Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shibutani, S.
Right arrow Articles by Grollman, A. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shibutani, S.
Right arrow Articles by Grollman, A. P.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


Volume 272, Number 21, Issue of May 23, 1997 pp. 13916-13922
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Translesional Synthesis on DNA Templates Containing a Single Abasic Site
A MECHANISTIC STUDY OF THE "A RULE"*

(Received for publication, August 7, 1996, and in revised form, January 19, 1997)

Shinya Shibutani Dagger , Masaru Takeshita and Arthur P. Grollman

From the Department of Pharmacological Sciences, State University of New York, Stony Brook, New York 11794-8651

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

Site-specifically modified oligodeoxynucleotides containing a single natural abasic site or a chemically synthesized (tetrahydrofuran or deoxyribitol) model abasic site were used as templates for primer extension reactions catalyzed by the Klenow fragment of Escherichia coli DNA polymerase I or by calf thymus DNA polymerase alpha . Analysis of the fully extended products of these reactions indicated that both polymerases preferentially incorporate dAMP opposite the natural abasic site and tetrahydrofuran, while DNA templates containing the ring-opened deoxyribitol moiety block translesional synthesis, promoting sequence context-dependent deletions. The frequency of nucleotide insertion opposite the three types of abasic sites follows the order dAMP > dGMP > dCMP > dTMP. The frequency of chain extension was highest when dAMP was positioned opposite a natural abasic site. The frequency of translesional synthesis past abasic sites follows the order tetrahydrofuran > deoxyribose > deoxyribitol. The Klenow fragment promotes blunt end addition of dAMP; this reaction was much less efficient than insertion of dAMP opposite an abasic site. We conclude that the miscoding potential of a natural abasic site in vitro closely resembles that of its tetrahydrofuran analog. Ring-opened abasic sites favor deletions. Studies with polymerase alpha  in vitro predict preferential incorporation of dAMP at abasic sites in mammalian cells.


INTRODUCTION

Abasic sites in DNA arise spontaneously by hydrolysis, a process that can be accelerated by modification of purine bases (1) and by the catalytic action of N-glycosylases that remove damaged bases from DNA (2-4). The natural abasic site (Ab)1 exists as an equilibrium mixture of the cyclic hemiacetal and open chain aldehyde forms of 2'-deoxyribose (see Fig. 1) and is subject to beta -elimination. This chemical reaction leads to strand scission (5); for that reason, structural analogs of deoxyribose have often been used to explore biological properties of abasic sites in DNA (6-10). Abasic site analogs include deoxyribitol, a model for the open chain form of the sugar (6, 7), and tetrahydrofuran, an isosteric and isoelectronic analog of deoxyribose (8, 9) that is cleaved by type II AP endonucleases, but is not subject to beta -elimination (9).


Fig. 1. Structures of abasic sites used in this study.
[View Larger Version of this Image (7K GIF file)]

The miscoding properties of natural and synthetic abasic sites have been investigated under a variety of experimental conditions using randomly or site-specifically modified DNA (6, 7, 11-15). The relative frequency of base incorporation opposite abasic sites and of chain extension from the 3'-primer terminus has also been reported (8, 9). While natural and synthetic abasic sites are structurally similar, their mutagenic potential has not been compared under the same experimental conditions.

In Escherichia coli, synthesis past abasic sites in vitro (6-9, 11-13) and in vivo (14, 15) is accompanied by preferential incorporation of dAMP opposite the lesion, a phenomenon known as the "A rule" (16). In eukaryotes, the presence of abasic sites in DNA is associated with different mutational spectra. For example, dAMP, dCMP, and dTMP were inserted at similar frequencies opposite a natural abasic site when a plasmid vector containing this lesion was allowed to replicate in simian kidney (COS) cells (17-20). In another study in COS cells, preferential incorporation of dAMP was observed opposite the tetrahydrofuran moiety, accompanied by a small number of deletions (21). In human lymphoblastoid cells, dGMP was incorporated preferentially opposite natural abasic sites (22). In AP endonuclease-deficient strains of yeast, the frequency of A:T right-arrow C:G events increased (23); in another yeast system, dCMP was predominantly incorporated opposite the lesion (24). In this report, we used a prokaryotic and a eukaryotic DNA polymerase and DNA templates containing a single abasic site to explore the mechanistic basis underlying mutagenesis at abasic sites in DNA.

Recently, one of us (S. S.) developed a method by which site-specifically modified oligodeoxynucleotides could be used to quantify all base substitutions and deletions occurring during DNA synthesis in vitro (25). Combined with steady-state kinetic analysis (26, 27), this experimental system is used to compare the miscoding properties of a natural abasic site and its analogs in reactions catalyzed by the Klenow fragment of E. coli DNA polymerase I or by calf thymus DNA polymerase alpha . Our results indicate that the natural abasic site resembles closely the tetrahydrofuran moiety with respect to its miscoding properties. These lesions, which exist primarily or exclusively in a ring-closed conformation, preferentially incorporate dAMP opposite the lesion. In contrast, deoxyribitol, which serves as a model for the open chain (minor) form of the natural abasic site, blocks DNA synthesis and promotes the sequence-dependent formation of 1- and 2-base deletions. In vitro, both pol alpha  and the Klenow fragment operate according to the tenets of the A rule.


EXPERIMENTAL PROCEDURES

Materials

Organic chemicals used for the synthesis of oligodeoxynucleotides were supplied by Aldrich. [gamma -32P]ATP (specific activity > 6000 Ci/mmol) was obtained from Amersham Corp. Cloned exo+ (17,400 units/mg) and exo- (21,200 units/mg) Klenow fragments of E. coli polymerase I (1 unit of enzyme catalyzes the incorporation of 1 nmol of total nucleotide into acid-insoluble form in 60 min at 37 °C) and uracil-DNA glycosylase (1 unit/µl) were purchased from U. S. Biochemical Corp. Intact DNA pol I and dNTPs were from Pharmacia; calf thymus DNA pol alpha  (30,000 units/mg) (1 unit of enzyme catalyzes the incorporation of 10 nmol of nucleotide acid-insoluble material in 30 min at 37 °C using poly(dA-dT) as template primer) was from Molecular Biology Resources, Inc.; T4 polynucleotide kinase was from Stratagene; and venom phosphodiesterase I was from Sigma. Acetonitrile, triethylamine, and distilled water, all HPLC-grade, were purchased from Fisher. A Waters 990 HPLC instrument, equipped with a photodiode array detector, was used to separate and analyze modified and unmodified oligodeoxynucleotides.

