (38), and sea urchin BP10 and SpAN in differentiation of ectodermal lineages (39, 40). Few members of the astacin family are expressed in mature organisms in a tissue-specific manner. For examples, crayfish astacin is synthesized in the crayfish hepatopancreas and functions as a digestive enzyme (41). Mammalian meprins are expressed as dimeric proteins (42, 43) in the brush border membranes of kidney and intestine (44, 45). Along with these limited precedents, nephrosin is expressed in the gill, head kidney, kidney, and spleen of mature carp. Although nephrosin and meprins are all present in the kidney, they are not identical as suggested by differences in the primary structure and in the forms of mature protein (dimeric membrane protein versus monomeric soluble protein). In addition, meprin exhibits an arylamidase activity toward peptide-p-nitroanilide substrates (43) that are shown to be very poor substrates for nephrosin.

Our data show that nephrosin is secreted from carp head kidney and its secretion can be regulated by manipulation of the membrane potentials. The fact that nephrosin is present in the kidney, head kidney, and spleen suggests a role of nephrosin in the lymphohematopoietic system. Whether nephrosin is expressed by the immune system and/or by the hematopoietic system requires critical examinations. We are currently preparing antisera against proteins derived from both systems as cell type markers. Along with the antiserum against nephrosin, we may be in a better position to solve this problem by immunohistochemical staining procedures.

We speculate that expression of nephrosin at high levels in the lymphohematopoietic tissues suggests that the proteinase may function in ECM remodeling. One most striking feature pertaining to the tissues is the frequent migration of cells out of and into these sites (46). ECM proteins provide multiple interaction domains mediating adhesion of cells and ECM (47). Although studies on proteolytic remodeling of ECM have been focused largely on matrix metalloproteinases (48), meprin (49), and HMP1 (35) of the astacin family are also effective in degrading ECM proteins. In a preliminary experiment,3 we also found that nephrosin was able to degrade mammalian fibronectin, but not laminin or type IV collagen. In addition, nephrosin can degrade mammalian gelatin in a SDS-PAGE zymographic assay. We are now repeating these experiments using carp ECM as substrates.


FOOTNOTES

*   This work was supported by Grants NSC-83-0203-B-001-119 and NSC-84-2311-B-001-073 from the National Science Council of Taiwan.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) U62621[GenBank].


§   Both authors contributed equally to this paper.
**   To whom correspondence should be addressed: Graduate Institute of Biochemical Sciences, National Taiwan University, P. O. Box 23-106, Taipei 10098, Taiwan, ROC. Tel.: 886-2-362-0261 (ext 4121); Fax: 886-2-363-5038; E-mail: gdchang{at}ccms.ntu.edu.tw.
1   The abbreviations used are: ECM, extracellular matrix; PAGE, polyacrylamide gel electrophoresis; RCM, reduced and carboxymethylated; BSA, bovine serum albumin; PBS, phosphate-buffered saline; DIG, digoxigenin; MOPS, 4-morpholinepropanesulfonic acid; bp, base pair(s); NA, nitroanilide; Tricine, N-tris(hydroxymethyl)methylglycine.
2   H.-R. Huang and G.-D. Chang, unpublished results.
3   G.-D. Chang, unpublished results.

ACKNOWLEDGEMENT

We are indebted to Dr. Chung-Ho Chang for critical comments on this manuscript.


REFERENCES

  1. Huang, F.-L., Ke, F.-C., Huang, J.-J., and Lo, T.-B. (1983) Arch. Biochem. Biophys. 225, 512-517 [CrossRef][Medline] [Order article via Infotrieve]
  2. Balm, P. H., Lambert, J. D., and Wendelaar Bonga, S. E. (1989) Gen. Comp. Endocrinol. 76, 53-62 [CrossRef][Medline] [Order article via Infotrieve]
  3. Sangalang, G. B., and Uthe, J. F. (1994) Gen. Comp. Endocrinol. 95, 273-285 [CrossRef][Medline] [Order article via Infotrieve]
  4. Gallo, V. P., Civinini, A., Mastrolia, L., Leitner, G., and Porta, S. (1993) Gen. Comp. Endocrinol. 92, 133-142 [CrossRef][Medline] [Order article via Infotrieve]
  5. Imagawa, T., Kitagawa, H., and Uehara, M. (1996) Anatomy 188, 149-156
  6. Zapata, A. (1979) Dev. Comp. Immunol. 3, 55-65 [CrossRef][Medline] [Order article via Infotrieve]
  7. Bengten, E., Leanderson, T., and Pilstrom, L. (1991) Eur. J. Immunol. 21, 3027-3033 [Medline] [Order article via Infotrieve]
  8. Imagawa, T., Hashimoto, Y., Kon, Y., and Sugimura, M. (1991) Fish Shellfish Immunol. 1, 173-185
  9. Koumans-van Diepen, J. C., Egberts, E., Peixoto, B. R., Taverne, N., and Bombout, J. H. (1995) Dev. Comp. Immunol. 19, 97-108 [CrossRef][Medline] [Order article via Infotrieve]
  10. Imagawa, T., Hashimoto, Y., Kon, Y., and Sugimura, M. (1990) J. Fish Biol. 37, 357-366 [CrossRef]
  11. Verburg-van Kemenade, B. M. L., Groeneveld, A., van Rens, B. T. T. M., and Rombout, J. H. W. M. (1994) J. Exp. Biol. 187, 143-158 [Abstract]
  12. Bond, J. S., and Beynon, R. J. (1995) Protein Sci. 4, 1247-1261 [Medline] [Order article via Infotrieve]
  13. Levine, J. E., and Ramirez, V. D. (1986) Methods Enzymol. 124, 466-494 [Medline] [Order article via Infotrieve]
  14. Koh, J. Y., and Choi, D. W. (1987) J. Neurosci. Methods 20, 83-90 [CrossRef][Medline] [Order article via Infotrieve]
  15. Bradford, M. M. (1976) Anal. Biochem. 72, 248-254 [CrossRef][Medline] [Order article via Infotrieve]
  16. Schägger, H., and von Jagow, G. V. (1987) Anal. Biochem. 166, 368-379 [CrossRef][Medline] [Order article via Infotrieve]
  17. Heussen, C., and Dowdle, E. B. (1980) Anal. Biochem. 102, 196-202 [CrossRef][Medline] [Order article via Infotrieve]
  18. Haspal, J., Bushell, G., and Ghosh, P. (1983) Anal. Biochem. 132, 288-293 [CrossRef][Medline] [Order article via Infotrieve]
  19. Huang, C.-J., Chen, C.-C., Chen, H.-J., Huang, F.-L., and Chang, G.-D. (1995) J. Neurochem. 64, 1715-1720 [Medline] [Order article via Infotrieve]
  20. Harlow, E., and Lane, D. (eds) (1988) Antibodies, pp. 471-510, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  21. Tsai, Y.-J., Chang, G.-D., Huang, C.-J., Chang, Y.-S., and Huang, F.-L. (1996) Comp. Biochem. Physiol. 113B, 573-580 [CrossRef]
  22. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  23. Short, J. M., Fernandez, J. H., Sorge, J. A., and Huse, W. D. (1988) Nucleic Acids Res. 16, 7583-7600 [Abstract/Free Full Text]
  24. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 5463-5467 [Abstract/Free Full Text]
  25. Pearson, W. R., and Lipman, D. J. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 2444-2448 [Abstract/Free Full Text]
  26. Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994) Nucleic Acids Res. 22, 4673-4680 [Abstract/Free Full Text]
  27. Kozak, M. (1987) Nucleic Acids Res. 15, 8125-8148 [Abstract/Free Full Text]
  28. Yasumasu, S., Yamada, K., Akasaka, K., Mitsunaga, K., Iuchi, I., Shimada, H., and Yamagami, K. (1992) Dev. Biol. 153, 250-258 [CrossRef][Medline] [Order article via Infotrieve]
  29. Titani, K., Torff, H. J., Hormel, S., Kumar, S., Walsh, K. A., Rodl, J., Neurath, H., and Zwilling, R. (1987) Biochemistry 26, 222-226 [CrossRef][Medline] [Order article via Infotrieve]
  30. Corbeil, D., Milhiet, P. E., Simon, V., Ingram, J., Kenny, A. J., Bioleau, G., and Crine, P. (1993) FEBS Lett. 335, 361-366 [CrossRef][Medline] [Order article via Infotrieve]
  31. Gorbea, C. M., Marchand, P., Jiang, W., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., and Bond, J. S. (1993) J. Biol. Chem. 268, 21035-21043 [Abstract/Free Full Text]
  32. Bode, W., Gomis-Rüth, R. F., Huber, R., Zwilling, R., and Stöcker, W. (1992) Nature 358, 164-167 [CrossRef][Medline] [Order article via Infotrieve]
  33. Yasumasu, S., Katow, S., Hamazaki, T., Iuchi, I., and Yamagami, K. (1992) Dev. Biol. 149, 349-356 [CrossRef][Medline] [Order article via Infotrieve]
  34. Lee, K. S., Yasumasu, S., Nomura, K., and Iuchi, I. (1994) FEBS Lett. 339, 281-284 [CrossRef][Medline] [Order article via Infotrieve]
  35. Yan, L., Pollcok, G. H., Nagase, H., and Sarras, M. P., Jr. (1995) Development 121, 1591-1602 [Abstract]
  36. Wozney, J. M., Rosen, V., Celeste, A. J., Mitsock, L. M., Whitters, M. J., Kriz, R. W., Hewick, R. M., and Wang, E. A. (1988) Science 242, 1528-1531 [Abstract/Free Full Text]
  37. Takahara, K., Lyons, G. E., and Greenspan, D. S. (1994) J. Biol. Chem. 269, 32572-32578 [Abstract/Free Full Text]
  38. Shimell, M. J., Ferguson, E. L., Childs, S. T., and O'Connor, M. B. (1991) Cell 67, 479-481
  39. Lepage, T., Ghiglione, C., and Gasche, C. (1992) Development 114, 147-164 [Abstract]
  40. Reynolds, S. D., Angerer, L. M., Palis, J., Nasir, A., and Angerer, R. C. (1992) Development 114, 769-786 [Abstract]
  41. Vogt, G., Stöcker, W., Storch, V., and Zwilling, R. (1989) Histochemistry 91, 373-381 [CrossRef][Medline] [Order article via Infotrieve]
  42. Butler, P. E., McKay, M. J., and Bond, J. S. (1987) Biochem. J. 241, 229-235 [Medline] [Order article via Infotrieve]
  43. Johnson, G. D., and Hersh, L. B. (1992) J. Biol. Chem. 267, 13505-13512 [Abstract/Free Full Text] ; Correction (1993) J. Biol. Chem. 268, 17647
  44. Barnes, K., Ingram, J., and Kenny, A. J. (1989) Biochem. J. 264, 335-346 [Medline] [Order article via Infotrieve]
  45. Yamaguchi, T., Kido, H., Kitazawa, R., Kitazawa, S., Fukase, M., and Katunuma, N. (1993) Biochemistry 113, 299-303
  46. Springer, T. A. (1994) Cell 76, 301-314 [CrossRef][Medline] [Order article via Infotrieve]
  47. Shimizu, Y., and Shaw, S. (1991) FASEB J. 5, 2292-2299 [Abstract]
  48. Birkedal-Hansen, H. (1995) Curr. Opin. Cell Biol. 7, 728-735 [CrossRef][Medline] [Order article via Infotrieve]
  49. Kaushal, G. P., Walker, P. D., and Shah, S. V. (1994) J. Cell Biol. 126, 1319-1327 [Abstract/Free Full Text]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Harlin-Cognato, E. A. Hoffman, and A. G. Jones
Gene cooption without duplication during the evolution of a male-pregnancy gene in pipefish
PNAS, December 19, 2006; 103(51): 19407 - 19412.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
T. Kijimoto, M. Watanabe, K. Fujimura, M. Nakazawa, Y. Murakami, S. Kuratani, Y. Kohara, T. Gojobori, and N. Okada
cimp1, A Novel Astacin Family Metalloproteinase Gene from East African Cichlids, Is Differentially Expressed Between Species During Growth
Mol. Biol. Evol., August 1, 2005; 22(8): 1649 - 1660.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H.-D. Song, X.-J. Sun, M. Deng, G.-W. Zhang, Y. Zhou, X.-Y. Wu, Y. Sheng, Y. Chen, Z. Ruan, C.-L. Jiang, et al.
Hematopoietic gene expression profile in zebrafish kidney marrow
PNAS, November 16, 2004; 101(46): 16240 - 16245.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P.-L. Tsai, C.-H. Chen, C.-J. Huang, C.-M. Chou, and G.-D. Chang
Purification and Cloning of an Endogenous Protein Inhibitor of Carp Nephrosin, an Astacin Metalloproteinase
J. Biol. Chem., March 19, 2004; 279(12): 11146 - 11155.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Shibata, T. Iwamatsu, Y. Oba, D. Kobayashi, M. Tanaka, Y. Nagahama, N. Suzuki, and M. Yoshikuni
Identification and cDNA Cloning of Alveolin, an Extracellular Metalloproteinase, Which Induces Chorion Hardening of Medaka (Oryzias latipes) Eggs upon Fertilization
J. Biol. Chem., March 17, 2000; 275(12): 8349 - 8354.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. L. Schissel, G. A. Keesler, E. H. Schuchman, K. J. Williams, and I. Tabas
The Cellular Trafficking and Zinc Dependence of Secretory and Lysosomal Sphingomyelinase, Two Products of the Acid Sphingomyelinase Gene
J. Biol. Chem., July 17, 1998; 273(29): 18250 - 18259.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow An addition or correction has been published
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hung, C.-H.
Right arrow Articles by Chang, G.-D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hung, C.-H.
Right arrow Articles by Chang, G.-D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement