JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Potapova, O.
Right arrow Articles by Mercola, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Potapova, O.
Right arrow Articles by Mercola, D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 22, Issue of May 30, 1997 pp. 14041-14044
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

COMMUNICATION:
The Jun Kinase/Stress-activated Protein Kinase Pathway Functions to Regulate DNA Repair and Inhibition of the Pathway Sensitizes Tumor Cells to Cisplatin*

(Received for publication, January 6, 1997, and in revised form, April 1, 1997)

Olga Potapova , Ali Haghighi , Frédéric Bost , Chaoting Liu , Michael J. Birrer Dagger , Ruth Gjerset and Dan Mercola §

From the Sidney Kimmel Cancer Center, San Diego, California 92121, the § Center for Molecular Genetics, University of California at San Diego, La Jolla, California 92093, and the Dagger  Division of Biomarkers and Prevention Research Branch, National Institutes of Health, Rockville, Maryland 20850

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
Addendum
REFERENCES


ABSTRACT

We have studied the role of Jun/stress-activated protein kinase (JNK/SAPK) pathway in DNA repair and cisplatin resistance in T98G glioblastoma cells. JUN/SAPK is activated by DNA damage and phosphorylates serines 63 and 73 in the N-terminal domain of c-Jun, which is known to increase its transactivation properties. We show that treatment of T98G glioblastoma cells with cisplatin but not the transplatin isomer activates JNK/SAPK about 10-fold. T98G cells, which are highly resistent to cisplatin (IC50 = 140 ± 13 µM), modified to express a nonphosphorylatable dominant negative c-Jun (termed dnJun) exhibit decreased viability following treatment with cisplatin, but not transplatin, in proportion (rPearson = 0.98) to the level of dnJun expressed leading to a 7-fold decreased IC50. Similar effects are observed in U87 cells, PC-3 cells, and MCF-7 cells, as well as in T98G cells modified to express TAM-67, a known inhibitor of c-Jun function. In contrast, no sensitization effect was observed in cells modified to express wild-type c-Jun. Furthermore, through quantitative polymerase chain reaction-stop assays, we show that dnJun expressing cells were inhibited in repair of cisplatin adducts (p = 0.55), whereas repair is readily detectable (p = 0.003) in parental cells. These observations indicate that the JNK/SAPK pathway is activated by cisplatin-induced DNA damage and that this response is required for DNA repair and viability following cisplatin treatment. Regulation of DNA repair following genotoxic stress may be a normal physiological role of the JNK/SAPK pathway.


INTRODUCTION

JNK/SAPK1 is part of a kinase cascade that phosphorylates the transcription factor c-Jun at serine residues 63 and 73 (1-9). Phosphorylation of c-Jun at these sites greatly enhances the transactivation potential of the AP-1 binding sites (1-4) and AP-1 regulated genes in vivo (5, 11, 12), and there is evidence suggesting roles for c-Jun phosphorylation in cellular transformation (1, 2), inflammation (14), and apoptosis (15). The JNK/SAPK pathway is strongly stimulated in a dose-dependent manner by various DNA damaging treatments, including UV-C (5, 7-8), ionizing radiation (16), and alkylating agents such as N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) (5), methylmethanesulfonate (MMS) (11), 1-beta -D-arabinofuranosylcytosine (Ara-C) (17), and hydrogen peroxide (18). These observations suggest that the JNK/SAPK pathway may mediate a physiological response to DNA damage such as induction of one or more DNA repair enzymes. Here we provide evidence that the chemotherapeutic agent cisplatin, which damages DNA through the formation of bifunctional platinum adducts, but not transplatin, which does not damage DNA (19, 20), activates JNK/SAPK up to 10-fold in a dose-dependent manner. Furthermore, inhibition of this pathway in cells modified by expression of a nonphosphorylatable dominant negative mutant of c-Jun, dnJun, blocks DNA repair as judged by quantitative PCR and markedly decreases viability following treatment with cisplatin but not transplatin. Thus, JNK/SAPK is activated by cisplatin-induced DNA damage and is required for DNA repair and survival following cisplatin treatment.


EXPERIMENTAL PROCEDURES

Cells

Culture conditions and all cell lines and plasmids used here were developed using standard methods as described previously (22, 23). The expression of c-Jun and dnJun was quantitated using the methods (24) and antibodies previously characterized (24).

PCR

The PCR-stop assay (28) was used to quantitate cisplatin-DNA adduct formation and subsequent repair. The assay is based on the observation that the efficiency of amplification of cisplatin-treated DNA is inversely proportional to the degree of platination. Genomic DNA was isolated immediately or 6 h after treatment of cells for 1 h 15 min with varying amounts of cisplatin and amplified quantitatively using 32P-end-labeled primers, giving rise to a 2.7-kb and a nested 0.15-kb fragment of the hyopxanthine phosphoribosyl transferase gene. The 5' and 3' primers were TGGGATTACACGTGTGAACCAACC and GATCCACAGTCTGCCTGAGTCACT, respectively, with a 5' nested primer of CCTAGAAAGCACATGGAGAGCTAG. The 0.15-kb segment of genomic DNA sustains undetectable levels of DNA damage under our conditions and serves as an internal PCR control and the basis for normalization of the amount of amplification of the 2.7-kb fragment. The number of lesions/2.7-kb fragment (i.e. Fig. 4) is calculated as 1 - (cpm damaged DNA/cpm undamaged DNA) (8).


Fig. 4. Expression of the transdominant inhibitor, dnJun, blocks cisplatin-induced DNA repair. PCR results for the 2.7-kb segment of the hyopxanthine phosphoribosyl transferase gene was determined for 0, 100, or 200 µM cisplatin for 1 h as described ("Experimental Procedures") and expressed as 1 - (normalized efficiency of PCR amplification), a measure of cisplatin-induced lesions (10). A, PCR results for T98G parental cells either immediately or 6 h after treatment with cisplatin. The results are the averages of three assays for each of two independent preparations of DNA for the three concentrations of cisplatin. B, comparison of T98G cells and dnJun-expressing cells 6 h after treatment with cisplatin. The results are the averages of three assays. ABZ, 2-aminobenzidine.
[View Larger Version of this Image (21K GIF file)]

JNK Assay

JNK assays were carried out exactly as described previously (7).

Cytotoxicity

Viability (29) was assessed by the addition of cisplatin or transplatin for 1 h one day after seeding test cells into 96-well plates followed by a change of medium to fresh medium and determination of surviving cells 5 days later by addition of MTS for 1 h and determination of A590 nm of the dissolved formazan product as described by the manufacturer (Promega). All results were carried out in quadruplicate, and viability is expressed as the ratio of the amount of viable cells following cisplatin or transplatin treatment to that of the same cells without treatment.


RESULTS

Activation of JNK/SAPK by Cisplatin Requires DNA Adduct Formation

It is known that cisplatin but not transplatin forms covalent covalent cross-links between the N7 position of adjacent guanine or adjacent adenine-guanine residues (19, 20). We find that the JNK activity of T98G cells is elevated in a dose-dependent manner up to 10-fold following a 1-h exposure to cisplatin but not to transplatin (Fig. 1A). As a positive control of the effects of a DNA-damaging agent, we examined the response of JNK of T98G cells to UV-C irradiation (Fig. 1B) and observed a similar dose-response relationship. Cisplatin-specific responses have been observed in other cell lines from tumor types that are commonly refractory to cisplatin treatment such as the human nonsmall cell lung carcinoma lines A549 (data not shown) and M103 (Fig. 1C). Moreover, 1 h after treatment with cisplatin, but not transplatin, JNK activity of T98G cells or lung carcinoma cells M103 remains elevated, suggesting that treatment with cisplatin leads to a prolonged response. These results indicate that only the DNA-damaging cisplatin isomer activates JNK activity.


Fig. 1. Cisplatin is a stereo-specific activator of JNK. A, T98G human glioblastoma cells were stored overnight in serum-free medium, plated the next day, and treated by the indicated concentrations of cisplatin or transplatin for 1 h with a 1-h chase period followed by lysis and assay for JNK activity as described (7). Matching wells of cells were harvested and counted (Coulter counter) and used as the basis for sample loading. FBS, fetal bovine serum. B, positive control. T98G cells were exposed to the indicated doses of UV-C band (StratalinkerTM UV cross-linker 1800) radiation and processed as described for A. C, JNK activity of human lung carcinoma M103 cells following treatment with 200 µM cisplatin or transplatin and processing as described for A with the addition of a 1-h chase prior to lysis.
[View Larger Version of this Image (26K GIF file)]