Synthesis and Purification of Oligodeoxynucleotides

Oligodeoxynucleotides were synthesized by solid-state methods using an automated DNA synthesizer. Templates containing a single unmodified dG or tetrahydrofuran (F) residue at position 13 (Sequences 1, 4, 11, and 18 in Table I) were synthesized as described previously (9). Templates (18-mers) containing a single natural abasic site (Ab) were prepared by incubating 5 µg of an unmodified oligomer containing a single dG (sequence 1 or 11) dissolved in 100 µl of 30 mM HCl at 37 °C for 16 h (28). The reaction mixture was evaporated to dryness in a vacuum desiccator and subjected to HPLC. The 18-mer containing an Ab site (tR = 20.4 min) was separated from the parent oligomer (tR = 22.1) on a reverse-phase µBondapak C18 column (0.38 × 30 cm; Waters) using a linear gradient of 0.05 M triethylammonium acetate (pH 7.0) containing 10-20% acetonitrile, an elution time of 60 min, and a flow rate of 1.0 ml/min (29). Eluate containing the Ab-modified 18-mer was concentrated using a Centricon-3 filter (Amicon, Inc.). The filter was rinsed three times with 1 ml of distilled water at 4 °C. Reduction of the natural Ab site was conducted at room temperature. NaBH4 (0.35 M) dissolved in 0.5 M phosphate buffer was added in three portions over 90 min (30). Reaction mixtures were concentrated with a Centricon-3 filter and then subjected to HPLC. Oligomers containing the reduced form of the natural abasic site (Re) were isolated as described above. An Ab-modified 24-mer template (Sequence 16) was prepared using uracil-DNA glycosylase. Six µg of a uracil-modified 24-mer (Sequence 17) were incubated for 2 h at 37 °C with 10 units of uracil glycosylase in a reaction containing 70 mM Hepes, 50 mM EDTA, and 1 mM dithiothreitol (pH 7.4). The Ab-modified 24-mer (tR = 22.1 min) was resolved from the parent uracil-modified 24-mer (tR = 23.3) on a reverse-phase µBondapak C18 column (0.78 × 30 cm; Waters) using a linear gradient of 0.05 M triethylammonium acetate (pH 7.0) containing 10-20% acetonitrile, an elution time of 60 min, and flow rate of 2.0 ml/min. Oligodeoxynucleotides were further purified by electrophoresis on 20% polyacrylamide gel in the presence of M urea and labeled at the 5'-terminus by treatment with bacteriophage T4 polynucleotide kinase in the presence of [gamma -32P]ATP (31). To establish homogeneity, samples were subjected to 20% polyacrylamide gels (15 × 72 × 0.04 cm) containing 7 M urea. The position of oligomers on the gel was established by autoradiography using Kodak X-Omat XAR film.

Table I. Sequence of oligodeoxynucleotides

Shown are the sequences of templates, primers, and standard markers. N = C, A, G, or T.  Shown are the sequences of templates, primers, and standard markers. N = C, A, G, or T. 

No. Sequence

1 CCTTCGCTCCTTTCCTCT
2 CCTTCAbCTCCTTTCCTCT
3 CCTTCReCTCCTTTCCTCT
4 CCTTCFCTCCTTTCCTCT
5 AGAGGAAAGG
6 AGAGGAAAGGAG
7 AGAGGAAAGGAGN
8 AGAGGAAAGGAGNGAAGG
9 AGAGGAAAGGAGGAAGG
10 AGAGGAAAGGAGAAGG
11 CCTTTGCTCCTTTCCTCT
12 AGAGGAAAGGAGNAAAGG
13 AGAGGAAAGGAGAAAGG
14 AGAGGAAAGGAGAAGG
15 CCTTCGCTACTTTCCTCTCCATTT
16 CCTTCAbCTACTTTCCTCTCCATTT
17 CCTTCUCTACTTTCCTCTCCATTT
18 CCTTCFCTACTTTCCTCTCCATTT
19 AGAGGAAAGT
20 AGAGGAAAGTAG
21 AGAGGAAAGTAGNGAAGG
22 AGAGGAAAGTAGGAAGG
23 AGAGGAAAGTAGAAGG

Analysis of Oligodeoxynucleotides Containing Abasic Sites

The stability of the natural abasic site was determined as follows. An Ab-modified 18-mer (1.0 µg) was cleaved immediately at the position of the lesion following incubation with 1 N NaOH (pH 13.0). In contrast, only 1.8 and 5.0% of Ab-modified 18-mer were degraded in 2 h when incubated at 25 and 37 °C, respectively, in 100 mM Tris-HCl (pH 8.0). As previously reported (9), 18-mers containing Re and F were completely stable in 100 mM Tris-HCl (pH 8.0) when incubated at 37° C.

Primer Extension Assay

This reaction was performed as described in earlier publications from this laboratory (25, 32, 33). An 18-mer (5'-CCTTCXCTCCTTTCCTCT or 5'-CCTTTXCTCCTTTCCTCT) or a 24-mer (5'-CCTTCXCTACTTTCCTCTCCATTT) template (1.0 pmol) containing dG or a single Ab, Re, or F at the position designated X was annealed to 0.5 pmol of a 32P-labeled 10-mer (Sequence 5 or 19) or 12-mer primer (Sequence 6 or 20). Primer extension was carried out in a buffer (10 µl) containing four dNTPs (100 µM each) and an unmodified or modified DNA template primed with a 32P-labeled 10-mer or 12-mer. Klenow fragment with (exo+) or without (exo-) 3' right-arrow 5' exonuclease activity was incubated at 25 or 30 °C for 1 h in 50 mM Tris-HCl (pH 8.0) containing 8 mM MgCl2 and 5 mM 2-mercaptoethanol. Primer extension reactions with pol alpha  were conducted at 30 °C in 10 µl of 50 mM Tris-HCl (pH 8.0) containing 10 mM MgCl2, 20 mM ammonium sulfate, 2 mM dithiothreitol, and 0.5 µg/µl bovine serum albumin using a modified template (0.2 pmol) annealed to a 32P-labeled 12-mer primer (0.1 pmol). Reaction mixtures were subjected to analysis by two-phase 20% polyacrylamide gel electrophoresis (35 × 42 × 0.04 cm or 15 × 72 × 0.04 cm) with 7 M urea present in the upper phase and no urea in the lower phase (25). Following gel electrophoresis, positions of the oligomers were established by autoradiography. Radioactivity was measured in a Packard scintillation counter. The detection limit for reaction products was 0.03% of the starting primer.

Kinetics of Nucleotide Insertion and Chain Extension

Kinetic parameters related to nucleotide insertion and chain extension were determined under conditions similar to those described for the primer extension assay (32, 33). Reaction mixtures containing varying amounts (0.001-0.05 units) of exo+ or exo- Klenow fragment were incubated at 30 °C for 1.0-5.0 min in 10 µl of Tris-HCl (pH 8.0) containing 1.0 pmol of template DNA (5'-CCTTCXCTCCTTTCCTCT, X = dG, Ab, Re, or F) primed with 0.5 pmol of 32P-labeled 12-mer (5'-AGAGGAAAGGAG) to measure nucleotide insertion kinetics or with a 32P-labeled 13-mer (5'-AGAGGAAAGGAGN, N = C, A, G, or T) to measure chain extension kinetics as described by Mendelman et al. (26, 27). Base insertion was measured in reactions using 0.005 units of exo+ Klenow fragment for 60 s (C:G), 0.05 units for 90 s (A:Ab, A:Re, and A:F), 0.05 units for 3 min (G:Ab, G:Re, and G:F), and 0.05 units for 5 min for other pairs and 0.001 units of exo- Klenow fragment for 60 s (C:G), 0.01 units for 90 s (A:Ab, A:Re, and A:F), and 0.05 units for 90 s (A:G, G:G, G:Ab, G:Re, and G:F). Kinetics of extension were measured in reactions using 0.005 units of exo+ Klenow fragment for 60 s (C:G) and 0.05 units for 5 min for other pairs and 0.001 units of exo- Klenow fragment for 60 s (C:G), 0.05 units for 3 min (G:G), and 0.05 units for 5 min for other pairs. Using a 32P-labeled DNA duplex (5'-CTGCTTTCCTCT/GAGGAAAGGAGA), the frequency of dNTP incorporation at the blunt end of the duplex was measured in reactions using 0.05 units of exo+ Klenow fragment for 5 min. Samples were heated for 3 min at 95 °C in the presence of formamide and then applied to a 20% polyacrylamide gel (35 × 42 × 0.04 cm) in the presence of 7 M urea. Following gel electrophoresis, bands were located by autoradiography and quantified as described above. Values for the Michaelis-Menten constant (Km) and the maximum velocity of the reaction (Vmax) were obtained from Hanes-Woolf plots. The ratio of primer-template to enzyme (0.05 units) is at least 20:1; similar values were reported by Boosalis et al. (34). Less than 20% of the primer is extended under the steady-state conditions used in our studies (35). All data reported represent an average of two to four independent experiments. Frequencies of nucleotide insertion (Fins) and chain extension (Fext) were determined relative to dC:dG according to equations derived by Mendelman et al. (26, 27), where F = (Vmax/Km)wrong pair/(Vmax/Km)right pair=dC:dG, with "wrong pair" defined as a mismatch or any pair involving Ab, Re, or F.


RESULTS

Primer Extension Reactions Catalyzed by the exo- and exo+ Klenow Fragments

The structures of the natural and synthetic abasic sites used in these experiments are shown in Fig. 1. Primer extension reactions, catalyzed by the exo- Klenow fragment of DNA polymerase I, were conducted in the presence of four dNTPs. The expected reaction products, represented by a mixture of 32P-labeled oligodeoxynucleotides containing dC, dA, dG, dT, and 1- or 2-base deletions (25), were completely resolved by two-phase 20% polyacrylamide gel electrophoresis (72 cm), as shown in Fig. 2 (lanes 1 and 5).


Fig. 2. Nucleotide incorporation opposite lesions in reactions catalyzed by the exo- Klenow fragment. Using a 24-mer template (5'-CCTTCXCTACTTTCCTCTCCATTT, X = dG (lane 2), Ab (lane 3), or F (lane 4)) primed with a 32P-labeled 10-mer (Sequence 19), primer extension reactions were conducted for 15 min at 25 °C using 0.01 units of exo- Klenow fragment for the unmodified template and 0.4 units of enzyme for the modified templates as described under "Experimental Procedures." One-third of the reaction mixture was subjected to two-phase polyacrylamide gel electrophoresis (15 × 72 × 0.04 cm). Mobilities of reaction products were compared with those of oligodeoxynucleotide standards (Stn.) containing dC, dA, dG, or dT opposite the lesion and 1-base (Delta 1) or 2-base (Delta 2) deletions opposite the lesion (Sequences 21-23 in Table I) (lanes 1 and 5).
[View Larger Version of this Image (84K GIF file)]

DNA synthesis on an unmodified template (Fig. 2, lane 2) led to the expected incorporation of dCMP (85.2% of the starting primer) opposite dG at position 13 with no deletions. When an Ab-modified oligodeoxynucleotide was used as template (lane 3), dAMP (35.5%) was preferentially incorporated opposite the lesion; 2-base deletions (7.1%) were also formed. Similar results were obtained using an F-modified template (lane 4). In contrast, following 15 min of primer extension on an 18-mer template containing Re, the amount of fully extended product containing a 2-base deletion (32.5%) exceeded dAMP incorporation opposite the lesion (15.6%) and 1-base deletions (0.61%) (Table II). The amount of these products increased over time (Table II) and was dependent on the amount of enzyme used in the reaction (data not shown). Incorporation of dGMP and dTMP opposite abasic sites was not detected. In the presence of excess enzyme, blunt end extension was observed (slowly migrating bands in lanes 3 and 4).

Table II. Time course of primer extension in reactions catalyzed by the exo- Klenow fragment on templates containing abasic sites

Using an 18-mer template (A, 5'-CCTTCXCTCC-; B, 5'-CCTTTXCTCC-; X = dG or abasic site) primed with a 32P-labeled 10-mer, primer extension reactions were carried out at 25 °C using 0.01 units of exo- Klenow fragment for the template containing dG and 0.4 units for that containing abasic sites as described under "Experimental Procedures." dC, dA, Delta 1, and Delta 2 represent the amount of the fully extended product containing dC, dA, and 1- and 2-base deletions opposite the lesion produced from the starting primer, respectively. The values in parentheses represent the relative ratio of product observed at 15 and 60 min to those at 3 min. Using an 18-mer template (A, 5'-CCTTCXCTCC-; B, 5'-CCTTTXCTCC-; X = dG or abasic site) primed with a 32P-labeled 10-mer, primer extension reactions were carried out at 25 °C using 0.01 units of exo- Klenow fragment for the template containing dG and 0.4 units for that containing abasic sites as described under "Experimental Procedures." dC, dA, Delta 1, and Delta 2 represent the amount of the fully extended product containing dC, dA, and 1- and 2-base deletions opposite the lesion produced from the starting primer, respectively. The values in parentheses represent the relative ratio of product observed at 15 and 60 min to those at 3 min.

Lesion Time dC dA  Delta 1  Delta 2

min % % % %
Template A
  dG 3 83.4 ± 1.2 NDa ND ND
  Ab 3 ND 21.7  ± 3.1 (1.0) 0.29  ± 0.04 (1.0) 2.4  ± 0.6 (1.0)
15 ND 37.8  ± 1.4 (1.7) 0.89  ± 0.04 (3.1) 10.4  ± 0.6 (4.4)
60 ND 48.1  ± 1.4 (2.2) 1.53  ± 0.15 (5.3) 21.1  ± 1.0 (9.0)
  Re 3 ND 6.8  ± 0.4 (1.0) 0.31  ± 0.06 (1.0) 6.1  ± 0.4 (1.0)
15 ND 15.6  ± 0.1 (2.3) 0.61  ± 0.01 (2.0) 32.5  ± 0.9 (5.3)
60 ND 17.8  ± 0.1 (2.6) 1.03  ± 0.19 (3.3) 49.1  ± 1.1 (8.0)
  F 3 ND 19.4  ± 1.5 (1.0) 0.46  ± 0.06 (1.0) 3.3  ± 0.1 (1.0)
15 ND 39.2  ± 0.7 (2.0) 0.78  ± 0.11 (1.7) 15.0  ± 1.3 (4.5)
60 ND 42.7  ± 1.6 (2.6) 1.43  ± 0.02 (3.1) 24.8  ± 0.3 (7.5)
Template B
  dG 3 90.3 ± 2.8 ND ND ND
  Ab 3 ND 10.5  ± 0.3 (1.0) 2.2  ± 0.1 (1.0) ND
15 ND 26.7  ± 2.1 (2.5) 8.7  ± 0.1 (3.9) ND
60 ND 30.8  ± 2.5 (2.9) 11.9  ± 0.9 (5.5) ND

a ND, not detectable.

