JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hagen, F. K.
Right arrow Articles by Tabak, L. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hagen, F. K.
Right arrow Articles by Tabak, L. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


Volume 272, Number 21, Issue of May 23, 1997 pp. 13843-13848
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

cDNA Cloning and Expression of a Novel UDP-N-acetyl-D-galactosamine:Polypeptide N-Acetylgalactosaminyltransferase*

(Received for publication, November 4, 1996, and in revised form, February 10, 1997)

Fred K. Hagen , Kelly G. Ten Hagen , Thomas M. Beres , Marlene M. Balys , Brian C. VanWuyckhuyse and Lawrence A. Tabak Dagger

From the Departments of Dental Research and Biochemistry and Biophysics, the School of Medicine and Dentistry, University of Rochester, Rochester, New York 14642

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES


ABSTRACT

The cDNA for a fourth member of the mammalian UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase family, termed ppGaNTase-T4, has been cloned from a murine spleen cDNA library and expressed transiently in COS7 cells as a secreted functional enzyme. Degenerate primers, based upon regions that are conserved among the known mammalian members of the enzyme family (ppGaNTase-T1, -T2, and -T3) and three Caenorhabditis elegans homologues (ppGaNTase-TA, -TB, and -TC), were used in polymerase chain reactions to identify and clone this new isoform. Substrate preferences for recombinant murine ppGaNTase-T1 and ppGaNTase-T4 isozymes were readily distinguished. ppGaNTase-T1 glycosylated a broader range of synthetic peptide substrates; in contrast, the ppGaNTase-T4 preferentially glycosylated a single substrate among the panel of 11 peptides tested. Using Northern blot analysis, a ppGaNTase-T4 message of 5.5 kilobases was detectable in murine embryonic tissues, as well as the adult sublingual gland, stomach, colon, small intestine, lung, cervix, and uterus with lower levels detected in kidney, liver, heart, brain, spleen, and ovary. Thus, the pattern of expression for ppGaNTase-T4 is more restricted than for the three previously reported isoforms of the enzyme. The variation in expression patterns and substrate specificities of the ppGaNTase enzyme family suggests that differential expression of these isoenzymes may be responsible for the cell-specific repertoire of mucin-type oligosaccharides on cell-surface and secreted O-linked glycoproteins.


INTRODUCTION

The acquisition of carbohydrate side chains in O-glycosidic linkage to either Thr or Ser has a profound structural impact on a polypeptide backbone and thus underlies the unique physicochemical properties of heavily O-glycosylated proteins such as mucin glycoproteins (1). In addition, O-glycans function as ligands for receptors mediating such diverse actions as lymphocyte trafficking (2), sperm-egg binding (3), and tumor cell adhesion (4). The first committed step of O-glycosylation is initiated through the action of UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase (EC 2.4.1.41) (ppGaNTase).1 Thus far, three isoforms of this enzyme have been cloned and expressed, ppGaNTase-T1 (5, 6), -T2 (7), and -T3 (8, 9). The three isoforms differ with regard to their patterns of tissue expression and appear to have both overlapping as well as unique substrate preferences. Thus, to fully understand how O-glycosylation of specific peptide sequences is initiated and how the process is regulated in a given tissue or cell type, the repertoire of ppGaNTases in that cell background will have to be defined.

In the present study, we have used degenerate primers derived from conserved sequences within a region spanning 420-aa residues to amplify putative ppGaNTases from RNA samples. Subcloned PCR products were then secondarily screened by plaque hybridization and subjected to sequence analysis. The method was validated by the successful isolation of products corresponding to ppGaNTase-T1, -T2, and -T3 isoforms from murine RNA samples. In addition, the approach led to the detection of a cDNA that appeared to encode a novel form of ppGaNTase. When a truncated version of this cDNA was expressed as a secreted product in COS7 cells, ppGaNTase activity was recovered. However, the peptide substrate specificity of this enzyme appeared to be more selective than ppGaNTase-T1. Further, this isoform displayed a pattern of transcript expression that is more restricted than ppGaNTase-T1, -T2, or -T3 transcripts. Collectively, these data indicated that we have identified a fourth distinct isoform of the ppGaNTase family.


EXPERIMENTAL PROCEDURES

Isolation of a ppGaNTase-T4 Probe and Full-length cDNA

ppGaNTase family members from mouse and/or human ppGaNTase-T1, -T2, -T3 and Caenorhabditis elegans clones that encode putative ppGaNTase-TA, -TB, and -TC (ZK688.8, yk2F11, and yk3G10, respectively)2 were aligned, and all were found to contain the translated amino acid sequence AGGLF (Fig. 1) and CH(G/N)XGGNQ (Fig. 1), an average of 180-aa apart. A pool of sense and antisense strand degenerate PCR primers were reverse-translated from the consensus aa sequence AGGLF and CH(G/N)XGGNQ, respectively. Sense primers (primer 1, Fig. 1A) were d(CNCCNAYNNWKGCNGGWGICTITT) and d(WGCNGGWGGNCTCTT) and antisense primers (primer 2, Fig. 1A) were d(TGRTTNCCHCCIIIRTTRTGRCA), d(TGRTTNCCNCCNNNNCCRTGRCA), and d(TGRTTNCCNCCIIIICCRTGRCA). Reverse transcriptase-PCR of spleen total RNA yielded the expected 540-bp PCR product (using the identical protocol as described in Hagen et al. (5)). The complete PCR sample was cloned into a M13 cloning vehicle and screened for putative ppGaNTase fragments using plaque hybridization and a panel of oligonucleotides, d(GARATHTGGGGNGGNGARAA) (primer 3, Fig. 1A), d(GTNGGNCAYGTNTTYMG) (primer 4, Fig. 1A), d(TTRTAYTCRTCCATCCANAC) (primer 5, Fig. 1A), and d(GGRTADATRTTYTCNARRTACCA) (primer 6, Fig. 1A), which corresponded to the conserved aa residues IWGGEN, CSXVGHVFR, EVWMDE, and WYLEN, respectively. Positive M13 clones were sequenced with infrared fluorescent dye-labeled primers on a LiCOR DNA 4000L DNA sequencer. The insert was used to screen a random and oligo(dT)-primed lambda  ZapII, mouse spleen cDNA library (Stratagene). Three positive clones were sequenced on both strands (Fig. 2). Sequence alignments were performed using the Megalign program (DNASTAR) (Fig. 3).


Fig. 1. Strategy for cloning novel polypeptide GalNAc transferase isoforms. A, the linear map summarizes the amino acid sequence alignment results of four different mammalian ppGaNTase isoforms (shown in Fig. 3). Open boxes below the bold line for the protein coding region indicate the amino acid map position and sequence of the segments containing at least three invariant amino acid residues. Degenerate oligonucleotides used as PCR primers or hybridization probes are shown as horizontal arrows. The PCR product amplified by the primers is indicated by a bold line. Primers 1 and 2 were used to obtain original PCR products, and primers 3-6 were used for secondary screenings. B, MegAlignment of 12 clones of the ppGaNTase family demonstrates the aa sequence conservation of the two PCR priming sites that are used in this strategy. Primers 1 and 2 from panel A are also depicted as horizontal arrows.
[View Larger Version of this Image (43K GIF file)]


Fig. 2. Nucleotide and predicted amino acid of murine spleen ppGaNTase-T4. Numbering of the cDNA begins with the initiation codon. The N-terminal transmembrane domain (bold line) was determined by a Kyte-Doolittle hydrophobicity plot. Conserved amino acid residues used to make degenerate PCR primers are enclosed in a box. Putative N-glycosylation sites are circled. The position of the engineered MluI site used to make the truncated expression clone is indicated by the 20-nucleotide oligonucleotide above the horizontal arrow. Mismatched bases in the mutant oligo are indicated by reverse video.
[View Larger Version of this Image (55K GIF file)]


Fig. 3. Amino acid sequence alignments of ppGaNTase-T1, -T2, -T3, and -T4 from human and murine clones. Multiple amino acid sequence alignments were performed using the Clustal method of Megalign (DNASTAR). A consensus sequence is depicted on the horizontal line positioned above alignment blocks. Segments of amino acid sequence that were reverse-translated and used to make hybridization probes or PCR primers are boxed. Horizontal arrows indicate the priming sites of the degenerate PCR primers.
[View Larger Version of this Image (101K GIF file)]

Functional Expression

A 600-bp region of the cDNA, beginning with the first alanine codon immediately following the N-terminal transmembrane domain, was amplified using a PCR primer that introduced a MluI site into the beginning of the luminal region of the transferase (Fig. 2, aa 34 in ppGaNTase-T4 protein). This PCR fragment was fully sequenced (found to be identical to ppGaNTase-T4 except for the presence of the MluI site) and reinserted into the full-length cDNA construct. A MluI-NheI digest released a 1.6-kb fragment that contained the coding region of the truncated ppGaNTase-T4 isozyme and 5 nucleotides of 3'-untranslated region. This MluI-NheI fragment was cloned into the MluI-BamHI sites of a SV40 promoter-driven mammalian expression vector, pIMKF1, containing an insulin secretion signal (I) to direct the secretion of the recombinant ppGaNTase-T4 enzyme into the cell culture medium (5), a metal binding site (M) to facilitate purification of recombinant enzyme (10), a heart muscle kinase site (K) to facilitate detection of recombinant protein, and an N-terminal FLAGTM epitope tag (F) to create pF1-mT4 (Fig. 4). Mock transfections with pSVL-beta -galactosidase and a positive control, pF1-mT1, which expresses mouse ppGaNTase-T1 (9), were performed in parallel. To assess transfection efficiency, two independent constructs of pF1-mT4 were used to transfect COS7 cells. There was <= 16% variation observed well to well among the independent transfections (n = 4) with pF1-mT4. The expression vector, COS7 cell transfections, and kinetic assays were performed as reported previously (10). Briefly, 1 µg of supercoiled DNA and 8 µl of LipofectAMINE (Life Technologies, Inc.) was used to transfect 35-mm wells of COS7 cells at 85-90% confluency as recommended by the manufacturer. Cells were grown at 30 °C in 2 ml of Dulbecco's modified Eagle's medium after transfection. After 3 days the enzyme activity was measured in clarified (centrifuged 100 × g for 10 min) cell culture medium, using 5 µl of medium and the following assay conditions: a final volume of 25 µl containing a final concentration of 500 µM peptide EA2, PTTDSTTPAPTTK (which corresponds to the tandem repeat sequence of rat submandibular gland apomucin (11)), 50 µM total UDP-GalNAc containing UDP-[14C]GalNAc (25,000 cpm), 10 mM MnCl2, 40 mM cacodylate, pH 6.5, 40 mM 2-mercaptoethanol, and 0.1% Triton X-100. All assays were performed in duplicate as indicated in the figures at 37 °C. One unit of activity was defined as the transfer of 100 pmol of GalNAc to the EA2 peptide/h under these assay conditions.


Fig. 4. Design and sequence of the epitope tag region of the pIMKF1 mammalian expression vectors. Source of 5'-untranslated region, insulin secretion sequence, and metal chelate site are described in Ref. 10. The abbreviations used are: I, insulin secretion signal peptide; M, histidine-rich metal binding site; K, heart muscle kinase phosphorylation site; and F, FLAGTM (Kodak) antibody recognition site. A, pIMKF1 plasmid contains a XhoI-BamHI fragment cloned into pSVL (Pharmacia Biotech Inc.). B, pF1-mT1 and pF1-mT4 expression constructs contain truncated coding regions of ppGaNTase-T1 or -T4, cloned into the MluI and BamHI sites, as described under "Experimental Procedures" and in Fig. 2. C, recombinant protein produced upon transient transfection into COS7 cells. The translated recombinant protein is secreted into the culture medium. Nucleotide and amino acid sequence of the N terminus of the coding region of the secreted recombinant protein. The actual processing site was determined from a nearly identical construct, pSVL-inGNT1 (1), and the N-terminal amino acid sequence was deduced from the nucleotide sequence.
[View Larger Version of this Image (33K GIF file)]

To compare the substrate preferences of the ppGaNTase-T4 and ppGaNTase-T1 isoforms, a panel of peptide substrates was screened using anti-FLAGTM affinity-purified recombinant ppGaNTase-T4 and -T1 enzymes. Briefly, clarified cell culture medium (1.5 ml) from COS7 cells transfected with either pF1-mT1 or pF1-mT4 was incubated with anti-FLAGTM M2 affinity gel (150 µl of a 50% (v/v) slurry) (Eastman Kodak Co.) overnight at 4 °C with gentle rocking. Bound materials were eluted with 4 mM FLAGTM peptide dissolved in 75 µl of 50 mM NaCl, 50% glycerol, 50 mM sodium cacodylate buffer, pH 6.5. Peptide substrates included EA2, Muc 1a-APPAHGVTSAPDTRPAPGC, and Muc 1b-PDTRPAPGSTAPPAC (12) derived from the protein core of human Muc 1 mucin-type glycoprotein, Muc 2-PTTTPISTTTMVTPTPTPTC (13) derived from human intestinal apomucin, RMUC-176-TTTPDV (14) derived from rat small intestine/colonic apomucin, EPO-T-PPDAATAAPLR and EPO-S-PPDAASAAPLR (5) derived from human erythropoietin, rMUC-2-SPTTSTPISSTPQPTS (15) derived from rat small and large intestinal apomucin, AWN1a-AIPPLNLSCGKE and AWN1b-KRLPTSGHPASP (16) derived from porcine spermadhesin AWN, and MCP2-STSSSTTKSPASSAS (17) derived from human testis membrane cofactor protein. Assays were conducted in duplicate using enzymes derived from the same transfection. To verify that ppGaNTase-T1 and ppGaNTase-T4 have different substrate specificities and that the recombinant preparations do not contain differing levels of transferase inhibitors, mixing experiments were performed in which the level of sugar transfer by each isoform was compared with that obtained when the two isoforms were mixed together.

Northern Blot Analysis

Following electrophoresis, mouse total RNA samples were transferred to Hybond-N membranes (Amersham Corp.). A 117-bp segment of the ppGaNTase-T4 cDNA region (nucleotide position 562-679, Fig. 2) was labeled by asymmetric PCR (18) using the antisense oligonucleotide d(CCAGGAAAGTGAGGACA) and then used as a probe for the ppGaNTase-T4 transcript. ppGaNTAse-T1 message was detected by the same method using cDNA sequences encoding aa positions 515-559 of the ppGaNTase-T1 cDNA and oligonucleotide d(AAGAAAGGATTGACTGGGCTAC). Antisense 18 S ribosomal subunit oligonucleotide d(TATTGGAGCTGGAATTACCGCGGCTGCTGG) was end-labeled (19) and used to normalize sample loading by hybridizing with a 5-molar excess of probe. All hybridizations were performed in 5× SSPE/50% formamide at 42 °C with two final washes in 2× SSC/0.1% SDS at 65 °C for 20 min.