Dominant Negative c-Jun Sensitizes Tumor Cells to Cisplatin but Not Transplatin

We developed clonal lines of human T98G glioblastoma cells, which stably express a dominant negative inhibitor (1, 2) of the JNK/SAPK pathway, dnJun. Expression of dnJun has no effect on either basal AP-1 activity (1, 2) or on the enzyme activity of JNK (data not shown) but does inhibit phosphorylation-dependent activation of transcription (1, 2, 10, 12). The effect of cisplatin treatment on the viability of representative clonal lines of the dnJun-expressing T98G cells is compared with that of an empty vector control line, T98GLHCX, in Fig. 2A. The viability of empty vector control T98G cells remains largely unaffected by treatment with increasing concentrations of cisplatin even at doses of >= 70 µM. Extended titrations revealed IC50 values of 147 and 154 µM for the parental cells and empty vector control cells, respectively (Table I). In contrast, the dnJun expressing cells exhibit an IC50 as low as 21 µM (Fig. 2A) or over 7-fold more sensitive to cisplatin than the control cells (Table I). Replicate experiments using additional clones that exhibit varying amounts of steady state dnJun indicate the sensitization to cisplatin is proportional (rPearson = 0.98) to the amount of dnJun expressed (Fig. 2B). Transplatin has no discernible effect at concentrations where the viability following treatment with cisplatin is less than 25% (Fig. 3B) and in extended titrations no significant effect at 250 µM, indicating that the requirements for sensitization by dnJun depends upon the stereospecific DNA-binding properties of cisplatin, similar to the conditions for the activation of JNK.


Fig. 2. dnJun sensitizes T98G cells to cisplatin. A, viability assay of empty vector control cells (bullet ), wild-type c-Jun expressing cells (black-square), and clonal dnJun-expressing cells (black-diamond ). B, dose-response curve of the IC50cisplatin of dnJun-expressing clones of T98G cells versus total immunoreactive c-Jun (c-Jun + dnJun). Total immunoreactive Jun (c-Jun + dnJun) was determined by sequential immunoprecipitation of 35S-labeled cells using specific Jun B, Jun D, followed by pan-Jun antiserum as described previously (24). Values above 8.5 are taken as expression of dnJun.
[View Larger Version of this Image (18K GIF file)]

Table I. Sensitization of human tumor lines to cisplatin-induced cytotoxicity

IC50 values were determined by direct titration of viability with cisplatin as described ("Experimental Procedures"). None of the cell lines examined here were made cisplatin-resistant prior to analysis. IC50 values were determined by direct titration of viability with cisplatin as described ("Experimental Procedures"). None of the cell lines examined here were made cisplatin-resistant prior to analysis.

Cell Controla
dnJun-expressing IC50 Cisplatin sensitizationb (IC50)Parent/(IC50)dnJun
IC50

µM µM
T98G glioblastoma Parental 140  ± 13 21  ± 3 7.0
Empty vector pLHCX 154  ± 13 7.60
U87 glioblastoma Parental 130  ± 53 50  ± 5 2.6
Empty vector pLHCX ND
PC3 prostate carcinoma Parental 109  ± 13 16  ± 2 7.2
Empty vector pMT64AA 156  ± 18 9.2
MCF-7 breast carcinoma Parental 145  ± 25 38  ± 2 3.8
Empty vector pLHCX 101  ± 9 2.7

a In all cases parental and empty vector cells were analyzed in parallel and with equal concentrations of cisplatin and transplatin in the range 0-250 µM all in quadruplicate. Transplatin had no effect on viability of any cell. ND, not done.
b Sensitization is defined by the ratio of IC50 values for the parental or empty vector control cells to the IC50 value of the dnJun-expressing cells.


Fig. 3. Sensitization of cells to cisplatin is general among cell types and stereospecific. A, comparison of the viability of PC3 human prostate carcinoma cells modified to express pLHCX and the empty vector pMT64AA in the presence (black-square) or absence (bullet ) of 25 mM zinc acetate to clonal PC3 cells the containing pLHCX and either the inducible vector pMTdnJun (black-diamond ) or pMTTAM-67 (black-triangle) both in the presence of 25 mM zinc acetate. B, the viability of parental and modified T98G cells in the presence of cisplatin (solid symbols) or transplatin (unfilled symbols).
[View Larger Version of this Image (25K GIF file)]

Expression of wild-type c-Jun does not mimic dnJun-expressing cells (Fig. 2A). In fact, the viability of these cells when treated with cisplatin is somewhat increased relative to parental or empty vector control cells for all viability determinations in the range 20-60 µM cisplatin, suggesting that increased JNK substrate augmented viability following treatment with cisplatin (Fig. 2A). Thus, the sensitization to cisplatin observed for the dnJun-expressing cells appears to correlate with interference in the role of activated c-Jun.

Generality

We have tested the generality of the sensitizing properties of dnJun in PC3 prostate carcinoma cells modified to express dnJun under the control of an inducible truncated metallothionein promoter as described previously (21). Viability studies show that parental or empty vector control cells are largely insensitive to cisplatin at concentrations <= 60 µM (Fig. 3A, circles). Extended titrations revealed IC50 values of 109 and 156 µM for the parental and empty vector control cells, respectively (Table I). However, for PC3 cells that stably express pMTdnJun, the IC50 value is markedly reduced (Fig. 3A, open diamonds). Further, induction of maximum expression of dnJun by the addition of zinc acetate leads to greatly increased cytotoxicity with an IC50 of 16 µM (Fig. 3B) or 7.24-9.8-fold more sensitive to cisplatin than control cells (Table I). The addition of zinc acetate alone has no effect on the viability of parental or empty vector control cells (Fig. 3A, filled circles). Thus, the results observed following induction of expression of dnJun by a single clonal line confirm the results of Fig. 2B that sensitization to cisplatin is dependent upon the expression of dnJun.

As a further control, we examined PC3 prostate carcinoma cells modified to express a zinc-inducible c-Jun derivative, TAM-67, a well characterized transdominant negative inhibitor of AP-1 owing to a deletion of residues 2-122 (21). As with dnJun, induction of TAM-67 in PC3 cells strongly enhances their sensitivity to cisplatin (Fig. 3A). We have determined that these TAM-67 and dnJun are expressed in approximately equal amounts, suggesting that the comparable degree of sensitization for TAM-67 and dnJun (Fig. 3A) is accounted for by interference in the role of phosphorylation-related function of c-Jun.

Similar results have been observed with an additional human glioblastoma line, U87, and an additional epithelial tumor line, MCF-7 (Table I). Clonal dnJun-expressing lines of these cells exhibit 2.6- and 3.8-fold decreased IC50 values, respectively (Table I). Thus, the sum of results indicate that the JNK/SAPK pathway may have a general role in mediating a functional response to DNA-cisplatin adduct formation. Inhibition of this response sensitizes cells to the cell-killing properties of cisplatin.

Cisplatin Activates and dnJun Inhibits DNA Repair

We assessed the extent of genomic DNA damage and repair following cisplatin treatment using a modified PCR assay (25). For this assay, it has been shown that the degree of inhibition of PCR-catalyzed amplification of DNA purified from cisplatin-treated cells is a direct measure of the amount of DNA-cisplatin adduct formation as measured by atomic absorption (25). Thus, this assay provides a direct assessment of the extent of cisplatin-induced DNA damage.

DNA isolated from T98G cells immediately after treatment with 0, 100, or 200 µM cisplatin for 1 h exhibit increasing levels of DNA damage (Fig. 4A, circles). However, if a 6-h "recovery" period is introduced prior to the DNA purification, damage is markedly and significantly (p = 0.003) reduced (Fig. 4A, filled circles). As a positive control for the effects of inhibition of genomic DNA repair, an inhibitor of ADP-ribosylation, 2-aminobenzidine, was added at the time of treatment of the cells with cisplatin (Fig. 4A, squares). Following the 6-h recovery period, DNA damage remained unrepaired, and total DNA damage was substantially increased. Next, we compared the level of DNA damage for T98G cells and dnJun-expressing cells following treatment with cisplatin (Fig. 4B). For the dnJun-expressing T98G cells, 6 h after cisplatin treatment DNA damage remains completely unrepaired for cells treated at either 100 or 200 µM cisplatin (p > 0.53). All the results summarized here (Fig. 4, A and B) are the averages of three independent assays, which confirms the reliability of this observation. The sum of results, therefore, strongly indicates that expression of dnJun by T98G cells largely abolishes DNA repair following exposure of the cells to cisplatin.


DISCUSSION

These studies show that the JNK/SAPK pathway is activated by cisplatin-induced DNA damage and is required for DNA repair and viability following cisplatin treatment. T98G glioblastoma cells modified to express a nonphosphorylatable dominant negative inhibitor of c-Jun, dnJun, fail to repair cisplatin adducts and are sensitized to the cytotoxic effects of cisplatin under conditions that have little or no effect on parental and control lines. In contrast, cell lines modified to overexpress wild-type c-Jun are resistant to cisplatin, an observation that rules out that possibility that the sensitization effect of dnJun is mediated by one or more of the domains it shares with wild-type c-Jun. Moreover, sensitization to cisplatin by dnJun is exhibited by several cell lines of varying origins. Sensitization to cisplatin is also observed in PC-3 prostate carcinoma cells modified to express TAM-67, a known dominant negative inhibitor of AP-1 (21). Because the degree of protein expression and sensitization is similar for TAM-67 and for dnJun, we conclude that most of the sensitization effects we observe are accounted for by inhibition of the phosphorylation-related functions of Jun.

Two major types of DNA regulatory elements that respond to the phosphorylation state of c-Jun include classic AP-1 sites and ATF/CREB sites. Classic AP-1 sites consisting of a 7-base pair consensus motif, T(G/T)A(C/G)TCA, bind to AP-1 complexes consisting of heterodimers of members of the Fos and Jun families and to Jun-Jun homodimers (9, 13-15, 21, 22, 26). ATF/CREB sites consisting of an 8-base pair consensus motif, T(G/A)CGTCA, bind to c-Jun/ATF2 heterodimers. Indeed, because JNK phosphorylates ATF2 as well as c-Jun and promotes complex formation and binding to ATF/CREB sites, these sites are likely to be major targets of JNK-mediated regulation (9, 12, 14, 15). Several enzymes known to be involved in repair of DNA-cisplatin adducts and implicated in cisplatin resistance (20) contain ATF/CREB sites in their promoters including DNA polymerase beta  (27, 28), topoisomerase I (30, 31), and proliferating cell nuclear antigen, an accessory protein of DNA polymerase delta (32, 33). Moreover, transcription of these genes is known to be activated through the ATF/CREB sites upon stimulation by genotoxic agents (27-33). Thus, the inhibition of induction of any or all of these activities could account for the inhibitory effects of dnJun on DNA repair and the resultant increase in cisplatin sensitivity. In view of the common regulatory mechanism involving ATF/CREB sites, a concerted induction of genes with a related function, DNA repair, is suggested. The sum of results indicate, therefore, that a potential physiological role for the strong activation of the JNK/SAPK pathway following DNA damage may be to mediate DNA repair by enhancing transaction of DNA repair enzymes.


FOOTNOTES

*   This work was supported by Grant CA 63783 from the National Cancer Institute (to D. A. M.), by La Ligue Nationale Contre le Cancer (to F. B. and D. A. M.), by the Tobacco-Related Diseases Research Program of California (to R. G.), by the U. S. Army Breast Cancer Research Project (to R. G.), by Introgen Therapeutics, Inc. (to R. G.), and by the Fellowship Program of the Sidney Kimmel Cancer Center.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
   To whom correspondence should be addressed: Sidney Kimmel Cancer Center, 3099 Science Park Rd., San Diego, CA 92121. Tel.: 619-450-5990; Fax: 619-450-3251; E-mail: 74361.2163{at}compuserve.com.
1   The abbreviations used are: JNK, c-Jun N-terminal kinase; AP-1, activator protein complex 1; cisplatin, cis-diaminodichloroplatinum; SAPK, stress-activated protein kinase; MTT, micro-tetrazolium (dye) test; transplatin, trans-diaminodichloroplatinum; UV-C, ultraviolet light C band, 254 nm maximum intensity for UV cross-linker 1800; dnJUN, dominant negative c-Jun; PCR, polymerase chain reaction; kb, kilobase pair; ATF, activation transcription factor; CREB, cAMP response element binding protein; MTS, (3-(4,5'-dimethylthiazol-2-yl)-5-(3-carboxymethoxylphenyl-2-(4-sulfophenyl)-2H-tetrazolium inner salt.

ACKNOWLEDGEMENTS

We thank M. Karin for providing the glutathione S-transferase-c-Jun and dnJun expression vectors and Eileen Adamson for critically reading this manuscript and for support.


Addendum

During the review of this manuscript we became aware that activation of JNK/SAPK by cisplatin has been reported by Liu et al. (Liu, Z.-G., Baskaran, R., Lea-Chou, E. T., Wood, L. D., Chen, Y., Karin, M., and Wang J. Y. J. (1996) Nature 384, 273-276).


REFERENCES

  1. Smeal, T., Binétruy, B., Mercola, D. A., Birrer, M., and Karin, M. (1991) Nature 354, 494-496 [CrossRef][Medline] [Order article via Infotrieve]
  2. Smeal, T., Binétruy, B., Mercola, D. A., Bardwick-Grover, A., Heidecker, G., Rapp, U., and Karin, M. (1992) Mol. Cell. Biol. 12, 3507-3513 [Abstract/Free Full Text]
  3. Binétruy, B., Smeal, T., and Karin, M. (1991) Nature 351, 122-127 [CrossRef][Medline] [Order article via Infotrieve]
  4. Pulverer, B., Kyriakis, J. M., Avruch, J., Nikolakakie, E., and Woodgett, J. (1991) Nature 353, 670-674 [CrossRef][Medline] [Order article via Infotrieve]
  5. Dérijard, B., Hibi, M., Wu, I.-H., Barrett, T., Su, B., Deng, T., Karin, M., and Davis, R., J. (1994) Cell 76, 1025-1037 [CrossRef][Medline] [Order article via Infotrieve]
  6. Kyriakis, J. M., Banerjee, P., Nikolakaki, E., Dai, T., Rubie, E. A., Ahmad, M. F., Avruch, J., and Woodgett, J. R. (1994) Nature 369, 156-160 [CrossRef][Medline] [Order article via Infotrieve]
  7. Hibi, M., Lin, A., Smeal, T., Minden, A., and Karin, M. (1993) Genes & Dev. 7, 2135-2148 [Abstract/Free Full Text]
  8. Adler, V., Fuchs, S., Y., Kim, J., Kraft, A., King, M., P., Pelling, J., and Ronai, Z. (1995) Cell Growth & Differ. 6, 1437-1446 [Abstract]
  9. Sluss, H., Barrett, T., Dérijard, B., and Davis, R. J. (1994) Mol. Cell. Biol. 14, 8376-8384 [Abstract/Free Full Text]
  10. van Dam, H., Wilhelm, D., Herr, I., Steffen, A., Herrlich, P., and Angel, P. (1995) EMBO J. 14, 1798-1811 [Medline] [Order article via Infotrieve]
  11. Adler, V., Franklin, C., and Kraft, A. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 5341-5345 [Abstract/Free Full Text]
  12. van Dam, H., Duyndam, M., Rottier, R., Bosch, A., de Vries-Smits, L., Herrlich, P., Zantema, A., Angel, P., and van der Eb, A. J. (1993) EMBO J. 12, 479-87 [Medline] [Order article via Infotrieve]
  13. Whitmarsh, A., Shore, P., Sharrocks, A., and Davis, R. J. (1995) Science 269, 403-407 [Abstract/Free Full Text]
  14. Davis, R. (1994) Trends Biochem. Sci. 19, 470-473 [CrossRef][Medline] [Order article via Infotrieve]
  15. Xia, Z., Dickens, M., Raingeaud, J., Davis, R., and Greenberg, M. (1995) Science 270, 1326-1331 [Abstract/Free Full Text]
  16. Macgregor, P. F., Abate, C., and Curran, T. (1990) Oncogene 5, 451-458 [Medline] [Order article via Infotrieve]
  17. Kharbanda, S., Pandey, P., Ren, R., Mayer, B., Zon, L., and Kufe, D. (1995) J. Biol. Chem. 270, 30278-30281 [Abstract/Free Full Text]
  18. Yu, R., Jiao, J., Duh, J., Tan, T. H., and Kong, A. (1996) Cancer Res. 56, 2954-2959 [Abstract/Free Full Text]
  19. Sherman, S. E., Gibson, D., Wang, A. H., and Lippard, S. J. (1985) Science 230, 412-417 [Abstract/Free Full Text]
  20. Zamble, D. B., and Lippard, S. J. (1995) Trends Biochem. Sci. 20, 435-439 [CrossRef][Medline] [Order article via Infotrieve]
  21. Brown, P. H., Chen, T. K., and Birrer, M. J. (1994) Oncogene 9, 791-799 [Medline] [Order article via Infotrieve]
  22. Mercola, D. A., Carpenter, P., Grover-Bardwick, A., and Mercola, M. (1992) Oncogene 7, 1793-1803 [Medline] [Order article via Infotrieve]
  23. Potapova, O., Fakhrai, H., Baird, S., and Mercola, D. (1996) Cancer Res. 56, 280-286 [Abstract/Free Full Text]
  24. Grover-Bardwick, A., Adamson, E., and Mercola, D. (1994) Carcinogenesis 15, 1667-1674 [Abstract/Free Full Text]
  25. Jennerwein, M. M., and Eastman, A. (1991) Nucleic Acids Res. 19, 6209-6214 [Abstract/Free Full Text]
  26. Karin, M., and Smeal (1992) Trends Biochem. Sci. 17, 418-422 [CrossRef][Medline] [Order article via Infotrieve]
  27. Kedar, P. S., Widen, S. G., Englander, E. W., Fornace, A. J., Jr., and Wilson, S. H. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 3729-3733 [Abstract/Free Full Text]
  28. Horton, J., Srivastava, D., Zmudzka, B., and Wilson, S. H. (1995) Nucleic Acids Res. 23, 3810-3815 [Abstract/Free Full Text]
  29. Gjerset, R., Turla, S., Sobol, R., Scalise, J., Mercola, D., Collins, H., and Isabella, P. (1995) Mol. Carcinogen. 14, 275-285 [Medline] [Order article via Infotrieve]
  30. Heiland, S,., Knippers, R., and Kunze, N. (1993) Eur. J. Biochem. 217, 813-822 [Medline] [Order article via Infotrieve]
  31. Baumgartner, B., Heiland, S., Kunze, N., Richter, A., and Knippers, R. (1994) Biochim. Biophys. Acta 1218, 123-127 [Medline] [Order article via Infotrieve]
  32. Feuerstein, N., Huang, D., and Prystowsky, M. B. (1995) J. Biol. Chem. 270, 9454-9458 [Abstract/Free Full Text]
  33. Huang, D., Shipman-Appasamy, P. M., Orten, D., J., Hinrichs, S. H., and Prystowsky, M. B. (1994) Mol. Cell. Biol. 14, 4233-4243 [Abstract/Free Full Text]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Toxicol SciHome page
S.-H. Chen, J.-K. Lin, S.-H. Liu, Y.-C. Liang, and S.-Y. Lin-Shiau
Apoptosis of Cultured Astrocytes Induced by the Copper and Neocuproine Complex through Oxidative Stress and JNK Activation
Toxicol. Sci., March 1, 2008; 102(1): 138 - 149.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Rouget, Y. Auclair, M. Loignon, E. B. Affar, and E. A. Drobetsky
A Sensitive Flow Cytometry-based Nucleotide Excision Repair Assay Unexpectedly Reveals That Mitogen-activated Protein Kinase Signaling Does Not Regulate the Removal of UV-induced DNA Damage in Human Cells
J. Biol. Chem., February 29, 2008; 283(9): 5533 - 5541.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
N. D. Gross, J. O. Boyle, B. Du, V. D. Kekatpure, A. Lantowski, H. T. Thaler, B. B. Weksler, K. Subbaramaiah, and A. J. Dannenberg
Inhibition of Jun NH2-Terminal Kinases Suppresses the Growth of Experimental Head and Neck Squamous Cell Carcinoma
Clin. Cancer Res., October 1, 2007; 13(19): 5910 - 5917.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Bullinger, F. G. Rucker, S. Kurz, J. Du, C. Scholl, S. Sander, A. Corbacioglu, C. Lottaz, J. Krauter, S. Frohling, et al.
Gene-expression profiling identifies distinct subclasses of core binding factor acute myeloid leukemia
Blood, August 15, 2007; 110(4): 1291 - 1300.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M. Scharpfenecker, M. van Dinther, Z. Liu, R.L. van Bezooijen, Q. Zhao, L. Pukac, C. W. G. M. Lowik, and P. ten Dijke
BMP-9 signals via ALK1 and inhibits bFGF-induced endothelial cell proliferation and VEGF-stimulated angiogenesis
J. Cell Sci., March 15, 2007; 120(6): 964 - 972.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Xia, H. Srinivas, Y.-h. Ahn, G. Sethi, X. Sheng, W. K. A. Yung, Q. Xia, P. J. Chiao, H. Kim, P. H. Brown, et al.
Mitogen-activated Protein Kinase Kinase-4 Promotes Cell Survival by Decreasing PTEN Expression through an NF{kappa}B-dependent Pathway
J. Biol. Chem., February 9, 2007; 282(6): 3507 - 3519.
[Abstract] [Full Text] [PDF]


Home page
Neuro OncolHome page
C. Billecke, S. Finniss, L. Tahash, C. Miller, T. Mikkelsen, N. P. Farrell, and O. Bogler
Polynuclear platinum anticancer drugs are more potent than cisplatin and induce cell cycle arrest in glioma
Neuro-oncol, July 1, 2006; 8(3): 215 - 226.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
G. Fritz and B. Kaina
Late Activation of Stress Kinases (SAPK/JNK) by Genotoxins Requires the DNA Repair Proteins DNA-PKcs and CSB
Mol. Biol. Cell, February 1, 2006; 17(2): 851 - 861.
[Abstract] [Full Text] [PDF]


Home page
Ann. N. Y. Acad. Sci.Home page
Y. WANG, J. HAYAKAWA, F. LONG, Q. YU, A. H. CHO, G. RONDEAU, J. WELSH, S. MITTAL, I. DE BELLE, E. ADAMSON, et al.
"Promoter Array" Studies Identify Cohorts of Genes Directly Regulated by Methylation, Copy Number Change, or Transcription Factor Binding in Human Cancer Cells
Ann. N.Y. Acad. Sci., November 1, 2005; 1058(1): 162 - 185.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
B. W. Ennis, K. E. Fultz, K. A. Smith, J. K. Westwick, D. Zhu, M. Boluro-Ajayi, G. K. Bilter, and B. Stein
Inhibition of Tumor Growth, Angiogenesis, and Tumor Cell Proliferation by a Small Molecule Inhibitor of c-Jun N-terminal Kinase
J. Pharmacol. Exp. Ther., April 1, 2005; 313(1): 325 - 332.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Wang, S. Ladrech, R. Pujol, P. Brabet, T. R. Van De Water, and J.-L. Puel
Caspase Inhibitors, but not c-Jun NH2-Terminal Kinase Inhibitor Treatment, Prevent Cisplatin-Induced Hearing Loss
Cancer Res., December 15, 2004; 64(24): 9217 - 9224.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
J. Turkson, S. Zhang, J. Palmer, H. Kay, J. Stanko, L. B. Mora, S. Sebti, H. Yu, and R. Jove
Inhibition of constitutive signal transducer and activator of transcription 3 activation by novel platinum complexes with potent antitumor activity
Mol. Cancer Ther., December 1, 2004; 3(12): 1533 - 1542.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. MacLaren, E. J. Black, W. Clark, and D. A. F. Gillespie
c-Jun-Deficient Cells Undergo Premature Senescence as a Result of Spontaneous DNA Damage Accumulation
Mol. Cell. Biol., October 15, 2004; 24(20): 9006 - 9018.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. Taron, R. Rosell, E. Felip, P. Mendez, J. Souglakos, M. S. Ronco, C. Queralt, J. Majo, J. M. Sanchez, J. J. Sanchez, et al.
BRCA1 mRNA expression levels as an indicator of chemoresistance in lung cancer
Hum. Mol. Genet., October 1, 2004; 13(20): 2443 - 2449.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C.-K. Youn, M.-H. Kim, H.-J. Cho, H.-B. Kim, I.-Y. Chang, M.-H. Chung, and H. J. You
Oncogenic H-Ras Up-Regulates Expression of ERCC1 to Protect Cells from Platinum-Based Anticancer Agents
Cancer Res., July 15, 2004; 64(14): 4849 - 4857.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. F. Curtin and T. G. Cotter
JNK Regulates HIPK3 Expression and Promotes Resistance to Fas-mediated Apoptosis in DU 145 Prostate Carcinoma Cells
J. Biol. Chem., April 23, 2004; 279(17): 17090 - 17100.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
G. Mathonnet, C. Leger, J. Desnoyers, R. Drouin, J.-P. Therrien, and E. A. Drobetsky
UV wavelength-dependent regulation of transcription-coupled nucleotide excision repair in p53-deficient human cells
PNAS, June 10, 2003; 100(12): 7219 - 7224.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Hayakawa, C. Depatie, M. Ohmichi, and D. Mercola
The Activation of c-Jun NH2-terminal Kinase (JNK) by DNA-damaging Agents Serves to Promote Drug Resistance via Activating Transcription Factor 2 (ATF2)-dependent Enhanced DNA Repair
J. Biol. Chem., May 30, 2003; 278(23): 20582 - 20592.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Mansouri, L. D. Ridgway, A. L. Korapati, Q. Zhang, L. Tian, Y. Wang, Z. H. Siddik, G. B. Mills, and F. X. Claret
Sustained Activation of JNK/p38 MAPK Pathways in Response to Cisplatin Leads to Fas Ligand Induction and Cell Death in Ovarian Carcinoma Cells
J. Biol. Chem., May 23, 2003; 278(21): 19245 - 19256.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
K. Deacon, P. Mistry, J. Chernoff, J. L. Blank, and R. Patel
p38 Mitogen-Activated Protein Kinase Mediates Cell Death and p21-Activated Kinase Mediates Cell Survival during Chemotherapeutic Drug-induced Mitotic Arrest
Mol. Biol. Cell, May 1, 2003; 14(5): 2071 - 2087.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
N. J. Kennedy, H. K. Sluss, S. N. Jones, D. Bar-Sagi, R. A. Flavell, and R. J. Davis
Suppression of Ras-stimulated transformation by the JNK signal transduction pathway
Genes & Dev., March 1, 2003; 17(5): 629 - 637.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
Y.-M. Yang, F. Bost, W. Charbono, N. Dean, R. McKay, J. S. Rhim, C. Depatie, and D. Mercola
C-Jun NH2-terminal Kinase Mediates Proliferation and Tumor Growth of Human Prostate Carcinoma
Clin. Cancer Res., January 1, 2003; 9(1): 391 - 401.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
V. Levresse, L. Marek, D. Blumberg, and L. E. Heasley
Regulation of Platinum-Compound Cytotoxicity by the c-Jun N-Terminal Kinase and c-Jun Signaling Pathway in Small-Cell Lung Cancer Cells
Mol. Pharmacol., September 1, 2002; 62(3): 689 - 697.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Mabuchi, M. Ohmichi, A. Kimura, K. Hisamoto, J. Hayakawa, Y. Nishio, K. Adachi, K. Takahashi, E. Arimoto-Ishida, Y. Nakatsuji, et al.
Inhibition of Phosphorylation of BAD and Raf-1 by Akt Sensitizes Human Ovarian Cancer Cells to Paclitaxel
J. Biol. Chem., August 30, 2002; 277(36): 33490 - 33500.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pathol.Home page
N J Gallagher, A G Eliopoulos, A Agathangelo, J Oates, J Crocker, and L S Young
CD40 activation in epithelial ovarian carcinoma cells modulates growth, apoptosis, and cytokine secretion
Mol. Pathol., April 1, 2002; 55(2): 110 - 120.
[Abstract] [Full Text] [PDF]


Home page