The identity of the base incorporated and the position of deletions produced during translesional synthesis on Ab-modified templates were confirmed by Maxam-Gilbert sequence analysis (36). The fully extended reaction products migrating at positions 18 and 16 (Fig. 2, lane 3) represent dAMP incorporation opposite Ab and a 2-base deletion opposite the lesion, respectively (data not shown). Similar results were obtained by sequence analysis of fully extended products generated on Re- or F-modified templates (data not shown).

Frequency of Nucleotide Insertion and Chain Extension

Kinetic parameters for nucleotide insertion opposite Ab, Re, or F and for chain extension from the 3'-primer terminus were determined under steady-state conditions as described previously (37, 38). The exo+ Klenow fragment lacks 5' right-arrow 3' exonuclease activity, and the exo- Klenow fragment lacks both 5' right-arrow 3' and 3' right-arrow 5' exonuclease activities. As shown in Table III, the relative insertion frequency (Fins) opposite the abasic site for the exo+ Klenow fragment followed the order dAMP > dGMP > dCMP > dTMP. Fins for dAMP incorporation opposite abasic sites was 23-48 times higher than for dAMP opposite dG and 3-8 times higher than for dGMP opposite Ab, Re, or F. Fins for dAMP opposite F was 2 times higher than for dAMP opposite Ab or Re. Fext could only be detected for the dA:Ab and dA:F pairs. Fins × Fext, a parameter used to estimate the overall frequency of translesional synthesis (39), was 11 times higher for dA:F than for dA:Ab. When Fins for blunt end extension was measured (40), dAMP was inserted exclusively at a rate 63-122 times lower than that for dAMP incorporated opposite Ab, Re, or F. 

Table III. Kinetic parameters for nucleotide insertion and chain extension reaction catalyzed by the exo+ Klenow fragment of DNA polymerase I

Kinetics of insertion and extension reactions were determined as described under "Experimental Procedures." Frequencies of nucleotide insertion (Fins) and chain extension (Fext) were estimated by the following equation: F = (Vmax/Km)wrong: pair/(Vmax/Km)right: pair=dC:dG. X = unmodified or modified lesion; B = blunt end position. Kinetics of insertion and extension reactions were determined as described under "Experimental Procedures." Frequencies of nucleotide insertion (Fins) and chain extension (Fext) were estimated by the following equation: F = (Vmax/Km)wrong: pair/(Vmax/Km)right: pair=dC:dG. X = unmodified or modified lesion; B = blunt end position.

N:X Km Vmax Fins Km Vmax Fext Fins × Fext

µM % min-1 µM % min-1
C:G 1.65  ± 1.2 105.8  ± 20.6 1.0 3.34  ± 0.09 202  ± 9.2 1.0 1.0
C:Ab 43.0  ± 2.6 0.18  ± 0.01 5.13  × 10-5 NDa
C:Re 67.9  ± 7.4 0.16  ± 0.01 2.84  × 10-5 ND
C:F 24.1  ± 8.2 0.35  ± 0.11 2.05  × 10-4 ND
C:B ND
A:G 89.0  ± 37.3 0.82  ± 0.18 1.31  × 10-4 21.5  ± 9.6 0.10  ± 0.01 9.16  × 10-5 1.20  × 10-8
A:Ab 44.9  ± 6.9 11.6  ± 0.51 3.21  × 10-3 25.6  ± 0.4 3.23  ± 0.51 × 10-3 2.10  × 10-6 6.74  × 10-9
A:Re 45.3  ± 4.3 10.9  ± 0.07 2.97  × 10-3 ND
A:F 38.6  ± 8.0 19.3  ± 0.84 6.30  × 10-3 39.5  ± 6.6 2.97  ± 0.88 × 10-2 1.22  × 10-5 7.69  × 10-8
A:B 68.7  ± 6.7 0.29  ± 0.01 5.13  × 10-5
G:G 25.1  ± 1.7 3.10  ± 0.42 1.53  × 10-3 8.64  ± 2.78 0.74  ± 0.02 1.42  × 10-3 2.17  × 10-6
G:Ab 58.0  ± 10.5 5.27  ± 0.80 1.12  × 10-3 ND
G:Re 33.9  ± 1.2 0.99  ± 0.04 3.61  × 10-4 ND
G:F 70.6  ± 15.4 6.95  ± 0.07 1.25  × 10-3 50.6  ± 23.8 2.95  ± 2.23 × 10-2 8.91  × 10-6 1.11  × 10-8
G:B ND
T:G 58.0  ± 0.0 1.97  ± 0.03 4.13  × 10-4 13.0  ± 0.07 13.2  ± 0.07 1.68  × 10-2 6.94  × 10-6
T:Ab 23.0  ± 3.3 0.14  ± 0.04 7.60  × 10-5 47.4  ± 39.6 1.62  ± 1.19 × 10-2 1.14  × 10-5 8.66  × 10-10
T:Re ND 26.8  ± 4.88 3.17  ± 0.44 × 10-2 1.96  × 10-5
T:F 86.1  ± 30.6 0.32  ± 0.01 4.94  × 10-5 57.6  ± 5.09 2.16  ± 0.11 × 10-2 6.20  × 10-6 3.06  × 10-10
T:B ND

a ND, not detectable.

Using the exo- Klenow fragment (Table IV), Fins for dAMP opposite Ab, Re, or F was 7-15 times higher than for dGMP. Fins for dAMP opposite Ab was 1.7 times higher than for dAMP opposite Re, but 24% less than for dAMP opposite F. Fext from 3'-primer termini containing dA:Ab was 3.6 times higher than from termini containing dA:Re and 31% less than from dA:F. Translesional synthesis (Fins × Fext) past dA:Ab was estimated to be 6-fold higher than synthesis past dA:Re and 2-fold lower than past dA:F.

Table IV. Kinetic parameters for nucleotide insertion and chain extension reaction catalyzed by the exo- Klenow fragment of DNA polymerase I

The frequency of base insertion and chain extension was determined as described under "Experimental Procedures." Also, see the legend to Table II. The frequency of base insertion and chain extension was determined as described under "Experimental Procedures." Also, see the legend to Table II.

N:X Km Vmax Fins Km Vmax Fext Fins × Fext

µM % min-1 µM % min-1
C:G 2.25  ± 0.94 25.8  ± 0.8 1.0 5.17  ± 0.26 96.1  ± 1.27 1.0 1.0
A:G 67.4  ± 10.7 0.62  ± 0.01 8.02  × 10-4 19.9  ± 2.0 7.67  ± 0.49 × 10-2 2.07  × 10-4 1.66  × 10-7
A:Ab 39.6  ± 7.1 9.12  ± 0.73 2.01  × 10-2 26.4  ± 6.6 3.77  ± 0.21 × 10-2 7.68  × 10-5 1.54  × 10-6
A:Re 33.3  ± 0.1 4.52  ± 0.21 1.18  × 10-2 29.4  ± 7.7 1.18  ± 0.05 × 10-2 2.15  × 10-5 2.55  × 10-7
A:F 35.6  ± 4.9 11.1  ± 0.18 2.72  × 10-2 21.8  ± 4.9 4.72  ± 0.30 × 10-2 1.16  × 10-4 3.16  × 10-6
G:G 32.2  ± 2.8 1.09  ± 0.02 2.95  × 10-3 20.6  ± 0.8 4.98  ± 0.04 × 10-1 1.30  × 10-3 3.84  × 10-6
G:Ab 45.7  ± 2.0 1.47  ± 0.07 2.81  × 10-3 23.9  ± 1.3 5.98  ± 1.05 × 10-3 1.35  × 10-5 3.79  × 10-8
G:Re 38.0  ± 2.8 0.35  ± 0.01 8.03  × 10-4 27.6  ± 0.1 2.53  ± 0.08 × 10-2 4.94  × 10-5 3.97  × 10-8
G:F 65.3  ± 2.9 1.47  ± 0.04 1.96  × 10-3 25.1  ± 5.0 8.62  ± 1.36 × 10-3 1.85  × 10-5 3.63  × 10-8

Effect of the 5'-Flanking Base on Base Substitutions and Deletions

Primer extension reactions were conducted using a modified oligodeoxynucleotide (Template B) in which dT is positioned 5' to Ab (Fig. 3). Fully extended products on this template contained dAMP or a 1-base deletion opposite the lesion; 2-base deletions were not detected (Fig. 3 and Table II). Upper and lower bands at position 13 represent incompletely extended products in which dGMP and dAMP have been incorporated opposite the lesion, respectively. The 14-mer and 16-mer bands also represent incompletely extended products.


Fig. 3. Effect of 5'-neighboring base on the miscoding frequencies. Using an Ab-modified template containing dT 5' to the lesion (5'-CCTTTXCTCCTTTCCTCT, X = Ab), primer extension reactions using 0.4 units of exo- Klenow fragment were conducted at 25 °C as described under "Experimental Procedures." One-third of the reaction mixture was subjected to 20% polyacrylamide gel electrophoresis (35 × 42 × 0.04 cm). Lane 5 represents standards (Stn.) containing dA opposite the lesion and 1-base or 2-base deletions (Sequences 12-14).
[View Larger Version of this Image (77K GIF file)]

Densities of bands in Fig. 3 were quantified and compared in Table II with values obtained in experiments with oligodeoxynucleotides in which dC is positioned 5' to Ab (Template A). Using this template, fully extended products containing 2-base deletions were formed (21%). The position of the inserted dAMP and 1- and 2-base deletions were confirmed by Maxam-Gilbert sequence analysis (data not shown).

Primer Extension Reactions Catalyzed by DNA pol alpha

When pol alpha  was used to catalyze primer extension, translesional synthesis past Ab and F produced 2.1 and 5.2%, respectively, of fully extended products containing dAMP opposite the lesion and 0.4 and 1.2%, respectively, of 2-base deletions (Fig. 4A, lanes 1 and 3). In contrast, primer extension on the Re-modified template was blocked opposite and 1 base before the lesion (lane 2). The amount of dAMP incorporation and 2-base deletions generated on Ab- and F-modified templates increased over time (Fig. 4B). After longer incubation, blunt end addition reactions were observed (Fig. 4B, lanes 3-5 and 7-9; and Fig. 5, lanes 2-5). Using two-phase gel electrophoresis (Fig. 5), 1-base (1.1%) and 2-base (2.9%) deletions were observed opposite Ab (lane 3) and 1-base (1.9%) and 2-base (4.2%) deletions opposite F (lane 5). dGMP, dTMP, and dCMP were not incorporated opposite either lesion.


Fig. 4. Nucleotide incorporation opposite lesions in reactions catalyzed by pol alpha . Using the modified 18-mer templates (Sequences 2-4) primed with a 32P-labeled 12-mer (Sequence 6), primer extension reactions were conducted at 30 °C for 1 h using 1.2 units of pol alpha  (A) and at 30 °C using 2.4 units of pol alpha  (B) as described under "Experimental Procedures." Lane 4 in A and lane 1 in B represent a mixture of oligodeoxynucleotide standards (Stn.) containing dA and dC opposite the lesion and 1- and 2-base deletions (Sequences 8-10).
[View Larger Version of this Image (54K GIF file)]


Fig. 5. Miscoding properties induced by the natural and furan abasic sites. Using the Ab- and F-modified 24-mer templates primed with a 32P-labeled 12-mer (Sequence 18), primer extension reactions were carried out at 30 °C for 1 h using 1.2 or 2.4 units of pol alpha  as described under "Experimental Procedures." Lanes 1 and 6 represent the standard (Stn.) oligodeoxynucleotides containing dA, dC, dG, and dT opposite the lesion and 1- and 2-base deletions (Sequences 21-23) as described in the legend to Fig. 2.
[View Larger Version of this Image (84K GIF file)]


DISCUSSION

Miscoding Properties of Natural and Synthetic Abasic Sites

In this study, the mutagenic potential of Ab, a reduced form of this lesion (deoxyribitol), and an isosteric synthetic analog of deoxyribose (tetrahydrofuran) have been directly compared using an experimental system (25) that permits us to distinguish and quantify all possible base substitutions and 1- and 2-base deletions in vitro. When the exo- Klenow fragment of DNA pol I was used to catalyze primer extension in the presence of four dNTPs, all three types of abasic sites promoted dAMP incorporation, 2-base deletions, and a small number of 1-base deletions. Templates containing Ab or F predominantly incorporated dAMP opposite the lesion, whereas templates containing Re promoted formation of 2-base deletions.

In aqueous solution, Ab exists as an equilibrium mixture of tautomers consisting primarily of the alpha - and beta -anomers of 2'-deoxyribofuranose, accompanied by a small amount of the partially hydrated (open chain) aldehyde form. F is a structural analog of the cyclic hemiacetal form of Ab, whereas Re is an analog of the open chain aldehyde form. All three lesions permit translesional synthesis and promote formation of deletions; however, Ab and F promote translesional synthesis more effectively than Re, suggesting that the open chain form of Ab is a more strongly blocking lesion. Primer extension assays were conducted in Tris-HCl (pH 8.0) at 25 or 30 °C for 1 h; kinetic experiments were carried out in the same buffer at 30 °C maximally for 3 min. We estimate that <1% of the Ab-modified template was cleaved by beta -elimination in 1 h under these conditions. Thus, template degradation does not affect significantly the kinetic parameters reported in this study for the natural abasic site.

When the exo+ Klenow fragment was used to catalyze DNA synthesis, chain extension was blocked opposite and 1 base before Ab, F, and Re (data not shown). Fins followed the order dAMP > dGMP >>  dTMP and dCMP, and Fins × Fext for dA:Ab or dA:F was much higher than for dA:Re or dA:dG, in keeping with the observation that the major product of translesional synthesis contains dA opposite the lesion (A rule). The relative values for these parameters are similar to those found with exo-, but the efficiency of translesional synthesis was 2-3 orders of magnitude lower for exo+ than for exo-. Thus, the 3' right-arrow 5' exonuclease function of DNA pol I acts to reduce the extent of translational synthesis at abasic sites. Similarly, when polymerase III*, the replicative polymerase of E. coli, was used in a similar primer extension assay, chain extension was blocked 1 base before the abasic site, suggesting that the 3' right-arrow 5' exonuclease function of this enzyme can efficiently remove a dNMP inserted opposite the lesion.2

The values reported for Fins and Fext with exo+ could be potentially affected by the 3' right-arrow 5' proofreading activity of this enzyme (40). However, differences in the relative efficiency (Vmax/Km) of exo+ for proofreading excision of dAMP and other nucleosides positioned opposite F at the 3'-primer terminus are at most 1.7-fold (41). Thus, although absolute values for Fext may be underestimated, relative values and conclusions drawn from the experiment with exo+ remain unchanged.

Under certain conditions, DNA polymerases perform nucleotide addition at the blunt end of duplex DNA (42). The frequency of base addition at this non-templated position was estimated; only dAMP addition was detected. This observation argues that preferential incorporation of dAMP is an intrinsic property of DNA polymerase (16). Fins for the addition reaction was ~2 orders of magnitude lower than comparable values for dAMP insertion opposite abasic sites.

Mechanism for Deletions Induced by Abasic Sites

1- and 2-base deletions opposite abasic sites were detected when 5'-CCTCXC- was used in the template for primer extension. Based on studies with dG-C8-acetylaminofluorene (37) and dG-N2-tetrahydrobenzo[a]pyrene (33), we have proposed a model involving template misalignment to account for such deletions. This model predicts that if extension of a newly inserted dNMP is significantly delayed, the newly inserted dNMP at the 3'-primer terminus will preferentially form a Watson-Crick pair with a template base positioned 5' to the lesion (37).

In experiments with the exo- Klenow fragment, primer extension through the 5'-CCTCXC sequence was partially blocked opposite the abasic site (Fig. 3). Fins for nucleotides opposite the lesion followed the order dAMP > dGMP > dCMP and dTMP. Thus, when dGMP is inserted opposite the abasic site, the inserted nucleotide can pair with dC 5' to the lesion to form a 1-base deletion, as shown in Fig. 6A. Alternatively, dAMP and the 5'-flanking dG in the primer could pair with TC 5' to the lesion to form a 2-base deletion. Experimentally, both products were observed. Our kinetic data indicate that Re is a more effective blocking lesion than Ab or F, and as predicted for the deletion-prone sequence used in this study, Re was more effective in promoting 2-base deletions than were ring-closed forms of the abasic site.


Fig. 6. Proposed mechanism for 1- and 2-base deletions. See "Discussion" for description of mechanisms A and B.
[View Larger Version of this Image (10K GIF file)]

When the base 5' to Ab in the template was changed from dC to dT, the frequency of 1-base deletions increased (Table II). As was shown, dAMP is inserted more frequently than dGMP opposite the lesion, and 1-base deletions are generated by preferential pairing between dA and dT 5' to the lesion (Fig. 6B). This result is consistent with the general mechanism for frameshift deletions proposed to occur in the presence of other blocking lesions (37).

dAMP incorporation increased slightly over time; however, the number of 1- and 2-base deletions increased sharply after 15 min (Table II). This delay may reflect the time required for the template to undergo a conformational change. Thus, as proposed in our model (37), kinetics of misalignment influence the relative number of base substitutions and deletions formed during translesional synthesis.

Miscoding Properties of Abasic Sites in Reactions Catalyzed by pol alpha

The frequency of nucleotide insertion opposite synthetic abasic sites and of chain extension from the 3'-primer terminus has been established for pol alpha  (26, 27). A nearest neighbor effect was detected on insertion fidelity (26). The present study is the first report using a mammalian DNA polymerase and a natural abasic site in which misincorporation of dNMPs and other events have been determined site-specifically in vitro. pol alpha  promoted incorporation of dAMP opposite Ab and F and generated 1- and 2-base deletions; lesser amounts of fully extended products were produced on templates containing Ab than on those containing F. In contrast, primer extension on an Re-modified template was blocked opposite and 1 base before the lesion. The efficiency of translesional synthesis past Re was lower than that on templates containing F. Thus, the miscoding properties of pol alpha  and exo- in vitro with respect to Ab and F are very similar. When pol delta , another mammalian replicative enzyme, was used in an analogous primer extension assay, preferential incorporation of dAMP opposite F also was detected (43).

We have conducted site-specific mutagenesis studies on a number of DNA adducts and lesions in which nucleotide misincorporation, determined by primer extension analysis and steady-state kinetics, was compared in the same sequence context with mutational specificity, determined in plasmids replicating in bacteria and mammalian cells (44, 45). In each case, the dNMP preferentially incorporated by replicative prokaryotic or eukaryotic DNA polymerases in vitro was reflected in the mutational spectrum of the lesion as observed in cells. The miscoding properties of the natural abasic site, established in vitro with pol alpha  and pol delta , predict dAMP incorporation at abasic sites in mammalian cells, an event that promotes G right-arrow T transversions, predominated in a site-specific mutagenesis study of the tetrahydrofuran moiety in simian kidney (COS) cells (21), but not in a similar study of natural abasic sites (20). It is conceivable that the intrinsic structural difference between Ab and F manifests itself in simian kidney cells, but not in E. coli; however, this interpretation is not supported by the in vitro studies reported here. The apparent discrepancy should be tested by side-by-side comparison of the miscoding potential of the two lesions in mammalian cells.

Conclusions

We conclude from these experiments that the miscoding properties of natural abasic sites are similar, if not identical, to those of the tetrahydrofuran analog. Analogs of the ring-opened form of the natural abasic site (deoxyribitol) tend to block translesional synthesis and to promote deletions, whereas predominantly cyclic structures (Ab and F) promote synthesis past the lesion. The preferred order of nucleotide insertion (dAMP > dGMP > dCTP > dTMP) is similar for both DNA polymerases studied. dAMP, positioned opposite Ab or F at the 3'-primer terminus, is more readily extended than other nucleotides. These kinetic studies are consistent with our observation that dAMP is preferentially incorporated into DNA by the Klenow fragment of pol I and by pol alpha . Blunt end addition of dAMP, observed in primer extension assays catalyzed by the exo- Klenow fragment, supports the idea that the A rule reflects an intrinsic property of this and possibly other DNA polymerases.


FOOTNOTES

*   This work was supported in part by Grants CA17395 and ES04068 from the National Institutes of Health.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Dagger    To whom correspondence should be addressed. Tel.: 516-444-3080; Fax: 516-444-7641.
1   The abbreviations used are: Ab, natural apurinic/apyridiminic (abasic) site; F, tetrahydrofuran; Re, reduced form of the natural abasic site (deoxyribitol); pol, DNA polymerase; HPLC, high performance liquid chromatography.
2   S. Shibutani, M. Takeshita, and A. P. Grollman, unpublished data.

ACKNOWLEDGEMENTS

We thank Robert Rieger for synthesizing the oligodeoxynucleotides used in this study and Susan Rigby for preparing the manuscript.


REFERENCES

  1. Lindahl, T., and Nyberg, B. (1972) Biochemistry 11, 3610-3618 [CrossRef][Medline] [Order article via Infotrieve]
  2. Loeb, L. A., and Preston, B. D. (1986) Annu. Rev. Genet. 20, 201-230 [CrossRef][Medline] [Order article via Infotrieve]
  3. Lindahl, T. (1982) Annu. Rev. Biochem. 51, 61-87 [CrossRef][Medline] [Order article via Infotrieve]
  4. Weiss, B., and Grossman, L. (1987) Adv. Enzymol. Relat. Areas Mol. Biol. 60, 1-34 [Medline] [Order article via Infotrieve]
  5. Jones, A. S., Mian, A. M., and Walker, R. T. (1968) J. Chem. Soc. (C) 2042-2044
  6. Sagher, D., and Strauss, B. (1983) Biochemistry 22, 4518-4526 [CrossRef][Medline] [Order article via Infotrieve]
  7. Sagher, D., and Strauss, B. (1985) Nucleic Acids Res. 13, 4285-4298 [Abstract/Free Full Text]
  8. Randall, S. K., Eritja, R., Kaplan, B. E., Petruska, J., and Goodman, M. F. (1987) J. Biol. Chem. 262, 6864-6870 [Abstract/Free Full Text]
  9. Takeshita, M., Chang, C.-N., Johnson, F., Will, S., and Grollman, A. P. (1987) J. Biol. Chem. 262, 10171-10179 [Abstract/Free Full Text]
  10. Millican, T. A., Mock, G. A., Chauncey, M. A., Patel, T. P., Eaton, M. A. W., Gunning, J., Cutbush, S. D., Neidele, S., and Mann, J. (1984) Nucleic Acids Res. 12, 7435-7453 [Abstract/Free Full Text]
  11. Hevronoi, D., and Livneh, Z. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 5046-5050 [Abstract/Free Full Text]
  12. Kunkel, T. A., Schaaper, R. M., and Loeb, L. A. (1983) Biochemistry 22, 2378-2384 [CrossRef][Medline] [Order article via Infotrieve]
  13. Schaaper, R. M., Kunkel, T. A., and Loeb, L. A. (1983) Proc. Natl. Acad. Sci. U. S. A. 80, 487-491 [Abstract/Free Full Text]
  14. Kunkel, T. A. (1984) Proc. Natl. Acad. Sci. U. S. A. 81, 1494-1498 [Abstract/Free Full Text]
  15. Lawrence, C. W., Borden, A., Banerjee, S. K., and LeClerc, J. E. (1990) Nucleic Acids Res. 18, 2153-2157 [Abstract/Free Full Text]
  16. Strauss, B. (1991) Bioassays 13, 79-84 [CrossRef][Medline] [Order article via Infotrieve]
  17. Gentil, A., Renault, G., Madzak, C., Margot, A., Cabral-Neto, J. B., Vasseur, J. J., Rayner, B., and Sarasin, A. (1990) Biochem. Biophys. Res. Commun. 173, 704-710 [CrossRef][Medline] [Order article via Infotrieve]
  18. Gentil, A., Cabral-Neto, J. B., Mariage-Samson, R., Margot, A., Imbach, J. L., Rayner, B., and Sarasin, A. (1992) J. Mol. Biol. 227, 981-984 [CrossRef][Medline] [Order article via Infotrieve]
  19. Cabral Neto, J. B., Gentil, A., Cabral, R. E. C., and Sarasin, A. (1992) J. Biol. Chem. 267, 19718-19723 [Abstract/Free Full Text]
  20. Cabral Neto, J. B., Cabral, R. E. C., Margot, A., Le Page, F., Sarasin, A., and Gentil, A. (1994) J. Mol. Biol. 240, 416-420 [CrossRef][Medline] [Order article via Infotrieve]
  21. Takeshita, M., and Eisenberg, W. (1994) Nucleic Acids Res. 22, 1897-1902 [Abstract/Free Full Text]
  22. Klinedinst, D. K., and Drinkwater, N. R. (1992) Mol. Carcinog. 6, 32-42 [Medline] [Order article via Infotrieve]
  23. Kunz, B. A., Henson, E. S., Roche, H., Ramotar, D., Nunoshiba, T., and Demple, B. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 8165-8169 [Abstract/Free Full Text]
  24. Gibbs, P. E., and Lawrence, C. W. (1995) J. Mol. Biol. 251, 229-236 [CrossRef][Medline] [Order article via Infotrieve]
  25. Shibutani, S. (1993) Chem. Res. Toxicol. 6, 625-629 [CrossRef][Medline] [Order article via Infotrieve]
  26. Mendelman, L. V., Boosalis, M. S., Petruska, J., and Goodman, M. F. (1989) J. Biol. Chem. 264, 14415-14423 [Abstract/Free Full Text]
  27. Mendelman, L. V., Petruska, J., and Goodman, M. F. (1990) J. Biol. Chem. 265, 2338-2346 [Abstract/Free Full Text]
  28. Bailly, V., Verly, W. G., O'Connor, T., and Laval, J. (1989) Biochem. J. 262, 681-689 [Medline] [Order article via Infotrieve]
  29. Shibutani, S., Gentles, R., Johnson, F., and Grollman, A. P. (1991) Carcinogenesis 12, 813-818 [Abstract/Free Full Text]
  30. Pierre, J., and Laval, J. (1981) J. Biol. Chem. 256, 10217-10220 [Abstract/Free Full Text]
  31. Maniatis, F., Fritsch, E. F., and Sambrook, J. (1972) Molecular Cloning: A Laboratory Manual, pp. 122-123, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  32. Shibutani, S., Takeshita, M., and Grollman, A. P. (1991) Nature 349, 431-434 [CrossRef][Medline] [Order article via Infotrieve]
  33. Shibutani, S., Margulis, L. M., Geacintov, N. E., and Grollman, A. P. (1993) Biochemistry 32, 7531-7541 [CrossRef][Medline] [Order article via Infotrieve]
  34. Boosalis, M. S., Petruska, J., and Goodman, M. F. (1987) J. Biol. Chem. 262, 14689-14696 [Abstract/Free Full Text]
  35. Creighton, S., Huang, M.-M., Cai, H., Arnheim, N., and Goodman, M. F. (1992) J. Biol. Chem. 267, 2633-2639 [Abstract/Free Full Text]
  36. Maxam, A. M., and Gilbert, W. (1980) Methods in Enzymol. 65, 499-560 [Medline] [Order article via Infotrieve]
  37. Shibutani, S., and Grollman, A. P. (1993) J. Biol. Chem. 268, 11703-11710 [Abstract/Free Full Text]
  38. Shibutani, S., Bodepudi, V., Johnson, F., and Grollman, A. P. (1993) Biochemistry 32, 4615-4621 [CrossRef][Medline] [Order article via Infotrieve]
  39. Dosanjh, M. K., Galeros, G., Goodman, M. F., and Singer, B. (1991) Biochemistry 30, 11595-11599 [CrossRef][Medline] [Order article via Infotrieve]
  40. Creighton, S., and Goodman, M. F. (1995) J. Biol. Chem. 270, 4759-4774 [Abstract/Free Full Text]
  41. Ide, H., Murayama, H., Sakamoto, S., Makino, K., Honda, K., Nakamuta, H., Sasaki, M., and Sugimoto, N. (1995) Nucleic Acids Res. 23, 123-129 [Abstract/Free Full Text]
  42. Clark, J. M., Joyce, C. M., and Beardsley, G. P. (1987) J. Mol. Biol. 198, 123-127 [CrossRef][Medline] [Order article via Infotrieve]
  43. Mozzherin, D. J., Shibutani, S., Tan, C.-K., Downey, K. M., and Fisher, P. A. (1997) Proc. Natl. Acad. Sci. U. S. A., in press
  44. Moriya, M. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 1122-1126 [Abstract/Free Full Text]
  45. Moriya, M., Zhang, W., Johnson, F., and Grollman, A. P. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 11899-11903 [Abstract/Free Full Text]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
G. Maga, B. van Loon, E. Crespan, G. Villani, and U. Hubscher
The Block of DNA Polymerase {delta} Strand Displacement Activity by an Abasic Site Can Be Rescued by the Concerted Action of DNA Polymerase {beta} and Flap Endonuclease 1
J. Biol. Chem., May 22, 2009; 284(21): 14267 - 14275.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
C. F. Mugal, H.-H. von Grunberg, and M. Peifer
Transcription-Induced Mutational Strand Bias and Its Effect on Substitution Rates in Human Genes
Mol. Biol. Evol., January 1, 2009; 26(1): 131 - 142.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
H. Fang and J.-S. Taylor
Serial analysis of mutation spectra (SAMS): a new approach for the determination of mutation spectra of site-specific DNA damage and their sequence dependence
Nucleic Acids Res., October 1, 2008; 36(18): 6004 - 6012.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
V. Pages, R. E. Johnson, L. Prakash, and S. Prakash
Mutational specificity and genetic control of replicative bypass of an abasic site in yeast
PNAS, January 29, 2008; 105(4): 1170 - 1175.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
P. Brotherton, P. Endicott, J. J. Sanchez, M. Beaumont, R. Barnett, J. Austin, and A. Cooper
Novel high-resolution characterization of ancient DNA reveals C > U-type base modification events as the sole cause of post mortem miscoding lesions
Nucleic Acids Res., September 27, 2007; 35(17): 5717 - 5728.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
K. Kaneda, J. Sekiguchi, and T. Shida
Role of the tryptophan residue in the vicinity of the catalytic center of exonuclease III family AP endonucleases: AP site recognition mechanism
Nucleic Acids Res., March 15, 2006; 34(5): 1552 - 1563.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. Hogg, W. Cooper, L. Reha-Krantz, and S. S. Wallace
Kinetics of error generation in homologous B-family DNA polymerases.
Nucleic Acids Res., January 1, 2006; 34(9): 2528 - 2535.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
V. Simonelli, L. Narciso, E. Dogliotti, and P. Fortini
Base excision repair intermediates are mutagenic in mammalian cells
Nucleic Acids Res., August 2, 2005; 33(14): 4404 - 4411.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Zang, T. M. Harris, and F. P. Guengerich
Kinetics of Nucleotide Incorporation Opposite DNA Bulky Guanine N2 Adducts by Processive Bacteriophage T7 DNA Polymerase (Exonuclease-) and HIV-1 Reverse Transcriptase
J. Biol. Chem., January 14, 2005; 280(2): 1165 - 1178.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
K. M. Kroeger, M. F. Goodman, and M. M. Greenberg
A comprehensive comparison of DNA replication past 2-deoxyribose and its tetrahydrofuran analog in Escherichia coli
Nucleic Acids Res., October 11, 2004; 32(18): 5480 - 5485.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
V. Faure, J.-F. Constant, P. Dumy, and M. Saparbaev
2'-Deoxyribonolactone lesion produces G->A transitions in Escherichia coli
Nucleic Acids Res., May 24, 2004; 32(9): 2937 - 2946.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Le Chatelier, O. J. Becherel, E. d'Alencon, D. Canceill, S. D. Ehrlich, R. P. P. Fuchs, and L. Janniere
Involvement of DnaE, the Second Replicative DNA Polymerase from Bacillus subtilis, in DNA Mutagenesis
J. Biol. Chem., January 16, 2004; 279(3): 1757 - 1767.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. J. Kokoska, S. D. McCulloch, and T. A. Kunkel
The Efficiency and Specificity of Apurinic/Apyrimidinic Site Bypass by Human DNA Polymerase {eta} and Sulfolobus solfataricus Dpo4
J. Biol. Chem., December 12, 2003; 278(50): 50537 - 50545.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Maor-Shoshani, V. Ben-Ari, and Z. Livneh
Lesion bypass DNA polymerases replicate across non-DNA segments
PNAS, December 9, 2003; 100(25): 14760 - 14765.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
H. Kamiya
Mutagenic potentials of damaged nucleic acids produced by reactive oxygen/nitrogen species: approaches using synthetic oligonucleotides and nucleotides: SURVEY AND SUMMARY
Nucleic Acids Res., January 15, 2003; 31(2): 517 - 531.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
C. Otsuka, S. Sanadai, Y. Hata, H. Okuto, V. N. Noskov, D. Loakes, and K. Negishi
Difference between deoxyribose- and tetrahydrofuran-type abasic sites in the in vivo mutagenic responses in yeast
Nucleic Acids Res., December 1, 2002; 30(23): 5129 - 5135.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
N. Berthet, Y. Roupioz, J.-F. Constant, M. Kotera, and J. Lhomme
Translesional synthesis on DNA templates containing the 2'-deoxyribonolactone lesion
Nucleic Acids Res., July 1, 2001; 29(13): 2725 - 2732.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. Yasui, S. Matsui, M. Ihara, Y. R. S. Laxmi, S. Shibutani, and T. Matsuda
Translesional synthesis on a DNA template containing N2-methyl-2'-deoxyguanosine catalyzed by the Klenow fragment of Escherichia coli DNA polymerase I
Nucleic Acids Res., May 1, 2001; 29(9): 1994 - 2001.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. L. Sheppard, P. Ordoukhanian, and G. F. Joyce
A DNA enzyme with N-glycosylase activity
PNAS, July 5, 2000; 97(14): 7802 - 7807.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
E. Ohashi, T. Ogi, R. Kusumoto, S. Iwai, C. Masutani, F. Hanaoka, and H. Ohmori
Error-prone bypass of certain DNA lesions by the human DNA polymerase kappa
Genes & Dev., July 1, 2000; 14(13): 1589 - 1594.
[Abstract] [Full Text]


Home page
Nucleic Acids ResHome page
V. Duarte, D. Gasparutto, M. Jaquinod, and J. Cadet
In vitro DNA synthesis opposite oxazolone and repair of this DNA damage using modified oligonucleotides
Nucleic Acids Res., April 1, 2000; 28(7): 1555 - 1563.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shibutani, S.
Right arrow Articles by Grollman, A. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shibutani, S.
Right arrow Articles by Grollman, A. P.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement