|
Volume 272, Number 21,
Issue of May 23, 1997
pp. 13916-13922
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
Translesional Synthesis on DNA Templates Containing a Single
Abasic Site
A MECHANISTIC STUDY OF THE "A RULE"*
(Received for publication, August 7, 1996, and in revised form, January 19, 1997)
Shinya
Shibutani
,
Masaru
Takeshita
and
Arthur P.
Grollman
From the Department of Pharmacological Sciences, State University
of New York, Stony Brook, New York 11794-8651
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
Site-specifically modified oligodeoxynucleotides
containing a single natural abasic site or a chemically synthesized
(tetrahydrofuran or deoxyribitol) model abasic site were used as
templates for primer extension reactions catalyzed by the Klenow
fragment of Escherichia coli DNA polymerase I or by calf
thymus DNA polymerase . Analysis of the fully extended products of
these reactions indicated that both polymerases preferentially
incorporate dAMP opposite the natural abasic site and tetrahydrofuran,
while DNA templates containing the ring-opened deoxyribitol moiety
block translesional synthesis, promoting sequence
context-dependent deletions. The frequency of nucleotide
insertion opposite the three types of abasic sites follows the order
dAMP > dGMP > dCMP > dTMP. The frequency of chain
extension was highest when dAMP was positioned opposite a natural
abasic site. The frequency of translesional synthesis past abasic sites
follows the order tetrahydrofuran > deoxyribose > deoxyribitol. The Klenow fragment promotes blunt end addition of dAMP;
this reaction was much less efficient than insertion of dAMP opposite
an abasic site. We conclude that the miscoding potential of a natural
abasic site in vitro closely resembles that of its
tetrahydrofuran analog. Ring-opened abasic sites favor deletions.
Studies with polymerase in vitro predict preferential
incorporation of dAMP at abasic sites in mammalian cells.
INTRODUCTION
Abasic sites in DNA arise spontaneously by hydrolysis, a process
that can be accelerated by modification of purine bases (1) and by the
catalytic action of N-glycosylases that remove damaged bases
from DNA (2-4). The natural abasic site
(Ab)1 exists as an equilibrium mixture of
the cyclic hemiacetal and open chain aldehyde forms of 2 -deoxyribose
(see Fig. 1) and is subject to -elimination. This chemical reaction
leads to strand scission (5); for that reason, structural analogs of
deoxyribose have often been used to explore biological properties of
abasic sites in DNA (6-10). Abasic site analogs include deoxyribitol, a model for the open chain form of the sugar (6, 7), and tetrahydrofuran, an isosteric and isoelectronic analog of deoxyribose (8, 9) that is cleaved by type II AP endonucleases, but is not subject
to -elimination (9).
Fig. 1.
Structures of abasic sites used in this
study.
[View Larger Version of this Image (7K GIF file)]
The miscoding properties of natural and synthetic abasic sites have
been investigated under a variety of experimental conditions using
randomly or site-specifically modified DNA (6, 7, 11-15). The relative
frequency of base incorporation opposite abasic sites and of chain
extension from the 3 -primer terminus has also been reported (8, 9).
While natural and synthetic abasic sites are structurally similar,
their mutagenic potential has not been compared under the same
experimental conditions.
In Escherichia coli, synthesis past abasic sites in
vitro (6-9, 11-13) and in vivo (14, 15) is
accompanied by preferential incorporation of dAMP opposite the lesion,
a phenomenon known as the "A rule" (16). In eukaryotes, the
presence of abasic sites in DNA is associated with different mutational
spectra. For example, dAMP, dCMP, and dTMP were inserted at similar
frequencies opposite a natural abasic site when a plasmid vector
containing this lesion was allowed to replicate in simian kidney (COS)
cells (17-20). In another study in COS cells, preferential
incorporation of dAMP was observed opposite the tetrahydrofuran moiety,
accompanied by a small number of deletions (21). In human
lymphoblastoid cells, dGMP was incorporated preferentially opposite
natural abasic sites (22). In AP endonuclease-deficient strains of
yeast, the frequency of A:T C:G events increased (23); in another
yeast system, dCMP was predominantly incorporated opposite the lesion (24). In this report, we used a prokaryotic and a eukaryotic DNA
polymerase and DNA templates containing a single abasic site to explore
the mechanistic basis underlying mutagenesis at abasic sites in
DNA.
Recently, one of us (S. S.) developed a method by which
site-specifically modified oligodeoxynucleotides could be used to quantify all base substitutions and deletions occurring during DNA
synthesis in vitro (25). Combined with steady-state kinetic analysis (26, 27), this experimental system is used to compare the
miscoding properties of a natural abasic site and its analogs in
reactions catalyzed by the Klenow fragment of E. coli DNA
polymerase I or by calf thymus DNA polymerase . Our results indicate
that the natural abasic site resembles closely the tetrahydrofuran moiety with respect to its miscoding properties. These lesions, which
exist primarily or exclusively in a ring-closed conformation, preferentially incorporate dAMP opposite the lesion. In contrast, deoxyribitol, which serves as a model for the open chain (minor) form
of the natural abasic site, blocks DNA synthesis and promotes the
sequence-dependent formation of 1- and 2-base deletions.
In vitro, both pol and the Klenow fragment operate
according to the tenets of the A rule.
EXPERIMENTAL PROCEDURES
Materials
Organic chemicals used for the synthesis of
oligodeoxynucleotides were supplied by Aldrich.
[ -32P]ATP (specific activity > 6000 Ci/mmol) was
obtained from Amersham Corp. Cloned exo+ (17,400 units/mg)
and exo (21,200 units/mg) Klenow fragments of E. coli polymerase I (1 unit of enzyme catalyzes the incorporation of
1 nmol of total nucleotide into acid-insoluble form in 60 min at
37 °C) and uracil-DNA glycosylase (1 unit/µl) were purchased from
U. S. Biochemical Corp. Intact DNA pol I and dNTPs were from
Pharmacia; calf thymus DNA pol (30,000 units/mg) (1 unit of enzyme
catalyzes the incorporation of 10 nmol of nucleotide acid-insoluble
material in 30 min at 37 °C using poly(dA-dT) as template primer)
was from Molecular Biology Resources, Inc.; T4 polynucleotide kinase
was from Stratagene; and venom phosphodiesterase I was from Sigma.
Acetonitrile, triethylamine, and distilled water, all HPLC-grade, were
purchased from Fisher. A Waters 990 HPLC instrument, equipped with a
photodiode array detector, was used to separate and analyze modified
and unmodified oligodeoxynucleotides.
Synthesis and Purification of
Oligodeoxynucleotides
Oligodeoxynucleotides were synthesized by
solid-state methods using an automated DNA synthesizer. Templates
containing a single unmodified dG or tetrahydrofuran (F) residue at
position 13 (Sequences 1, 4, 11, and 18 in Table I) were
synthesized as described previously (9). Templates (18-mers) containing
a single natural abasic site (Ab) were prepared by incubating 5 µg of
an unmodified oligomer containing a single dG (sequence 1 or 11)
dissolved in 100 µl of 30 mM HCl at 37 °C for 16 h (28). The reaction mixture was evaporated to dryness in a vacuum
desiccator and subjected to HPLC. The 18-mer containing an Ab site
(tR = 20.4 min) was separated from the parent
oligomer (tR = 22.1) on a reverse-phase µBondapak
C18 column (0.38 × 30 cm; Waters) using a linear
gradient of 0.05 M triethylammonium acetate (pH 7.0) containing 10-20% acetonitrile, an elution time of 60 min, and a flow
rate of 1.0 ml/min (29). Eluate containing the Ab-modified 18-mer was
concentrated using a Centricon-3 filter (Amicon, Inc.). The filter was
rinsed three times with 1 ml of distilled water at 4 °C. Reduction
of the natural Ab site was conducted at room temperature.
NaBH4 (0.35 M) dissolved in 0.5 M
phosphate buffer was added in three portions over 90 min (30). Reaction
mixtures were concentrated with a Centricon-3 filter and then subjected to HPLC. Oligomers containing the reduced form of the natural abasic
site (Re) were isolated as described above. An Ab-modified 24-mer
template (Sequence 16) was prepared using uracil-DNA glycosylase. Six
µg of a uracil-modified 24-mer (Sequence 17) were incubated for
2 h at 37 °C with 10 units of uracil glycosylase in a reaction containing 70 mM Hepes, 50 mM EDTA, and 1 mM dithiothreitol (pH 7.4). The Ab-modified 24-mer
(tR = 22.1 min) was resolved from the parent
uracil-modified 24-mer (tR = 23.3) on a
reverse-phase µBondapak C18 column (0.78 × 30 cm;
Waters) using a linear gradient of 0.05 M triethylammonium
acetate (pH 7.0) containing 10-20% acetonitrile, an elution time of
60 min, and flow rate of 2.0 ml/min. Oligodeoxynucleotides were further
purified by electrophoresis on 20% polyacrylamide gel in the presence
of 7 M urea and labeled at the 5 -terminus by treatment
with bacteriophage T4 polynucleotide kinase in the presence of
[ -32P]ATP (31). To establish homogeneity, samples were
subjected to 20% polyacrylamide gels (15 × 72 × 0.04 cm)
containing 7 M urea. The position of oligomers on the gel
was established by autoradiography using Kodak X-Omat XAR film.
Table I.
Sequence of oligodeoxynucleotides
Shown are the sequences of templates, primers, and standard markers.
N = C, A, G, or T.
Shown are the sequences of templates, primers, and standard markers.
N = C, A, G, or T.
|
| No. |
Sequence
|
|
| 1 |
CCTTCGCTCCTTTCCTCT
|
| 2 |
CCTTCAbCTCCTTTCCTCT
|
| 3 |
CCTTCReCTCCTTTCCTCT
|
| 4 |
CCTTCFCTCCTTTCCTCT |
| 5 |
AGAGGAAAGG
|
| 6 |
AGAGGAAAGGAG |
| 7 |
AGAGGAAAGGAGN
|
| 8 |
AGAGGAAAGGAGNGAAGG |
| 9 |
AGAGGAAAGGAGGAAGG
|
| 10 |
AGAGGAAAGGAGAAGG |
| 11 |
CCTTTGCTCCTTTCCTCT
|
| 12 |
AGAGGAAAGGAGNAAAGG |
| 13 |
AGAGGAAAGGAGAAAGG
|
| 14 |
AGAGGAAAGGAGAAGG
|
| 15 |
CCTTCGCTACTTTCCTCTCCATTT
|
| 16 |
CCTTCAbCTACTTTCCTCTCCATTT
|
| 17 |
CCTTCUCTACTTTCCTCTCCATTT
|
| 18 |
CCTTCFCTACTTTCCTCTCCATTT |
| 19 |
AGAGGAAAGT
|
| 20 |
AGAGGAAAGTAG |
| 21 |
AGAGGAAAGTAGNGAAGG
|
| 22 |
AGAGGAAAGTAGGAAGG |
| 23 |
AGAGGAAAGTAGAAGG |
|
Analysis of Oligodeoxynucleotides Containing Abasic
Sites
The stability of the natural abasic site was determined as
follows. An Ab-modified 18-mer (1.0 µg) was cleaved immediately at
the position of the lesion following incubation with 1 N
NaOH (pH 13.0). In contrast, only 1.8 and 5.0% of Ab-modified 18-mer were degraded in 2 h when incubated at 25 and 37 °C,
respectively, in 100 mM Tris-HCl (pH 8.0). As previously
reported (9), 18-mers containing Re and F were completely stable in 100 mM Tris-HCl (pH 8.0) when incubated at 37° C.
Primer Extension Assay
This reaction was performed as
described in earlier publications from this laboratory (25, 32, 33). An
18-mer (5 -CCTTCXCTCCTTTCCTCT or
5 -CCTTTXCTCCTTTCCTCT) or a 24-mer
(5 -CCTTCXCTACTTTCCTCTCCATTT) template (1.0 pmol) containing
dG or a single Ab, Re, or F at the position designated X was
annealed to 0.5 pmol of a 32P-labeled 10-mer (Sequence 5 or
19) or 12-mer primer (Sequence 6 or 20). Primer extension was carried
out in a buffer (10 µl) containing four dNTPs (100 µM
each) and an unmodified or modified DNA template primed with a
32P-labeled 10-mer or 12-mer. Klenow fragment with
(exo+) or without (exo ) 3 5 exonuclease
activity was incubated at 25 or 30 °C for 1 h in 50 mM Tris-HCl (pH 8.0) containing 8 mM
MgCl2 and 5 mM 2-mercaptoethanol. Primer
extension reactions with pol were conducted at 30 °C in 10 µl
of 50 mM Tris-HCl (pH 8.0) containing 10 mM
MgCl2, 20 mM ammonium sulfate, 2 mM
dithiothreitol, and 0.5 µg/µl bovine serum albumin using a modified
template (0.2 pmol) annealed to a 32P-labeled 12-mer primer
(0.1 pmol). Reaction mixtures were subjected to analysis by two-phase
20% polyacrylamide gel electrophoresis (35 × 42 × 0.04 cm
or 15 × 72 × 0.04 cm) with 7 M urea present in
the upper phase and no urea in the lower phase (25). Following gel
electrophoresis, positions of the oligomers were established by
autoradiography. Radioactivity was measured in a Packard scintillation counter. The detection limit for reaction products was 0.03% of the
starting primer.
Kinetics of Nucleotide Insertion and Chain
Extension
Kinetic parameters related to nucleotide insertion and
chain extension were determined under conditions similar to those
described for the primer extension assay (32, 33). Reaction mixtures containing varying amounts (0.001-0.05 units) of exo+ or
exo Klenow fragment were incubated at 30 °C for
1.0-5.0 min in 10 µl of Tris-HCl (pH 8.0) containing 1.0 pmol of
template DNA (5 -CCTTCXCTCCTTTCCTCT, X = dG,
Ab, Re, or F) primed with 0.5 pmol of 32P-labeled 12-mer
(5 -AGAGGAAAGGAG) to measure nucleotide insertion kinetics or with a
32P-labeled 13-mer (5 -AGAGGAAAGGAGN, N = C, A, G, or
T) to measure chain extension kinetics as described by Mendelman
et al. (26, 27). Base insertion was measured in reactions
using 0.005 units of exo+ Klenow fragment for 60 s
(C:G), 0.05 units for 90 s (A:Ab, A:Re, and A:F), 0.05 units for 3 min (G:Ab, G:Re, and G:F), and 0.05 units for 5 min for other pairs and
0.001 units of exo Klenow fragment for 60 s (C:G),
0.01 units for 90 s (A:Ab, A:Re, and A:F), and 0.05 units for
90 s (A:G, G:G, G:Ab, G:Re, and G:F). Kinetics of extension were
measured in reactions using 0.005 units of exo+ Klenow
fragment for 60 s (C:G) and 0.05 units for 5 min for other pairs
and 0.001 units of exo Klenow fragment for 60 s
(C:G), 0.05 units for 3 min (G:G), and 0.05 units for 5 min for other
pairs. Using a 32P-labeled DNA duplex
(5 -CTGCTTTCCTCT/GAGGAAAGGAGA), the frequency of dNTP incorporation at
the blunt end of the duplex was measured in reactions using 0.05 units
of exo+ Klenow fragment for 5 min. Samples were heated for
3 min at 95 °C in the presence of formamide and then applied to a
20% polyacrylamide gel (35 × 42 × 0.04 cm) in the presence
of 7 M urea. Following gel electrophoresis, bands were
located by autoradiography and quantified as described above. Values
for the Michaelis-Menten constant (Km) and the
maximum velocity of the reaction (Vmax) were
obtained from Hanes-Woolf plots. The ratio of primer-template to enzyme
(0.05 units) is at least 20:1; similar values were reported by Boosalis
et al. (34). Less than 20% of the primer is extended under
the steady-state conditions used in our studies (35). All data reported
represent an average of two to four independent experiments.
Frequencies of nucleotide insertion (Fins) and
chain extension (Fext) were determined relative
to dC:dG according to equations derived by Mendelman et al.
(26, 27), where F = (Vmax/Km)wrong pair/(Vmax/Km)right pair=dC:dG, with "wrong pair" defined as a mismatch or any pair involving Ab,
Re, or F.
RESULTS
Primer Extension Reactions Catalyzed by the exo and
exo+ Klenow Fragments
The structures of the natural
and synthetic abasic sites used in these experiments are shown in Fig.
1. Primer extension reactions, catalyzed by the
exo Klenow fragment of DNA polymerase I, were conducted
in the presence of four dNTPs. The expected reaction products,
represented by a mixture of 32P-labeled
oligodeoxynucleotides containing dC, dA, dG, dT, and 1- or 2-base
deletions (25), were completely resolved by two-phase 20%
polyacrylamide gel electrophoresis (72 cm), as shown in Fig. 2 (lanes 1 and 5).
Fig. 2.
Nucleotide incorporation opposite lesions in
reactions catalyzed by the exo Klenow fragment.
Using a 24-mer template (5 -CCTTCXCTACTTTCCTCTCCATTT, X = dG (lane 2), Ab (lane 3), or
F (lane 4)) primed with a 32P-labeled 10-mer
(Sequence 19), primer extension reactions were conducted for 15 min at
25 °C using 0.01 units of exo Klenow fragment for the
unmodified template and 0.4 units of enzyme for the modified templates
as described under "Experimental Procedures." One-third of the
reaction mixture was subjected to two-phase polyacrylamide gel
electrophoresis (15 × 72 × 0.04 cm). Mobilities of reaction
products were compared with those of oligodeoxynucleotide standards
(Stn.) containing dC, dA, dG, or dT opposite the lesion and
1-base ( 1) or 2-base ( 2) deletions
opposite the lesion (Sequences 21-23 in Table I) (lanes 1 and 5).
[View Larger Version of this Image (84K GIF file)]
DNA synthesis on an unmodified template (Fig. 2, lane 2) led
to the expected incorporation of dCMP (85.2% of the starting primer)
opposite dG at position 13 with no deletions. When an Ab-modified
oligodeoxynucleotide was used as template (lane 3), dAMP
(35.5%) was preferentially incorporated opposite the lesion; 2-base
deletions (7.1%) were also formed. Similar results were obtained using
an F-modified template (lane 4). In contrast, following 15 min of primer extension on an 18-mer template containing Re, the amount
of fully extended product containing a 2-base deletion (32.5%)
exceeded dAMP incorporation opposite the lesion (15.6%) and 1-base
deletions (0.61%) (Table II). The amount of these
products increased over time (Table II) and was dependent on the amount of enzyme used in the reaction (data not shown). Incorporation of dGMP
and dTMP opposite abasic sites was not detected. In the presence of
excess enzyme, blunt end extension was observed (slowly migrating bands
in lanes 3 and 4).
Table II.
Time course of primer extension in reactions catalyzed by the
exo Klenow fragment on templates containing abasic sites
Using an 18-mer template (A, 5 -CCTTCXCTCC-; B,
5 -CCTTTXCTCC-; X = dG or abasic
site) primed with a 32P-labeled 10-mer, primer extension
reactions were carried out at 25 °C using 0.01 units of
exo Klenow fragment for the template containing dG and 0.4 units for that containing abasic sites as described under
"Experimental Procedures." dC, dA, 1, and 2
represent the amount of the fully extended product containing dC, dA,
and 1- and 2-base deletions opposite the lesion produced from the
starting primer, respectively. The values in parentheses represent the
relative ratio of product observed at 15 and 60 min to those at 3 min.
Using an 18-mer template (A, 5 -CCTTCXCTCC-; B,
5 -CCTTTXCTCC-; X = dG or abasic
site) primed with a 32P-labeled 10-mer, primer extension
reactions were carried out at 25 °C using 0.01 units of
exo Klenow fragment for the template containing dG and 0.4 units for that containing abasic sites as described under
"Experimental Procedures." dC, dA, 1, and 2
represent the amount of the fully extended product containing dC, dA,
and 1- and 2-base deletions opposite the lesion produced from the
starting primer, respectively. The values in parentheses represent the
relative ratio of product observed at 15 and 60 min to those at 3 min.
|
| Lesion |
Time |
dC |
dA |
1 |
2
|
|
|
min |
% |
% |
% |
% |
| Template A
|
| dG |
3 |
83.4 ± 1.2 |
NDa |
ND |
ND
|
| Ab |
3 |
ND |
21.7
± 3.1 (1.0) |
0.29 ± 0.04 (1.0) |
2.4
± 0.6 (1.0) |
|
15 |
ND |
37.8 ± 1.4 (1.7) |
0.89
± 0.04 (3.1) |
10.4 ± 0.6 (4.4) |
|
60 |
ND |
48.1
± 1.4 (2.2) |
1.53 ± 0.15 (5.3) |
21.1 ± 1.0 (9.0)
|
| Re |
3 |
ND |
6.8 ± 0.4 (1.0) |
0.31
± 0.06 (1.0) |
6.1 ± 0.4 (1.0) |
|
15 |
ND |
15.6
± 0.1 (2.3) |
0.61 ± 0.01 (2.0) |
32.5 ± 0.9 (5.3)
|
|
60 |
ND |
17.8 ± 0.1 (2.6) |
1.03
± 0.19 (3.3) |
49.1 ± 1.1 (8.0) |
| F |
3 |
ND |
19.4
± 1.5 (1.0) |
0.46 ± 0.06 (1.0) |
3.3 ± 0.1 (1.0)
|
|
15 |
ND |
39.2 ± 0.7 (2.0) |
0.78
± 0.11 (1.7) |
15.0 ± 1.3 (4.5) |
|
60 |
ND |
42.7
± 1.6 (2.6) |
1.43 ± 0.02 (3.1) |
24.8 ± 0.3 (7.5)
|
| Template B |
| dG |
3 |
90.3 ± 2.8 |
ND |
ND |
ND
|
| Ab |
3 |
ND |
10.5 ± 0.3 (1.0) |
2.2
± 0.1 (1.0) |
ND |
|
15 |
ND |
26.7
± 2.1 (2.5) |
8.7 ± 0.1 (3.9) |
ND |
|
60 |
ND |
30.8
± 2.5 (2.9) |
11.9 ± 0.9 (5.5) |
ND |
|
|
a
ND, not detectable.
|
|
The identity of the base incorporated and the position of deletions
produced during translesional synthesis on Ab-modified templates were
confirmed by Maxam-Gilbert sequence analysis (36). The fully extended
reaction products migrating at positions 18 and 16 (Fig. 2, lane
3) represent dAMP incorporation opposite Ab and a 2-base deletion
opposite the lesion, respectively (data not shown). Similar results
were obtained by sequence analysis of fully extended products generated
on Re- or F-modified templates (data not shown).
Frequency of Nucleotide Insertion and Chain Extension
Kinetic
parameters for nucleotide insertion opposite Ab, Re, or F and for chain
extension from the 3 -primer terminus were determined under
steady-state conditions as described previously (37, 38). The
exo+ Klenow fragment lacks 5 3 exonuclease activity,
and the exo Klenow fragment lacks both 5 3 and 3
5 exonuclease activities. As shown in Table III,
the relative insertion frequency (Fins) opposite
the abasic site for the exo+ Klenow fragment followed the
order dAMP > dGMP > dCMP > dTMP. Fins for dAMP incorporation opposite abasic
sites was 23-48 times higher than for dAMP opposite dG and 3-8 times
higher than for dGMP opposite Ab, Re, or F. Fins
for dAMP opposite F was 2 times higher than for dAMP opposite Ab or Re.
Fext could only be detected for the dA:Ab and
dA:F pairs. Fins × Fext,
a parameter used to estimate the overall frequency of translesional
synthesis (39), was 11 times higher for dA:F than for dA:Ab. When
Fins for blunt end extension was measured (40),
dAMP was inserted exclusively at a rate 63-122 times lower than that
for dAMP incorporated opposite Ab, Re, or F.
Using the exo Klenow fragment (Table IV),
Fins for dAMP opposite Ab, Re, or F was 7-15
times higher than for dGMP. Fins for dAMP
opposite Ab was 1.7 times higher than for dAMP opposite Re, but 24%
less than for dAMP opposite F. Fext from
3 -primer termini containing dA:Ab was 3.6 times higher than from
termini containing dA:Re and 31% less than from dA:F. Translesional
synthesis (Fins × Fext)
past dA:Ab was estimated to be 6-fold higher than synthesis past dA:Re
and 2-fold lower than past dA:F.
Effect of the 5 -Flanking Base on Base Substitutions and
Deletions
Primer extension reactions were conducted using a
modified oligodeoxynucleotide (Template B) in which dT is positioned 5 to Ab (Fig. 3). Fully extended products on this template
contained dAMP or a 1-base deletion opposite the lesion; 2-base
deletions were not detected (Fig. 3 and Table II). Upper and lower
bands at position 13 represent incompletely extended products in which dGMP and dAMP have been incorporated opposite the lesion, respectively. The 14-mer and 16-mer bands also represent incompletely extended products.
Fig. 3.
Effect of 5 -neighboring base on the
miscoding frequencies. Using an Ab-modified template containing dT
5 to the lesion (5 -CCTTTXCTCCTTTCCTCT,
X = Ab), primer extension reactions using 0.4 units of
exo Klenow fragment were conducted at 25 °C as
described under "Experimental Procedures." One-third of the
reaction mixture was subjected to 20% polyacrylamide gel
electrophoresis (35 × 42 × 0.04 cm). Lane 5 represents standards (Stn.) containing dA opposite the
lesion and 1-base or 2-base deletions (Sequences 12-14).
[View Larger Version of this Image (77K GIF file)]
Densities of bands in Fig. 3 were quantified and compared in Table II
with values obtained in experiments with oligodeoxynucleotides in which
dC is positioned 5 to Ab (Template A). Using this template, fully
extended products containing 2-base deletions were formed (21%). The
position of the inserted dAMP and 1- and 2-base deletions were
confirmed by Maxam-Gilbert sequence analysis (data not shown).
Primer Extension Reactions Catalyzed by DNA pol
When pol
was used to catalyze primer extension, translesional synthesis past
Ab and F produced 2.1 and 5.2%, respectively, of fully extended
products containing dAMP opposite the lesion and 0.4 and 1.2%,
respectively, of 2-base deletions (Fig. 4A, lanes 1 and 3). In contrast, primer extension on
the Re-modified template was blocked opposite and 1 base before the
lesion (lane 2). The amount of dAMP incorporation and 2-base
deletions generated on Ab- and F-modified templates increased over time
(Fig. 4B). After longer incubation, blunt end addition
reactions were observed (Fig. 4B, lanes 3-5 and
7-9; and Fig. 5, lanes 2-5).
Using two-phase gel electrophoresis (Fig. 5), 1-base (1.1%) and 2-base
(2.9%) deletions were observed opposite Ab (lane 3) and
1-base (1.9%) and 2-base (4.2%) deletions opposite F (lane
5). dGMP, dTMP, and dCMP were not incorporated opposite either
lesion.
Fig. 4.
Nucleotide incorporation opposite lesions in
reactions catalyzed by pol . Using the modified 18-mer
templates (Sequences 2-4) primed with a 32P-labeled 12-mer
(Sequence 6), primer extension reactions were conducted at 30 °C for
1 h using 1.2 units of pol (A) and at 30 °C
using 2.4 units of pol (B) as described under
"Experimental Procedures." Lane 4 in A and
lane 1 in B represent a mixture of oligodeoxynucleotide standards (Stn.) containing dA and dC
opposite the lesion and 1- and 2-base deletions (Sequences
8-10).
[View Larger Version of this Image (54K GIF file)]
Fig. 5.
Miscoding properties induced by the natural
and furan abasic sites. Using the Ab- and F-modified 24-mer
templates primed with a 32P-labeled 12-mer (Sequence 18),
primer extension reactions were carried out at 30 °C for 1 h
using 1.2 or 2.4 units of pol as described under "Experimental
Procedures." Lanes 1 and 6 represent the
standard (Stn.) oligodeoxynucleotides containing dA, dC, dG, and dT opposite the lesion and 1- and 2-base deletions (Sequences 21-23) as described in the legend to Fig. 2.
[View Larger Version of this Image (84K GIF file)]
DISCUSSION
Miscoding Properties of Natural and Synthetic Abasic
Sites
In this study, the mutagenic potential of Ab, a reduced
form of this lesion (deoxyribitol), and an isosteric synthetic analog of deoxyribose (tetrahydrofuran) have been directly compared using an
experimental system (25) that permits us to distinguish and quantify
all possible base substitutions and 1- and 2-base deletions in
vitro. When the exo Klenow fragment of DNA pol I was
used to catalyze primer extension in the presence of four dNTPs, all
three types of abasic sites promoted dAMP incorporation, 2-base
deletions, and a small number of 1-base deletions. Templates containing
Ab or F predominantly incorporated dAMP opposite the lesion, whereas
templates containing Re promoted formation of 2-base deletions.
In aqueous solution, Ab exists as an equilibrium mixture of tautomers
consisting primarily of the - and -anomers of
2 -deoxyribofuranose, accompanied by a small amount of the partially
hydrated (open chain) aldehyde form. F is a structural analog of the
cyclic hemiacetal form of Ab, whereas Re is an analog of the open chain
aldehyde form. All three lesions permit translesional synthesis and
promote formation of deletions; however, Ab and F promote translesional synthesis more effectively than Re, suggesting that the open chain form
of Ab is a more strongly blocking lesion. Primer extension assays were
conducted in Tris-HCl (pH 8.0) at 25 or 30 °C for 1 h; kinetic
experiments were carried out in the same buffer at 30 °C maximally
for 3 min. We estimate that <1% of the Ab-modified template was
cleaved by -elimination in 1 h under these conditions. Thus,
template degradation does not affect significantly the kinetic parameters reported in this study for the natural abasic site.
When the exo+ Klenow fragment was used to catalyze DNA
synthesis, chain extension was blocked opposite and 1 base before Ab, F, and Re (data not shown). Fins followed the
order dAMP > dGMP dTMP and dCMP, and
Fins × Fext for dA:Ab or
dA:F was much higher than for dA:Re or dA:dG, in keeping with the
observation that the major product of translesional synthesis contains
dA opposite the lesion (A rule). The relative values for these
parameters are similar to those found with exo , but the
efficiency of translesional synthesis was 2-3 orders of magnitude
lower for exo+ than for exo . Thus, the 3 5 exonuclease function of DNA pol I acts to reduce the extent of
translational synthesis at abasic sites. Similarly, when polymerase
III*, the replicative polymerase of E. coli, was used in a
similar primer extension assay, chain extension was blocked 1 base
before the abasic site, suggesting that the 3 5 exonuclease
function of this enzyme can efficiently remove a dNMP inserted opposite
the lesion.2
The values reported for Fins and
Fext with exo+ could be potentially
affected by the 3 5 proofreading activity of this enzyme (40).
However, differences in the relative efficiency (Vmax/Km) of exo+
for proofreading excision of dAMP and other nucleosides positioned opposite F at the 3 -primer terminus are at most 1.7-fold (41). Thus,
although absolute values for Fext may be
underestimated, relative values and conclusions drawn from the
experiment with exo+ remain unchanged.
Under certain conditions, DNA polymerases perform nucleotide addition
at the blunt end of duplex DNA (42). The frequency of base addition at
this non-templated position was estimated; only dAMP addition was
detected. This observation argues that preferential incorporation of
dAMP is an intrinsic property of DNA polymerase (16).
Fins for the addition reaction was ~2 orders of magnitude lower than comparable values for dAMP insertion opposite abasic sites.
Mechanism for Deletions Induced by Abasic Sites
1- and 2-base
deletions opposite abasic sites were detected when
5 -CCTCXC- was used in the template for primer
extension. Based on studies with dG-C8-acetylaminofluorene (37) and
dG-N2-tetrahydrobenzo[a]pyrene
(33), we have proposed a model involving template misalignment to
account for such deletions. This model predicts that if extension of a
newly inserted dNMP is significantly delayed, the newly inserted dNMP
at the 3 -primer terminus will preferentially form a Watson-Crick pair
with a template base positioned 5 to the lesion (37).
In experiments with the exo Klenow fragment, primer
extension through the 5 -CCTCXC sequence was
partially blocked opposite the abasic site (Fig. 3).
Fins for nucleotides opposite the lesion followed the order dAMP > dGMP > dCMP and dTMP. Thus, when
dGMP is inserted opposite the abasic site, the inserted nucleotide can
pair with dC 5 to the lesion to form a 1-base deletion, as shown in
Fig. 6A. Alternatively, dAMP and the
5 -flanking dG in the primer could pair with TC 5 to the lesion to
form a 2-base deletion. Experimentally, both products were observed.
Our kinetic data indicate that Re is a more effective blocking lesion
than Ab or F, and as predicted for the deletion-prone sequence used in
this study, Re was more effective in promoting 2-base deletions than
were ring-closed forms of the abasic site.
Fig. 6.
Proposed mechanism for 1- and 2-base
deletions. See "Discussion" for description of mechanisms
A and B.
[View Larger Version of this Image (10K GIF file)]
When the base 5 to Ab in the template was changed from dC to dT, the
frequency of 1-base deletions increased (Table II). As was shown, dAMP
is inserted more frequently than dGMP opposite the lesion, and 1-base
deletions are generated by preferential pairing between dA and dT 5 to
the lesion (Fig. 6B). This result is consistent with the
general mechanism for frameshift deletions proposed to occur in the
presence of other blocking lesions (37).
dAMP incorporation increased slightly over time; however, the number of
1- and 2-base deletions increased sharply after 15 min (Table II). This
delay may reflect the time required for the template to undergo a
conformational change. Thus, as proposed in our model (37), kinetics of
misalignment influence the relative number of base substitutions and
deletions formed during translesional synthesis.
Miscoding Properties of Abasic Sites in Reactions Catalyzed by pol
The frequency of nucleotide insertion opposite synthetic
abasic sites and of chain extension from the 3 -primer terminus has been established for pol (26, 27). A nearest neighbor effect was
detected on insertion fidelity (26). The present study is the first
report using a mammalian DNA polymerase and a natural abasic site in
which misincorporation of dNMPs and other events have been determined
site-specifically in vitro. pol promoted incorporation
of dAMP opposite Ab and F and generated 1- and 2-base deletions; lesser
amounts of fully extended products were produced on templates
containing Ab than on those containing F. In contrast, primer extension
on an Re-modified template was blocked opposite and 1 base before the
lesion. The efficiency of translesional synthesis past Re was lower
than that on templates containing F. Thus, the miscoding properties of
pol and exo in vitro with respect to Ab
and F are very similar. When pol , another mammalian replicative
enzyme, was used in an analogous primer extension assay, preferential
incorporation of dAMP opposite F also was detected (43).
We have conducted site-specific mutagenesis studies on a number of DNA
adducts and lesions in which nucleotide misincorporation, determined by
primer extension analysis and steady-state kinetics, was compared in
the same sequence context with mutational specificity, determined in
plasmids replicating in bacteria and mammalian cells (44, 45). In each
case, the dNMP preferentially incorporated by replicative prokaryotic
or eukaryotic DNA polymerases in vitro was reflected in the
mutational spectrum of the lesion as observed in cells. The miscoding
properties of the natural abasic site, established in vitro
with pol and pol , predict dAMP incorporation at abasic sites in
mammalian cells, an event that promotes G T transversions,
predominated in a site-specific mutagenesis study of the
tetrahydrofuran moiety in simian kidney (COS) cells (21), but not in a
similar study of natural abasic sites (20). It is conceivable that the
intrinsic structural difference between Ab and F manifests itself in
simian kidney cells, but not in E. coli; however, this
interpretation is not supported by the in vitro studies
reported here. The apparent discrepancy should be tested by
side-by-side comparison of the miscoding potential of the two lesions
in mammalian cells.
Conclusions
We conclude from these experiments that the
miscoding properties of natural abasic sites are similar, if not
identical, to those of the tetrahydrofuran analog. Analogs of the
ring-opened form of the natural abasic site (deoxyribitol) tend to
block translesional synthesis and to promote deletions, whereas
predominantly cyclic structures (Ab and F) promote synthesis past the
lesion. The preferred order of nucleotide insertion (dAMP > dGMP > dCTP > dTMP) is similar for both DNA polymerases
studied. dAMP, positioned opposite Ab or F at the 3 -primer terminus,
is more readily extended than other nucleotides. These kinetic studies
are consistent with our observation that dAMP is preferentially
incorporated into DNA by the Klenow fragment of pol I and by pol .
Blunt end addition of dAMP, observed in primer extension assays
catalyzed by the exo Klenow fragment, supports the idea
that the A rule reflects an intrinsic property of this and possibly
other DNA polymerases.
FOOTNOTES
*
This work was supported in part by Grants CA17395 and
ES04068 from the National Institutes of Health.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.: 516-444-3080;
Fax: 516-444-7641.
1
The abbreviations used are: Ab, natural
apurinic/apyridiminic (abasic) site; F, tetrahydrofuran; Re, reduced
form of the natural abasic site (deoxyribitol); pol, DNA polymerase;
HPLC, high performance liquid chromatography.
2
S. Shibutani, M. Takeshita, and A. P. Grollman,
unpublished data.
ACKNOWLEDGEMENTS
We thank Robert Rieger for synthesizing the
oligodeoxynucleotides used in this study and Susan Rigby for preparing
the manuscript.
REFERENCES
-
Lindahl, T., and Nyberg, B.
(1972)
Biochemistry
11,
3610-3618
[CrossRef][Medline]
[Order article via Infotrieve]
-
Loeb, L. A., and Preston, B. D.
(1986)
Annu. Rev. Genet.
20,
201-230
[CrossRef][Medline]
[Order article via Infotrieve]
-
Lindahl, T.
(1982)
Annu. Rev. Biochem.
51,
61-87
[CrossRef][Medline]
[Order article via Infotrieve]
-
Weiss, B., and Grossman, L.
(1987)
Adv. Enzymol. Relat. Areas Mol. Biol.
60,
1-34
[Medline]
[Order article via Infotrieve]
-
Jones, A. S., Mian, A. M., and Walker, R. T. (1968) J. Chem. Soc.
(C) 2042-2044
-
Sagher, D., and Strauss, B.
(1983)
Biochemistry
22,
4518-4526
[CrossRef][Medline]
[Order article via Infotrieve]
-
Sagher, D., and Strauss, B.
(1985)
Nucleic Acids Res.
13,
4285-4298
[Abstract/Free Full Text]
-
Randall, S. K., Eritja, R., Kaplan, B. E., Petruska, J., and Goodman, M. F.
(1987)
J. Biol. Chem.
262,
6864-6870
[Abstract/Free Full Text]
-
Takeshita, M., Chang, C.-N., Johnson, F., Will, S., and Grollman, A. P.
(1987)
J. Biol. Chem.
262,
10171-10179
[Abstract/Free Full Text]
-
Millican, T. A., Mock, G. A., Chauncey, M. A., Patel, T. P., Eaton, M. A. W., Gunning, J., Cutbush, S. D., Neidele, S., and Mann, J.
(1984)
Nucleic Acids Res.
12,
7435-7453
[Abstract/Free Full Text]
-
Hevronoi, D., and Livneh, Z.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
5046-5050
[Abstract/Free Full Text]
-
Kunkel, T. A., Schaaper, R. M., and Loeb, L. A.
(1983)
Biochemistry
22,
2378-2384
[CrossRef][Medline]
[Order article via Infotrieve]
-
Schaaper, R. M., Kunkel, T. A., and Loeb, L. A.
(1983)
Proc. Natl. Acad. Sci. U. S. A.
80,
487-491
[Abstract/Free Full Text]
-
Kunkel, T. A.
(1984)
Proc. Natl. Acad. Sci. U. S. A.
81,
1494-1498
[Abstract/Free Full Text]
-
Lawrence, C. W., Borden, A., Banerjee, S. K., and LeClerc, J. E.
(1990)
Nucleic Acids Res.
18,
2153-2157
[Abstract/Free Full Text]
-
Strauss, B.
(1991)
Bioassays
13,
79-84
[CrossRef][Medline]
[Order article via Infotrieve]
-
Gentil, A., Renault, G., Madzak, C., Margot, A., Cabral-Neto, J. B., Vasseur, J. J., Rayner, B., and Sarasin, A.
(1990)
Biochem. Biophys. Res. Commun.
173,
704-710
[CrossRef][Medline]
[Order article via Infotrieve]
-
Gentil, A., Cabral-Neto, J. B., Mariage-Samson, R., Margot, A., Imbach, J. L., Rayner, B., and Sarasin, A.
(1992)
J. Mol. Biol.
227,
981-984
[CrossRef][Medline]
[Order article via Infotrieve]
-
Cabral Neto, J. B., Gentil, A., Cabral, R. E. C., and Sarasin, A.
(1992)
J. Biol. Chem.
267,
19718-19723
[Abstract/Free Full Text]
-
Cabral Neto, J. B., Cabral, R. E. C., Margot, A., Le Page, F., Sarasin, A., and Gentil, A.
(1994)
J. Mol. Biol.
240,
416-420
[CrossRef][Medline]
[Order article via Infotrieve]
-
Takeshita, M., and Eisenberg, W.
(1994)
Nucleic Acids Res.
22,
1897-1902
[Abstract/Free Full Text]
-
Klinedinst, D. K., and Drinkwater, N. R.
(1992)
Mol. Carcinog.
6,
32-42
[Medline]
[Order article via Infotrieve]
-
Kunz, B. A., Henson, E. S., Roche, H., Ramotar, D., Nunoshiba, T., and Demple, B.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
8165-8169
[Abstract/Free Full Text]
-
Gibbs, P. E., and Lawrence, C. W.
(1995)
J. Mol. Biol.
251,
229-236
[CrossRef][Medline]
[Order article via Infotrieve]
-
Shibutani, S.
(1993)
Chem. Res. Toxicol.
6,
625-629
[CrossRef][Medline]
[Order article via Infotrieve]
-
Mendelman, L. V., Boosalis, M. S., Petruska, J., and Goodman, M. F.
(1989)
J. Biol. Chem.
264,
14415-14423
[Abstract/Free Full Text]
-
Mendelman, L. V., Petruska, J., and Goodman, M. F.
(1990)
J. Biol. Chem.
265,
2338-2346
[Abstract/Free Full Text]
-
Bailly, V., Verly, W. G., O'Connor, T., and Laval, J.
(1989)
Biochem. J.
262,
681-689
[Medline]
[Order article via Infotrieve]
-
Shibutani, S., Gentles, R., Johnson, F., and Grollman, A. P.
(1991)
Carcinogenesis
12,
813-818
[Abstract/Free Full Text]
-
Pierre, J., and Laval, J.
(1981)
J. Biol. Chem.
256,
10217-10220
[Abstract/Free Full Text]
-
Maniatis, F., Fritsch, E. F., and Sambrook, J.
(1972)
Molecular Cloning: A Laboratory Manual, pp. 122-123, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
-
Shibutani, S., Takeshita, M., and Grollman, A. P.
(1991)
Nature
349,
431-434
[CrossRef][Medline]
[Order article via Infotrieve]
-
Shibutani, S., Margulis, L. M., Geacintov, N. E., and Grollman, A. P.
(1993)
Biochemistry
32,
7531-7541
[CrossRef][Medline]
[Order article via Infotrieve]
-
Boosalis, M. S., Petruska, J., and Goodman, M. F.
(1987)
J. Biol. Chem.
262,
14689-14696
[Abstract/Free Full Text]
-
Creighton, S., Huang, M.-M., Cai, H., Arnheim, N., and Goodman, M. F.
(1992)
J. Biol. Chem.
267,
2633-2639
[Abstract/Free Full Text]
-
Maxam, A. M., and Gilbert, W.
(1980)
Methods in Enzymol.
65,
499-560
[Medline]
[Order article via Infotrieve]
-
Shibutani, S., and Grollman, A. P.
(1993)
J. Biol. Chem.
268,
11703-11710
[Abstract/Free Full Text]
-
Shibutani, S., Bodepudi, V., Johnson, F., and Grollman, A. P.
(1993)
Biochemistry
32,
4615-4621
[CrossRef][Medline]
[Order article via Infotrieve]
-
Dosanjh, M. K., Galeros, G., Goodman, M. F., and Singer, B.
(1991)
Biochemistry
30,
11595-11599
[CrossRef][Medline]
[Order article via Infotrieve]
-
Creighton, S., and Goodman, M. F.
(1995)
J. Biol. Chem.
270,
4759-4774
[Abstract/Free Full Text]
-
Ide, H., Murayama, H., Sakamoto, S., Makino, K., Honda, K., Nakamuta, H., Sasaki, M., and Sugimoto, N.
(1995)
Nucleic Acids Res.
23,
123-129
[Abstract/Free Full Text]
-
Clark, J. M., Joyce, C. M., and Beardsley, G. P.
(1987)
J. Mol. Biol.
198,
123-127
[CrossRef][Medline]
[Order article via Infotrieve]
-
Mozzherin, D. J., Shibutani, S., Tan, C.-K., Downey, K. M., and Fisher,
P. A. (1997) Proc. Natl. Acad. Sci. U. S. A., in press
-
Moriya, M.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
1122-1126
[Abstract/Free Full Text]
-
Moriya, M., Zhang, W., Johnson, F., and Grollman, A. P.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
11899-11903
[Abstract/Free Full Text]
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
G. Maga, B. van Loon, E. Crespan, G. Villani, and U. Hubscher
The Block of DNA Polymerase {delta} Strand Displacement Activity by an Abasic Site Can Be Rescued by the Concerted Action of DNA Polymerase {beta} and Flap Endonuclease 1
J. Biol. Chem.,
May 22, 2009;
284(21):
14267 - 14275.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. F. Mugal, H.-H. von Grunberg, and M. Peifer
Transcription-Induced Mutational Strand Bias and Its Effect on Substitution Rates in Human Genes
Mol. Biol. Evol.,
January 1, 2009;
26(1):
131 - 142.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Fang and J.-S. Taylor
Serial analysis of mutation spectra (SAMS): a new approach for the determination of mutation spectra of site-specific DNA damage and their sequence dependence
Nucleic Acids Res.,
October 1, 2008;
36(18):
6004 - 6012.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Pages, R. E. Johnson, L. Prakash, and S. Prakash
Mutational specificity and genetic control of replicative bypass of an abasic site in yeast
PNAS,
January 29, 2008;
105(4):
1170 - 1175.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Brotherton, P. Endicott, J. J. Sanchez, M. Beaumont, R. Barnett, J. Austin, and A. Cooper
Novel high-resolution characterization of ancient DNA reveals C > U-type base modification events as the sole cause of post mortem miscoding lesions
Nucleic Acids Res.,
September 27, 2007;
35(17):
5717 - 5728.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kaneda, J. Sekiguchi, and T. Shida
Role of the tryptophan residue in the vicinity of the catalytic center of exonuclease III family AP endonucleases: AP site recognition mechanism
Nucleic Acids Res.,
March 15, 2006;
34(5):
1552 - 1563.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Hogg, W. Cooper, L. Reha-Krantz, and S. S. Wallace
Kinetics of error generation in homologous B-family DNA polymerases.
Nucleic Acids Res.,
January 1, 2006;
34(9):
2528 - 2535.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Simonelli, L. Narciso, E. Dogliotti, and P. Fortini
Base excision repair intermediates are mutagenic in mammalian cells
Nucleic Acids Res.,
August 2, 2005;
33(14):
4404 - 4411.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Zang, T. M. Harris, and F. P. Guengerich
Kinetics of Nucleotide Incorporation Opposite DNA Bulky Guanine N2 Adducts by Processive Bacteriophage T7 DNA Polymerase (Exonuclease-) and HIV-1 Reverse Transcriptase
J. Biol. Chem.,
January 14, 2005;
280(2):
1165 - 1178.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. M. Kroeger, M. F. Goodman, and M. M. Greenberg
A comprehensive comparison of DNA replication past 2-deoxyribose and its tetrahydrofuran analog in Escherichia coli
Nucleic Acids Res.,
October 11, 2004;
32(18):
5480 - 5485.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Faure, J.-F. Constant, P. Dumy, and M. Saparbaev
2'-Deoxyribonolactone lesion produces G->A transitions in Escherichia coli
Nucleic Acids Res.,
May 24, 2004;
32(9):
2937 - 2946.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Le Chatelier, O. J. Becherel, E. d'Alencon, D. Canceill, S. D. Ehrlich, R. P. P. Fuchs, and L. Janniere
Involvement of DnaE, the Second Replicative DNA Polymerase from Bacillus subtilis, in DNA Mutagenesis
J. Biol. Chem.,
January 16, 2004;
279(3):
1757 - 1767.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. J. Kokoska, S. D. McCulloch, and T. A. Kunkel
The Efficiency and Specificity of Apurinic/Apyrimidinic Site Bypass by Human DNA Polymerase {eta} and Sulfolobus solfataricus Dpo4
J. Biol. Chem.,
December 12, 2003;
278(50):
50537 - 50545.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Maor-Shoshani, V. Ben-Ari, and Z. Livneh
Lesion bypass DNA polymerases replicate across non-DNA segments
PNAS,
December 9, 2003;
100(25):
14760 - 14765.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Kamiya
Mutagenic potentials of damaged nucleic acids produced by reactive oxygen/nitrogen species: approaches using synthetic oligonucleotides and nucleotides: SURVEY AND SUMMARY
Nucleic Acids Res.,
January 15, 2003;
31(2):
517 - 531.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Otsuka, S. Sanadai, Y. Hata, H. Okuto, V. N. Noskov, D. Loakes, and K. Negishi
Difference between deoxyribose- and tetrahydrofuran-type abasic sites in the in vivo mutagenic responses in yeast
Nucleic Acids Res.,
December 1, 2002;
30(23):
5129 - 5135.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Berthet, Y. Roupioz, J.-F. Constant, M. Kotera, and J. Lhomme
Translesional synthesis on DNA templates containing the 2'-deoxyribonolactone lesion
Nucleic Acids Res.,
July 1, 2001;
29(13):
2725 - 2732.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Yasui, S. Matsui, M. Ihara, Y. R. S. Laxmi, S. Shibutani, and T. Matsuda
Translesional synthesis on a DNA template containing N2-methyl-2'-deoxyguanosine catalyzed by the Klenow fragment of Escherichia coli DNA polymerase I
Nucleic Acids Res.,
May 1, 2001;
29(9):
1994 - 2001.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. L. Sheppard, P. Ordoukhanian, and G. F. Joyce
A DNA enzyme with N-glycosylase activity
PNAS,
July 5, 2000;
97(14):
7802 - 7807.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Ohashi, T. Ogi, R. Kusumoto, S. Iwai, C. Masutani, F. Hanaoka, and H. Ohmori
Error-prone bypass of certain DNA lesions by the human DNA polymerase kappa
Genes & Dev.,
July 1, 2000;
14(13):
1589 - 1594.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
V. Duarte, D. Gasparutto, M. Jaquinod, and J. Cadet
In vitro DNA synthesis opposite oxazolone and repair of this DNA damage using modified oligonucleotides
Nucleic Acids Res.,
April 1, 2000;
28(7):
1555 - 1563.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|