![]()
|
|
||||||||
(Received for publication, January 6, 1997, and in revised form, April 1, 1997)
,
From the Sidney Kimmel Cancer Center, San Diego, California 92121, the § Center for Molecular Genetics, University of
California at San Diego, La Jolla, California 92093, and the
Division of Biomarkers and Prevention Research Branch,
National Institutes of Health, Rockville, Maryland 20850
We have studied the role of Jun/stress-activated protein kinase (JNK/SAPK) pathway in DNA repair and cisplatin resistance in T98G glioblastoma cells. JUN/SAPK is activated by DNA damage and phosphorylates serines 63 and 73 in the N-terminal domain of c-Jun, which is known to increase its transactivation properties. We show that treatment of T98G glioblastoma cells with cisplatin but not the transplatin isomer activates JNK/SAPK about 10-fold. T98G cells, which are highly resistent to cisplatin (IC50 = 140 ± 13 µM), modified to express a nonphosphorylatable dominant negative c-Jun (termed dnJun) exhibit decreased viability following treatment with cisplatin, but not transplatin, in proportion (rPearson = 0.98) to the level of dnJun expressed leading to a 7-fold decreased IC50. Similar effects are observed in U87 cells, PC-3 cells, and MCF-7 cells, as well as in T98G cells modified to express TAM-67, a known inhibitor of c-Jun function. In contrast, no sensitization effect was observed in cells modified to express wild-type c-Jun. Furthermore, through quantitative polymerase chain reaction-stop assays, we show that dnJun expressing cells were inhibited in repair of cisplatin adducts (p = 0.55), whereas repair is readily detectable (p = 0.003) in parental cells. These observations indicate that the JNK/SAPK pathway is activated by cisplatin-induced DNA damage and that this response is required for DNA repair and viability following cisplatin treatment. Regulation of DNA repair following genotoxic stress may be a normal physiological role of the JNK/SAPK pathway.
JNK/SAPK1 is part of a kinase cascade
that phosphorylates the transcription factor c-Jun at serine residues
63 and 73 (1-9). Phosphorylation of c-Jun at these sites greatly
enhances the transactivation potential of the AP-1 binding sites (1-4)
and AP-1 regulated genes in vivo (5, 11, 12), and there is
evidence suggesting roles for c-Jun phosphorylation in cellular
transformation (1, 2), inflammation (14), and apoptosis (15). The
JNK/SAPK pathway is strongly stimulated in a dose-dependent
manner by various DNA damaging treatments, including UV-C (5, 7-8),
ionizing radiation (16), and alkylating agents such as
N-methyl-N
-nitro-N-nitrosoguanidine (MNNG) (5), methylmethanesulfonate (MMS) (11),
1-
-D-arabinofuranosylcytosine (Ara-C) (17), and hydrogen
peroxide (18). These observations suggest that the JNK/SAPK pathway may
mediate a physiological response to DNA damage such as induction of one
or more DNA repair enzymes. Here we provide evidence that the
chemotherapeutic agent cisplatin, which damages DNA through the
formation of bifunctional platinum adducts, but not transplatin, which
does not damage DNA (19, 20), activates JNK/SAPK up to 10-fold in a
dose-dependent manner. Furthermore, inhibition of this
pathway in cells modified by expression of a nonphosphorylatable
dominant negative mutant of c-Jun, dnJun, blocks DNA repair as judged
by quantitative PCR and markedly decreases viability following
treatment with cisplatin but not transplatin. Thus, JNK/SAPK is
activated by cisplatin-induced DNA damage and is required for DNA
repair and survival following cisplatin treatment.
Culture conditions and all cell lines and plasmids used here were developed using standard methods as described previously (22, 23). The expression of c-Jun and dnJun was quantitated using the methods (24) and antibodies previously characterized (24).
PCRThe PCR-stop assay (28) was used to quantitate
cisplatin-DNA adduct formation and subsequent repair. The assay is
based on the observation that the efficiency of amplification of
cisplatin-treated DNA is inversely proportional to the degree of
platination. Genomic DNA was isolated immediately or 6 h after
treatment of cells for 1 h 15 min with varying amounts of
cisplatin and amplified quantitatively using
32P-end-labeled primers, giving rise to a 2.7-kb and a
nested 0.15-kb fragment of the hyopxanthine phosphoribosyl transferase
gene. The 5
and 3
primers were TGGGATTACACGTGTGAACCAACC and
GATCCACAGTCTGCCTGAGTCACT, respectively, with a 5
nested primer of
CCTAGAAAGCACATGGAGAGCTAG. The 0.15-kb segment of genomic DNA sustains
undetectable levels of DNA damage under our conditions and serves as an
internal PCR control and the basis for normalization of the amount of
amplification of the 2.7-kb fragment. The number of lesions/2.7-kb
fragment (i.e. Fig. 4) is calculated as 1
(cpm
damaged DNA/cpm undamaged DNA) (8).
(normalized efficiency of PCR amplification), a measure of
cisplatin-induced lesions (10). A, PCR results for T98G
parental cells either immediately or 6 h after treatment with
cisplatin. The results are the averages of three assays for each of two
independent preparations of DNA for the three concentrations of
cisplatin. B, comparison of T98G cells and dnJun-expressing
cells 6 h after treatment with cisplatin. The results are the
averages of three assays. ABZ, 2-aminobenzidine.
JNK Assay
JNK assays were carried out exactly as described previously (7).
CytotoxicityViability (29) was assessed by the addition of cisplatin or transplatin for 1 h one day after seeding test cells into 96-well plates followed by a change of medium to fresh medium and determination of surviving cells 5 days later by addition of MTS for 1 h and determination of A590 nm of the dissolved formazan product as described by the manufacturer (Promega). All results were carried out in quadruplicate, and viability is expressed as the ratio of the amount of viable cells following cisplatin or transplatin treatment to that of the same cells without treatment.
It is known that cisplatin but not transplatin forms
covalent covalent cross-links between the N7 position of
adjacent guanine or adjacent adenine-guanine residues (19, 20). We find
that the JNK activity of T98G cells is elevated in a
dose-dependent manner up to 10-fold following a 1-h
exposure to cisplatin but not to transplatin (Fig.
1A). As a positive control of the effects of
a DNA-damaging agent, we examined the response of JNK of T98G cells to
UV-C irradiation (Fig. 1B) and observed a similar
dose-response relationship. Cisplatin-specific responses have been
observed in other cell lines from tumor types that are commonly
refractory to cisplatin treatment such as the human nonsmall cell lung
carcinoma lines A549 (data not shown) and M103 (Fig. 1C).
Moreover, 1 h after treatment with cisplatin, but not transplatin, JNK activity of T98G cells or lung carcinoma cells M103 remains elevated, suggesting that treatment with cisplatin leads to a prolonged
response. These results indicate that only the DNA-damaging cisplatin
isomer activates JNK activity.
Dominant Negative c-Jun Sensitizes Tumor Cells to Cisplatin but Not Transplatin
We developed clonal lines of human T98G glioblastoma
cells, which stably express a dominant negative inhibitor (1, 2) of the
JNK/SAPK pathway, dnJun. Expression of dnJun has no effect on either
basal AP-1 activity (1, 2) or on the enzyme activity of JNK (data not
shown) but does inhibit phosphorylation-dependent activation of transcription (1, 2, 10, 12). The effect of cisplatin
treatment on the viability of representative clonal lines of the
dnJun-expressing T98G cells is compared with that of an empty vector
control line, T98GLHCX, in Fig. 2A. The
viability of empty vector control T98G cells remains largely unaffected by treatment with increasing concentrations of cisplatin even at doses
of
70 µM. Extended titrations revealed IC50
values of 147 and 154 µM for the parental cells and empty
vector control cells, respectively (Table I). In
contrast, the dnJun expressing cells exhibit an IC50 as low
as 21 µM (Fig. 2A) or over 7-fold more
sensitive to cisplatin than the control cells (Table I). Replicate
experiments using additional clones that exhibit varying amounts of
steady state dnJun indicate the sensitization to cisplatin is
proportional (rPearson = 0.98) to the amount of
dnJun expressed (Fig. 2B). Transplatin has no discernible
effect at concentrations where the viability following treatment with
cisplatin is less than 25% (Fig. 3B) and in
extended titrations no significant effect at 250 µM,
indicating that the requirements for sensitization by dnJun depends
upon the stereospecific DNA-binding properties of cisplatin, similar to
the conditions for the activation of JNK.