RESULTS

Conserved Sequences In the ppGaNTase Family

Primary sequence alignments of three different isoforms of the ppGaNTase family from different mammals and putative transferases from C. elegans demonstrated that the size of the conserved region of this enzyme is approximately 420 amino acids in length (consensus aa 151-570, Fig. 3). This 420-aa region consists of 13 segments of 7-12 amino acids that are highly conserved (>70% similarity) among 3 mammalian forms and 3 homologues found in C. elegans (Fig. 1A). Two such short blocks of nearly invariant sequences, AGGLF at consensus aa 367 (Fig. 3) and CH(G/N)XGGNQ at consensus aa 543 (Fig. 3), were used to design degenerate PCR primers (Fig. 1, primers 1 and 2). Reverse transcriptase-PCR of 14 different RNA sources produced 540-bp PCR products in all samples tested (data not shown). We continued the analysis of the PCR products from spleen samples because in prior work we had demonstrated that the spleen expresses a low level of ppGaNTase-T1 transcript but expresses high levels of ppGaNTase enzyme activity (20). PCR products were then subcloned to create a library in M13; the resultant clones were re-screened with internal nested primers (Fig. 1A, primers 3, 4, 5, and 6) to eliminate false positive clones.

Based on DNA sequencing results, the degenerate PCR primers and oligonucleotide probes were successful in identifying all known ppGaNTase isoforms (ppGaNTase-T1, -T2, and -T3) from a variety of tissue sources (data not shown), thus validating the approach. In addition, a PCR fragment lacking nucleic acid sequence identity with ppGaNTase-T1, T2, or -T3 was detected among the amplified fragments derived from spleen RNA. This fragment was used to probe a mouse spleen cDNA library (1 × 106 plaques).

cDNA Cloning of ppGaNTase-T4 and Sequence Analysis

Of the 34 positive clones obtained, one contained a 1734-bp open reading frame encoding a 578-amino acid protein (Fig. 2). Conceptual translation of the ppGaNTase-T4 message revealed a protein with a type II membrane protein architecture, typical of the ppGaNTase family. An N-terminal 12-aa cytoplasmic segment preceded a 22-aa hydrophobic transmembrane domain, which was followed by a 544-amino acid C-terminal luminal domain. Potential N-glycosylation sites are found at Asn466 and Asn471. Sequence analysis using the Clustal Method produced alignments demonstrating that this protein is distinct from the ppGaNTase-T1, -T2, and -T3 isozymes yet shares a sequence similarity between consensus aa positions 150 and 570 (Fig. 3). BestFit analysis reveals that the overall amino acid sequence similarity of this 420-aa region is 69, 67, and 68% when mouse ppGaNTase-T4 is compared with mouse-ppGaNTase-T1, human ppGaNTase-T2, and mouse ppGaNTase-T3, respectively. The 100-amino acid segment from consensus positions 358 to 457 is highly conserved as is a span of 26 aa beginning at consensus position 185 (Fig. 3). A search of the combined GenBankTM/NCBI data bases did not reveal any genes or expressed sequence tags that were identical to ppGaNTase-T4.

Functional Expression

A truncated coding region of the putative transferase beginning with the first alanine (Ala34) codon following the N-terminal transmembrane domain was cloned downstream of a FLAGTM epitope tag and insulin secretion signal creating the vector pF1-mT4 (Fig. 4). The expressed product was secreted into the culture medium of the transfected COS7 cells and shown to be active. A low background of activity equal to 1% of the wild-type ppGaNTase-T1 activity was detected in the culture medium of mock-transfected cells. Following enrichment of each recombinant enzyme by immunoadsorption on anti-FLAGTM affinity matrix, similar units of ppGaNTase-T1 and ppGaNTase-T4 enzyme activity were compared using the EA2 peptide to normalize the amount of enzymatic activity used. Recombinant ppGaNTase-T1 glycosylated 6 peptides from a diverse set of 11 substrates, whereas ppGaNTase-T4 displayed a marked preference for EA2, a peptide derived from the tandem repeat sequence of rat submandibular gland mucin (Fig. 5). ppGaNTase-T4 showed limited activity (<= 252 cpm/h) on five additional substrates.


Fig. 5. O-Glycosylation of peptide substrates with ppGaNTase-T1 and ppGaNTase-T4. ppGaNTase enzyme assays were performed using a 500 mM final peptide concentration. Similar units (as defined by the rate of incorporation into the EA2 peptide) of partially purified recombinant ppGaNTase-T1 (shaded bar) and partially purified recombinant ppGaNTase-T4 (solid bar) enzymes were used in the in vitro assay. All assays were performed in duplicate. Vertical axis indicates rate of transfer as cpm/h. Reaction products were purified using anion exchange chromatography (AG 1X-8, Bio-Rad). Reactions lacking either enzyme or peptide yielded a background of 104 cpm, which was subtracted from each sample. Each bar represents the average of values obtained from two independent transfections with each point assayed in duplicate. Standard error of the mean is indicated by error bars. The peptide sequences and the specific activity of the sugar donor and the peptide sequences used are outlined under "Experimental Procedures."
[View Larger Version of this Image (25K GIF file)]

To demonstrate that ppGaNTase-T1 and ppGaNTase-T4 have different substrate specificities and to rule out the possibility that the results obtained are not due to the presence of specific inhibitors of transferase activity in each enzyme preparation, we performed a mixing experiment under conditions where each reaction was linear (data not shown). As summarized in Table I, the activity of the two isoforms is additive (within a 10% error margin). The calculated sum of ppGaNTase-T1 and -T4 activities per µl of enzyme preparation yielded the same activity as in assays in which both isoforms were added simultaneously.

Table I. The activities of ppGaNTase-T1 and -T4 are additive


Enzyme(s) [14C]GalNAc incorporation into peptides
EA2 EPO-T

(cpm/h)
ppGaNTase-T1a 2373  ± 2 839  ± 58
ppGaNTase-T4a 1688  ± 133 157  ± 10
Expected sum of ppGaNTase-T1 and T4b 4061    996    
Observed value for mixing ppGaNTase-T1 and T4c 4023  ± 37 1107  ± 15

a Rate of [14C]GalNAc incorporation in cpm/h is expressed for 1 µl of each enzyme using 500 µM either EA2 or EPO-T peptide.
b Expected sum of ppGaNTase-T1 and T4 was calculated by adding the rate of glycosylation for 1 µl of each enzyme preparation (T1 + T4).
c Observed value is obtained by performing a standard enzyme assay of a mixture containing 1 µl of ppGaNTase-T1 and 1 µl of ppGaNTase-T4.

Northern Blot Analysis

The size and tissue distribution of the murine ppGaNTase-T4 and -T1 messages clearly differ (Fig. 6). The predominant ppGaNTase-T4 transcript was 5.5 kb; minor levels of message were 2.8 and 1.7 kb in length. The most abundant ppGaNTase-T4 signal was observed in the mouse sublingual gland, stomach, colon, small intestine, and cervix. Intermediate levels of message were seen in kidney, ovary, lung, and uterus. Low levels of transcript were observed in the spleen sample with trace amounts detected in liver, heart, and brain. No signal was detected from submandibular and parotid glands, skeletal muscle, and testis. In contrast, the ppGaNTase-T1 message is expressed as a doublet at 3.6 and 4.2 kb at varying levels in all the tissues surveyed.


Fig. 6. Northern blot analysis of ppGaNTase-T1 and ppGaNTase-T4. Total RNA from Balb/c mice was extracted from glands and organs listed above panel A. After electrophoresis on 1% formaldehyde-agarose gel and transfer to Hybond-N membranes, RNA was hybridized with a ppGaNTase-T4-specific probe (top panel), T1-specific probe (middle panel), and 18 S rRNA probe (lower panel). Each lane contains 7.5 µg of total RNA. Size markers are indicated on the left. SM Gland, submandibular gland; SL Gland, sublingual gland; Sm Intestine, small intestine.
[View Larger Version of this Image (87K GIF file)]


DISCUSSION

To help define the repertoire of ppGaNTases in a tissue, we have devised a PCR-based strategy that employs a series of oligonucleotides derived from conserved sequences found within a 420-aa region of the ppGaNTase family of enzymes. PCR products could be amplified with one set of oligonucleotide primers, cloned into an M13 vehicle, and then screened using a second set of degenerate oligonucleotides that are nested within the original primers. This strategy yields an M13 library of the PCR products and a means to discriminate among clones encoding different ppGaNTase isoforms and false PCR products. In contrast to the approach of Bennett et al. (8), we avoided using restriction enzyme cleavage patterns as a means to identify novel isoforms, because some restriction recognition sequences were conserved among different isoforms whereas other sites were not present in all mammalian species. Using this approach we were able to identify products corresponding to the previously identified ppGaNTase-T1, -T2, and -T3 as well as ppGaNTase-T4 described herein. A search of the GenBankTM/NCBI data base failed to identify any identical matches, indicating that this isoform is novel. We have also identified transcripts that encode additional putative transferases, which are expressed in the rat sublingual gland.2 We are currently determining if these species code for active enzyme.

All four members of the ppGaNTase family share a type II membrane architecture, consisting of a short (4-19 aa) N-terminal cytoplasmic segment, a 19-24-aa transmembrane domain, a variable length stem region, and a luminal catalytic domain that is represented by most of the coding region on the C terminus. While there is no obvious primary aa sequence similarity in the N-terminal transmembrane and stem region of the enzymes, the sequence of the Golgi luminal domain is highly conserved within a block of approximately 420 aa (consensus aa 151-570, Fig. 3). This region is noticeably larger than the putative 61-aa "GalNAc-T Motif" previously reported by Bennett et al. (8). The sequence divergence within this large 420-aa region among the known isoforms of ppGaNTases is not sufficiently high to simply identify potential aa residues that may be involved in substrate binding or catalysis.

When partially purified recombinant ppGaNTase-T1 and -T4 were compared for their ability to incorporate GalNAc into a panel of peptide substrates, we determined that only EA2 (PTTDSTTPAPTTK) was a good acceptor for ppGaNTase-T4. Thus, ppGaNTase-T4 transferred GalNAc to EA2 at a rate approximately 12 times greater than that observed for the single site substrate EPO-T. This is in contrast to ppGaNTase-T1, which transfers GalNAc to EA2 at only a 2-fold higher rate than EPO-T (Fig. 5). To verify that ppGaNTase-T1 and -T4 have different substrate specificities, we took advantage of the apparent substrate preferences for EA2 and EPO-T and performed mixing experiments under conditions in which each reaction was linear. The activity of the transferases in a mixture was shown to be additive. This result eliminates the possibility that inhibitors from each enzyme preparation account for the differences in substrate specificity observed.

The patterns of transcript expression of the known forms of ppGaNTase differ. Based upon our work (Refs. 9 and 20 and the present study) and that of others (8) it appears that ppGaNTase-T1 and -T2 are expressed ubiquitously, -T3 is expressed in a more limited range of tissues, and -T4 more restricted still. Perhaps the pattern of expression reflects the diversity of endogenous substrates that must be O-glycosylated. For example, the rat submandibular gland, which expresses a relatively simple apomucin (11), expresses relatively low levels of ppGaNTase-T1 and -T3 transcript but not -T4. In contrast, the rat sublingual gland, which produces a much larger apomucin,3 expresses at least seven forms of ppGaNTase transcript (i.e. ppGaNTase-T1, -T2, -T3, and -T4 plus three as yet uncharacterized forms identified with the PCR approach described here), with very high levels of ppGaNTase-T4 noted (Fig. 5). Thus, it is conceivable that more than one enzyme may be required to fully glycosylate the complete repertoire of mucin-type substrates expressed in a given cell. This likely accounts for the differences observed in the tissue-specific expression of the various ppGaNTases identified to date.


FOOTNOTES

*   This work was supported in part by National Institutes of Health Grant DE-08108 (to L. A. T.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) U73820[GenBank] (mouse ppGaNTase-T1) and U73819[GenBank] (mouse ppGaNTase-T4).


Dagger    To whom correspondence should be addressed: Depts. of Dental Research and Biochemistry and Biophysics, the School of Medicine and Dentistry, University of Rochester, 601 Elmwood Ave., Box 611, Rochester, NY 14642. Tel.: 716-275-0770; Fax: 716-473-2679; E-mail: LTAB{at}medinfo.rochester.edu.
1   The abbreviations used are: ppGaNTase, UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase; PCR, polymerase chain reactions; aa, amino acid; bp, base pair(s); kb, kilobase(s).
2   F. K. Hagen, unpublished observations.
3   K. G. Ten Hagen and L. A. Tabak, unpublished observations.

REFERENCES

  1. Tabak, L. A. (1995) Annu. Rev. Physiol. 57, 547-564 [CrossRef][Medline] [Order article via Infotrieve]
  2. Dowbenko, D., Andalibi, A., Young, P. E., Lusis, A. J., and Lasky, L. A. (1993) J. Biol. Chem. 268, 4525-4529 [Abstract/Free Full Text]
  3. Kinloch, R. A., Sakai, Y., and Wasserman, P. M. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 263-267 [Abstract/Free Full Text]
  4. Sawada, T., Ho, J. J., Chung, Y. S., Sowa, M., and Kim, Y. S. (1994) Int. J. Cancer 57, 901-907 [Medline] [Order article via Infotrieve]
  5. Hagen, F. K., VanWuyckhuyse, B., and Tabak, L. A. (1993) J. Biol. Chem. 268, 18960-18965 [Abstract/Free Full Text]
  6. Homa, F. L., Hollander, T., Lehman, D. J., Thomsen, D. R., and Elhammer, A. P. (1993) J. Biol. Chem. 268, 12609-12616 [Abstract/Free Full Text]
  7. Sørensen, T., White, T., Wandall, H. H., Kristensen, A. K., Roepstorff, P., and Clausen, H. (1995) J. Biol. Chem. 270, 24166-24173 [Abstract/Free Full Text]
  8. Bennett, E. P., Hassan, H., and Clausen, H. (1996) J. Biol. Chem. 271, 17006-17012 [Abstract/Free Full Text]
  9. Zara, J., Hagen, F. K., Ten Hagen, K. G., VanWuyckhuyse, B. C., and Tabak, L. A. (1996) Biochem. Biophys. Res. Commun. 228, 38-44 [CrossRef][Medline] [Order article via Infotrieve]
  10. Wragg, S., Hagen, F. K., and Tabak, L. A. (1995) J. Biol. Chem. 270, 16947-16954 [Abstract/Free Full Text]
  11. Albone, E. F., Hagen, F. K., VanWuyckhuyse, B. C., and Tabak, L. A. (1994) J. Biol. Chem. 269, 16845-16852 [Abstract/Free Full Text]
  12. Gendler, S. J., Lancaster, C. A., Taylor-Papadimitriou, J., Duhig, T., Peat, N., Burchell, J., Pemberton, L., Lalani, E.-N., and Wilson, D. (1990) J. Biol. Chem. 265, 15286-15293 [Abstract/Free Full Text]
  13. Gum, J. R., Jr., Hickes, J. W., Toribara, N. W., Siddiki, B., and Kim, Y. S. (1994) J. Biol. Chem. 269, 2440-2446 [Abstract/Free Full Text]
  14. Gum, J. R., Jr., Hicks, J. W., Lagace, R. E., Byrd, J. C., Toribara, N. W., Siddiki, B., Fearney, F. J., Lamport, D. T. A., and Kim, Y. S. (1991) J. Biol. Chem. 266, 22733-22738 [Abstract/Free Full Text]
  15. Ohmori, H., Dohrman, A. F., Gallup, M., Tsuda, T., Kai, H., Gum, J. R., Jr., Kim, Y. S., and Basbaum, C. B. (1994) J. Biol. Chem. 269, 17833-17840 [Abstract/Free Full Text]
  16. Sanz, L., Calvete, J. J., Mann, K., Schafer, W., Schmid, E. R., Amselgruber, W., Sinowatz, F., Ehrhard, M., and Topfer-Petersen, E. (1992) FEBS Lett. 300, 213-218 [CrossRef][Medline] [Order article via Infotrieve]
  17. Liszewski, M. K., Post, T. W., and Atkinson, J. P. (1991) Annu. Rev. Immunol. 9, 431-455 [CrossRef][Medline] [Order article via Infotrieve]
  18. Bednarczuk, T. A., Wiggins, R. C., and Konat, G. W. (1991) BioTechniques 10, 478-479 [Medline] [Order article via Infotrieve]
  19. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  20. Hagen, F. K., Gregoire, C. A., and Tabak, L. A. (1995) Glycoconj. J. 12, 901-909 [CrossRef][Medline] [Order article via Infotrieve]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
M. Tenno, K. Ohtsubo, F. K. Hagen, D. Ditto, A. Zarbock, P. Schaerli, U. H. von Andrian, K. Ley, D. Le, L. A. Tabak, et al.
Initiation of Protein O Glycosylation by the Polypeptide GalNAcT-1 in Vascular Biology and Humoral Immunity
Mol. Cell. Biol., December 15, 2007; 27(24): 8783 - 8796.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. A. Gerken, J. Raman, T. A. Fritz, and O. Jamison
Identification of Common and Unique Peptide Substrate Preferences for the UDP-GalNAc:Polypeptide {alpha}-N-acetylgalactosaminyltransferases T1 and T2 Derived from Oriented Random Peptide Substrates
J. Biol. Chem., October 27, 2006; 281(43): 32403 - 32416.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. A. Fritz, J. Raman, and L. A. Tabak
Dynamic Association between the Catalytic and Lectin Domains of Human UDP-GalNAc:Polypeptide {alpha}-N-Acetylgalactosaminyltransferase-2
J. Biol. Chem., March 31, 2006; 281(13): 8613 - 8619.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. H. Dube, J. A. Prescher, C. N. Quang, and C. R. Bertozzi
Probing mucin-type O-linked glycosylation in living animals
PNAS, March 28, 2006; 103(13): 4819 - 4824.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
L. Kinarsky, G. Suryanarayanan, O. Prakash, H. Paulsen, H. Clausen, F.-G. Hanisch, M. A. Hollingsworth, and S. Sherman
Conformational studies on the MUC1 tandem repeat glycopeptides: implication for the enzymatic O-glycosylation of the mucin protein core
Glycobiology, December 1, 2003; 13(12): 929 - 939.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. G. Ten Hagen, D. T. Tran, T. A. Gerken, D. S. Stein, and Z. Zhang
Functional Characterization and Expression Analysis of Members of the UDP-GalNAc:Polypeptide N-Acetylgalactosaminyltransferase Family from Drosophila melanogaster
J. Biol. Chem., September 12, 2003; 278(37): 35039 - 35048.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
W. W. Young Jr., D. R. Holcomb, K. G. Ten Hagen, and L. A. Tabak
Expression of UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase isoforms in murine tissues determined by real-time PCR: a new view of a large family
Glycobiology, July 1, 2003; 13(7): 549 - 557.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
N. T. Marcos, A. Cruz, F. Silva, R. Almeida, L. David, U. Mandel, H. Clausen, S. von Mensdorff-Pouilly, and C. A. Reis
Polypeptide GalNAc-transferases, ST6GalNAc-transferase I, and ST3Gal-transferase I Expression in Gastric Carcinoma Cell Lines
J. Histochem. Cytochem., June 1, 2003; 51(6): 761 - 771.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Zhang, H. Iwasaki, H. Wang, T. Kudo, T. B. Kalka, T. Hennet, T. Kubota, L. Cheng, N. Inaba, M. Gotoh, et al.
Cloning and Characterization of a New Human UDP-N-Acetyl-alpha -D-galactosamine:Polypeptide N-Acetylgalactosaminyltransferase, Designated pp-GalNAc-T13, That Is Specifically Expressed in Neurons and Synthesizes GalNAc alpha -Serine/Threonine Antigen
J. Biol. Chem., January 3, 2003; 278(1): 573 - 584.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
K. G. Ten Hagen, T. A. Fritz, and L. A. Tabak
All in the family: the UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferases
Glycobiology, January 1, 2003; 13(1): 1R - 16R.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Tenno, A. Saeki, F. J. Kezdy, A. P. Elhammer, and A. Kurosaka
The Lectin Domain of UDP-GalNAc:Polypeptide N-Acetylgalactosaminyltransferase 1 Is Involved in O-Glycosylation of a Polypeptide with Multiple Acceptor Sites
J. Biol. Chem., November 27, 2002; 277(49): 47088 - 47096.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. G. T. Hagen and D. T. Tran
A UDP-GalNAc:Polypeptide N-Acetylgalactosaminyltransferase Is Essential for Viability in Drosophila melanogaster
J. Biol. Chem., June 14, 2002; 277(25): 22616 - 22622.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Schwientek, E. P. Bennett, C. Flores, J. Thacker, M. Hollmann, C. A. Reis, J. Behrens, U. Mandel, B. Keck, M. A. Schafer, et al.
Functional Conservation of Subfamilies of Putative UDP-N-acetylgalactosamine:Polypeptide N-Acetylgalactosaminyltransferases in Drosophila, Caenorhabditis elegans, and Mammals. ONE SUBFAMILY COMPOSED OF l(2)35Aa IS ESSENTIAL IN DROSOPHILA
J. Biol. Chem., June 14, 2002; 277(25): 22623 - 22638.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. C. M. Brinkman-Van der Linden and A. Varki
New Aspects of Siglec Binding Specificities, Including the Significance of Fucosylation and of the Sialyl-Tn Epitope
J. Biol. Chem., March 17, 2000; 275(12): 8625 - 8632.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. G. T. Hagen, D. Tetaert, F. K. Hagen, C. Richet, T. M. Beres, J. Gagnon, M. M. Balys, B. VanWuyckhuyse, G. S. Bedi, P. Degand, et al.
Characterization of a UDP-GalNAc:Polypeptide N-Acetylgalactosaminyltransferase That Displays Glycopeptide N-Acetylgalactosaminyltransferase Activity
J. Biol. Chem., September 24, 1999; 274(39): 27867 - 27874.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. K. Hagen, B. Hazes, R. Raffo, D. deSa, and L. A. Tabak
Structure-Function Analysis of the UDP-N-acetyl-D-galactosamine:Polypeptide N-acetylgalactosaminyltransferase. ESSENTIAL RESIDUES LIE IN A PREDICTED ACTIVE SITE CLEFT RESEMBLING A LACTOSE REPRESSOR FOLD
J. Biol. Chem., March 5, 1999; 274(10): 6797 - 6803.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. P. Bennett, H. Hassan, U. Mandel, E. Mirgorodskaya, P. Roepstorff, J. Burchell, J. Taylor-Papadimitriou, M. A. Hollingsworth, G. Merkx, A. G. van Kessel, et al.
Cloning of a Human UDP-N-Acetyl-alpha -D-Galactosamine:Polypeptide N-Acetylgalactosaminyltransferase That Complements Other GalNAc-Transferases in Complete O-Glycosylation of the MUC1 Tandem Repeat
J. Biol. Chem., November 13, 1998; 273(46): 30472 - 30481.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. A. M. de Haan, P. Roestenberg, M. de Wit, A. A. F. de Vries, T. Nilsson, H. Vennema, and P. J. M. Rottier
Structural Requirements for O-Glycosylation of the Mouse Hepatitis Virus Membrane Protein
J. Biol. Chem., November 6, 1998; 273(45): 29905 - 29914.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. G. T. Hagen, F. K. Hagen, M. M. Balys, T. M. Beres, B. Van Wuyckhuyse, and L. A. Tabak
Cloning and Expression of a Novel, Tissue Specifically Expressed Member of the UDP-GalNAc:Polypeptide N-Acetylgalactosaminyltransferase Family
J. Biol. Chem., October 16, 1998; 273(42): 27749 - 27754.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. K. Hagen and K. Nehrke
cDNA Cloning and Expression of a Family of UDP-N-acetyl-Dgalactosamine:Polypeptide N-Acetylgalactosaminyltransferase Sequence Homologs from Caenorhabditis elegans
J. Biol. Chem., April 3, 1998; 273(14): 8268 - 8277.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Hassan, C. A. Reis, E. P. Bennett, E. Mirgorodskaya, P. Roepstorff, M. A. Hollingsworth, J. Burchell, J. Taylor-Papadimitriou, and H. Clausen
The Lectin Domain of UDP-N-acetyl-D-galactosamine:Polypeptide N-acetylgalactosaminyltransferase-T4 Directs Its Glycopeptide Specificities
J. Biol. Chem., December 1, 2000; 275(49): 38197 - 38205.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. G. T. Hagen, G. S. Bedi, D. Tetaert, P. D. Kingsley, F. K. Hagen, M. M. Balys, T. M. Beres, P. Degand, and L. A. Tabak
Cloning and Characterization of a Ninth Member of the UDP-GalNAc:Polypeptide N-Acetylgalactosaminyltransferase Family, ppGaNTase-T9
J. Biol. Chem., May 11, 2001; 276(20): 17395 - 17404.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hagen, F. K.
Right arrow Articles by Tabak, L. A.
Right arrow Search for Related Content
PubMed