),
wild-type c-Jun expressing cells (
), and clonal dnJun-expressing
cells (
). B, dose-response curve of the
IC50cisplatin of dnJun-expressing clones
of T98G cells versus total immunoreactive c-Jun (c-Jun + dnJun). Total immunoreactive Jun (c-Jun + dnJun) was
determined by sequential immunoprecipitation of 35S-labeled
cells using specific Jun B, Jun D, followed by pan-Jun antiserum as
described previously (24). Values above 8.5 are taken as expression of
dnJun.
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
) or
absence (
) of 25 mM zinc acetate to clonal PC3 cells the
containing pLHCX and either the inducible vector pMTdnJun (
) or
pMTTAM-67 (
) both in the presence of 25 mM zinc acetate.
B, the viability of parental and modified T98G cells in the
presence of cisplatin (solid symbols) or transplatin
(unfilled symbols).
Expression of wild-type c-Jun does not mimic dnJun-expressing cells (Fig. 2A). In fact, the viability of these cells when treated with cisplatin is somewhat increased relative to parental or empty vector control cells for all viability determinations in the range 20-60 µM cisplatin, suggesting that increased JNK substrate augmented viability following treatment with cisplatin (Fig. 2A). Thus, the sensitization to cisplatin observed for the dnJun-expressing cells appears to correlate with interference in the role of activated c-Jun.
GeneralityWe have tested the generality of the sensitizing
properties of dnJun in PC3 prostate carcinoma cells modified to express
dnJun under the control of an inducible truncated metallothionein
promoter as described previously (21). Viability studies show that
parental or empty vector control cells are largely insensitive to
cisplatin at concentrations
60 µM (Fig. 3A,
circles). Extended titrations revealed IC50
values of 109 and 156 µM for the parental and empty vector control cells, respectively (Table I). However, for PC3 cells
that stably express pMTdnJun, the IC50 value is markedly reduced (Fig. 3A, open diamonds). Further,
induction of maximum expression of dnJun by the addition of zinc
acetate leads to greatly increased cytotoxicity with an
IC50 of 16 µM (Fig. 3B) or
7.24-9.8-fold more sensitive to cisplatin than control cells (Table
I). The addition of zinc acetate alone has no effect on the viability of parental or empty vector control cells (Fig. 3A,
filled circles). Thus, the results observed following
induction of expression of dnJun by a single clonal line confirm the
results of Fig. 2B that sensitization to cisplatin is
dependent upon the expression of dnJun.
As a further control, we examined PC3 prostate carcinoma cells modified to express a zinc-inducible c-Jun derivative, TAM-67, a well characterized transdominant negative inhibitor of AP-1 owing to a deletion of residues 2-122 (21). As with dnJun, induction of TAM-67 in PC3 cells strongly enhances their sensitivity to cisplatin (Fig. 3A). We have determined that these TAM-67 and dnJun are expressed in approximately equal amounts, suggesting that the comparable degree of sensitization for TAM-67 and dnJun (Fig. 3A) is accounted for by interference in the role of phosphorylation-related function of c-Jun.
Similar results have been observed with an additional human glioblastoma line, U87, and an additional epithelial tumor line, MCF-7 (Table I). Clonal dnJun-expressing lines of these cells exhibit 2.6- and 3.8-fold decreased IC50 values, respectively (Table I). Thus, the sum of results indicate that the JNK/SAPK pathway may have a general role in mediating a functional response to DNA-cisplatin adduct formation. Inhibition of this response sensitizes cells to the cell-killing properties of cisplatin.
Cisplatin Activates and dnJun Inhibits DNA RepairWe assessed the extent of genomic DNA damage and repair following cisplatin treatment using a modified PCR assay (25). For this assay, it has been shown that the degree of inhibition of PCR-catalyzed amplification of DNA purified from cisplatin-treated cells is a direct measure of the amount of DNA-cisplatin adduct formation as measured by atomic absorption (25). Thus, this assay provides a direct assessment of the extent of cisplatin-induced DNA damage.
DNA isolated from T98G cells immediately after treatment with 0, 100, or 200 µM cisplatin for 1 h exhibit increasing levels of DNA damage (Fig. 4A, circles). However, if a 6-h "recovery" period is introduced prior to the DNA purification, damage is markedly and significantly (p = 0.003) reduced (Fig. 4A, filled circles). As a positive control for the effects of inhibition of genomic DNA repair, an inhibitor of ADP-ribosylation, 2-aminobenzidine, was added at the time of treatment of the cells with cisplatin (Fig. 4A, squares). Following the 6-h recovery period, DNA damage remained unrepaired, and total DNA damage was substantially increased. Next, we compared the level of DNA damage for T98G cells and dnJun-expressing cells following treatment with cisplatin (Fig. 4B). For the dnJun-expressing T98G cells, 6 h after cisplatin treatment DNA damage remains completely unrepaired for cells treated at either 100 or 200 µM cisplatin (p > 0.53). All the results summarized here (Fig. 4, A and B) are the averages of three independent assays, which confirms the reliability of this observation. The sum of results, therefore, strongly indicates that expression of dnJun by T98G cells largely abolishes DNA repair following exposure of the cells to cisplatin.
These studies show that the JNK/SAPK pathway is activated by cisplatin-induced DNA damage and is required for DNA repair and viability following cisplatin treatment. T98G glioblastoma cells modified to express a nonphosphorylatable dominant negative inhibitor of c-Jun, dnJun, fail to repair cisplatin adducts and are sensitized to the cytotoxic effects of cisplatin under conditions that have little or no effect on parental and control lines. In contrast, cell lines modified to overexpress wild-type c-Jun are resistant to cisplatin, an observation that rules out that possibility that the sensitization effect of dnJun is mediated by one or more of the domains it shares with wild-type c-Jun. Moreover, sensitization to cisplatin by dnJun is exhibited by several cell lines of varying origins. Sensitization to cisplatin is also observed in PC-3 prostate carcinoma cells modified to express TAM-67, a known dominant negative inhibitor of AP-1 (21). Because the degree of protein expression and sensitization is similar for TAM-67 and for dnJun, we conclude that most of the sensitization effects we observe are accounted for by inhibition of the phosphorylation-related functions of Jun.
Two major types of DNA regulatory elements that respond to the
phosphorylation state of c-Jun include classic AP-1 sites and ATF/CREB
sites. Classic AP-1 sites consisting of a 7-base pair consensus motif,
T(G/T)A(C/G)TCA, bind to AP-1 complexes consisting of heterodimers of
members of the Fos and Jun families and to Jun-Jun homodimers (9,
13-15, 21, 22, 26). ATF/CREB sites consisting of an 8-base pair
consensus motif, T(G/A)CGTCA, bind to c-Jun/ATF2 heterodimers. Indeed,
because JNK phosphorylates ATF2 as well as c-Jun and promotes complex
formation and binding to ATF/CREB sites, these sites are likely to be
major targets of JNK-mediated regulation (9, 12, 14, 15). Several
enzymes known to be involved in repair of DNA-cisplatin adducts and
implicated in cisplatin resistance (20) contain ATF/CREB sites in their promoters including DNA polymerase
(27, 28), topoisomerase I (30,
31), and proliferating cell nuclear antigen, an accessory protein of
DNA polymerase delta (32, 33). Moreover, transcription of these genes
is known to be activated through the ATF/CREB sites upon stimulation by
genotoxic agents (27-33). Thus, the inhibition of induction of any or
all of these activities could account for the inhibitory effects of
dnJun on DNA repair and the resultant increase in cisplatin
sensitivity. In view of the common regulatory mechanism involving
ATF/CREB sites, a concerted induction of genes with a related function,
DNA repair, is suggested. The sum of results indicate, therefore, that
a potential physiological role for the strong activation of the
JNK/SAPK pathway following DNA damage may be to mediate DNA repair by
enhancing transaction of DNA repair enzymes.
-dimethylthiazol-2-yl)-5-(3-carboxymethoxylphenyl-2-(4-sulfophenyl)-2H-tetrazolium inner salt.
We thank M. Karin for providing the glutathione S-transferase-c-Jun and dnJun expression vectors and Eileen Adamson for critically reading this manuscript and for support.
During the review of this manuscript we became aware that activation of JNK/SAPK by cisplatin has been reported by Liu et al. (Liu, Z.-G., Baskaran, R., Lea-Chou, E. T., Wood, L. D., Chen, Y., Karin, M., and Wang J. Y. J. (1996) Nature 384, 273-276).
This article has been cited by other articles:
![]() |
S.-H. Chen, J.-K. Lin, S.-H. Liu, Y.-C. Liang, and S.-Y. Lin-Shiau Apoptosis of Cultured Astrocytes Induced by the Copper and Neocuproine Complex through Oxidative Stress and JNK Activation Toxicol. Sci., March 1, 2008; 102(1): 138 - 149. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Rouget, Y. Auclair, M. Loignon, E. B. Affar, and E. A. Drobetsky A Sensitive Flow Cytometry-based Nucleotide Excision Repair Assay Unexpectedly Reveals That Mitogen-activated Protein Kinase Signaling Does Not Regulate the Removal of UV-induced DNA Damage in Human Cells J. Biol. Chem., February 29, 2008; 283(9): 5533 - 5541. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. D. Gross, J. O. Boyle, B. Du, V. D. Kekatpure, A. Lantowski, H. T. Thaler, B. B. Weksler, K. Subbaramaiah, and A. J. Dannenberg Inhibition of Jun NH2-Terminal Kinases Suppresses the Growth of Experimental Head and Neck Squamous Cell Carcinoma Clin. Cancer Res., October 1, 2007; 13(19): 5910 - 5917. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Bullinger, F. G. Rucker, S. Kurz, J. Du, C. Scholl, S. Sander, A. Corbacioglu, C. Lottaz, J. Krauter, S. Frohling, et al. Gene-expression profiling identifies distinct subclasses of core binding factor acute myeloid leukemia Blood, August 15, 2007; 110(4): 1291 - 1300. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Scharpfenecker, M. van Dinther, Z. Liu, R.L. van Bezooijen, Q. Zhao, L. Pukac, C. W. G. M. Lowik, and P. ten Dijke BMP-9 signals via ALK1 and inhibits bFGF-induced endothelial cell proliferation and VEGF-stimulated angiogenesis J. Cell Sci., March 15, 2007; 120(6): 964 - 972. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Xia, H. Srinivas, Y.-h. Ahn, G. Sethi, X. Sheng, W. K. A. Yung, Q. Xia, P. J. Chiao, H. Kim, P. H. Brown, et al. Mitogen-activated Protein Kinase Kinase-4 Promotes Cell Survival by Decreasing PTEN Expression through an NF{kappa}B-dependent Pathway J. Biol. Chem., February 9, 2007; 282(6): 3507 - 3519. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Billecke, S. Finniss, L. Tahash, C. Miller, T. Mikkelsen, N. P. Farrell, and O. Bogler Polynuclear platinum anticancer drugs are more potent than cisplatin and induce cell cycle arrest in glioma Neuro-oncol, July 1, 2006; 8(3): 215 - 226. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Fritz and B. Kaina Late Activation of Stress Kinases (SAPK/JNK) by Genotoxins Requires the DNA Repair Proteins DNA-PKcs and CSB Mol. Biol. Cell, February 1, 2006; 17(2): 851 - 861. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. WANG, J. HAYAKAWA, F. LONG, Q. YU, A. H. CHO, G. RONDEAU, J. WELSH, S. MITTAL, I. DE BELLE, E. ADAMSON, et al. "Promoter Array" Studies Identify Cohorts of Genes Directly Regulated by Methylation, Copy Number Change, or Transcription Factor Binding in Human Cancer Cells Ann. N.Y. Acad. Sci., November 1, 2005; 1058(1): 162 - 185. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. W. Ennis, K. E. Fultz, K. A. Smith, J. K. Westwick, D. Zhu, M. Boluro-Ajayi, G. K. Bilter, and B. Stein Inhibition of Tumor Growth, Angiogenesis, and Tumor Cell Proliferation by a Small Molecule Inhibitor of c-Jun N-terminal Kinase J. Pharmacol. Exp. Ther., April 1, 2005; 313(1): 325 - 332. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wang, S. Ladrech, R. Pujol, P. Brabet, T. R. Van De Water, and J.-L. Puel Caspase Inhibitors, but not c-Jun NH2-Terminal Kinase Inhibitor Treatment, Prevent Cisplatin-Induced Hearing Loss Cancer Res., December 15, 2004; 64(24): 9217 - 9224. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Turkson, S. Zhang, J. Palmer, H. Kay, J. Stanko, L. B. Mora, S. Sebti, H. Yu, and R. Jove Inhibition of constitutive signal transducer and activator of transcription 3 activation by novel platinum complexes with potent antitumor activity Mol. Cancer Ther., December 1, 2004; 3(12): 1533 - 1542. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. MacLaren, E. J. Black, W. Clark, and D. A. F. Gillespie c-Jun-Deficient Cells Undergo Premature Senescence as a Result of Spontaneous DNA Damage Accumulation Mol. Cell. Biol., October 15, 2004; 24(20): 9006 - 9018. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Taron, R. Rosell, E. Felip, P. Mendez, J. Souglakos, M. S. Ronco, C. Queralt, J. Majo, J. M. Sanchez, J. J. Sanchez, et al. BRCA1 mRNA expression levels as an indicator of chemoresistance in lung cancer Hum. Mol. Genet., October 1, 2004; 13(20): 2443 - 2449. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-K. Youn, M.-H. Kim, H.-J. Cho, H.-B. Kim, I.-Y. Chang, M.-H. Chung, and H. J. You Oncogenic H-Ras Up-Regulates Expression of ERCC1 to Protect Cells from Platinum-Based Anticancer Agents Cancer Res., July 15, 2004; 64(14): 4849 - 4857. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Curtin and T. G. Cotter JNK Regulates HIPK3 Expression and Promotes Resistance to Fas-mediated Apoptosis in DU 145 Prostate Carcinoma Cells J. Biol. Chem., April 23, 2004; 279(17): 17090 - 17100. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Mathonnet, C. Leger, J. Desnoyers, R. Drouin, J.-P. Therrien, and E. A. Drobetsky UV wavelength-dependent regulation of transcription-coupled nucleotide excision repair in p53-deficient human cells PNAS, June 10, 2003; 100(12): 7219 - 7224. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Hayakawa, C. Depatie, M. Ohmichi, and D. Mercola The Activation of c-Jun NH2-terminal Kinase (JNK) by DNA-damaging Agents Serves to Promote Drug Resistance via Activating Transcription Factor 2 (ATF2)-dependent Enhanced DNA Repair J. Biol. Chem., May 30, 2003; 278(23): 20582 - 20592. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Mansouri, L. D. Ridgway, A. L. Korapati, Q. Zhang, L. Tian, Y. Wang, Z. H. Siddik, G. B. Mills, and F. X. Claret Sustained Activation of JNK/p38 MAPK Pathways in Response to Cisplatin Leads to Fas Ligand Induction and Cell Death in Ovarian Carcinoma Cells J. Biol. Chem., May 23, 2003; 278(21): 19245 - 19256. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Deacon, P. Mistry, J. Chernoff, J. L. Blank, and R. Patel p38 Mitogen-Activated Protein Kinase Mediates Cell Death and p21-Activated Kinase Mediates Cell Survival during Chemotherapeutic Drug-induced Mitotic Arrest Mol. Biol. Cell, May 1, 2003; 14(5): 2071 - 2087. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. J. Kennedy, H. K. Sluss, S. N. Jones, D. Bar-Sagi, R. A. Flavell, and R. J. Davis Suppression of Ras-stimulated transformation by the JNK signal transduction pathway Genes & Dev., March 1, 2003; 17(5): 629 - 637. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-M. Yang, F. Bost, W. Charbono, N. Dean, R. McKay, J. S. Rhim, C. Depatie, and D. Mercola C-Jun NH2-terminal Kinase Mediates Proliferation and Tumor Growth of Human Prostate Carcinoma Clin. Cancer Res., January 1, 2003; 9(1): 391 - 401. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Levresse, L. Marek, D. Blumberg, and L. E. Heasley Regulation of Platinum-Compound Cytotoxicity by the c-Jun N-Terminal Kinase and c-Jun Signaling Pathway in Small-Cell Lung Cancer Cells Mol. Pharmacol., September 1, 2002; 62(3): 689 - 697. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mabuchi, M. Ohmichi, A. Kimura, K. Hisamoto, J. Hayakawa, Y. Nishio, K. Adachi, K. Takahashi, E. Arimoto-Ishida, Y. Nakatsuji, et al. Inhibition of Phosphorylation of BAD and Raf-1 by Akt Sensitizes Human Ovarian Cancer Cells to Paclitaxel J. Biol. Chem., August 30, 2002; 277(36): 33490 - 33500. [Abstract] [Full Text] [PDF] |
||||
![]() |
N J Gallagher, A G Eliopoulos, A Agathangelo, J Oates, J Crocker, and L S Young CD40 activation in epithelial ovarian carcinoma cells modulates growth, apoptosis, and cytokine secretion Mol. Pathol., April 1, 2002; 55(2): 110 - 120. [Abstract] [Full Text] [PDF] |
||||
![]() |