JBC Origene Your Gene Company

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kobayashi, T.
Right arrow Articles by Narumiya, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kobayashi, T.
Right arrow Articles by Narumiya, S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 24, Issue of June 13, 1997 pp. 15154-15160
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Identification of Domains Conferring Ligand Binding Specificity to the Prostanoid Receptor
STUDIES ON CHIMERIC PROSTACYCLIN/PROSTAGLANDIN D RECEPTORS*

(Received for publication, February 14, 1997, and in revised form, April 14, 1997)

Takuya Kobayashi , Michitaka Kiriyama , Takako Hirata , Masakazu Hirata , Fumitaka Ushikubi and Shuh Narumiya Dagger

From the Department of Pharmacology, Kyoto University Faculty of Medicine, Yoshida, Sakyo-ku, Kyoto 606-01, Japan

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENT
REFERENCES


ABSTRACT

To identify domains conferring ligand binding specificity to prostanoid receptors, we constructed a series of chimeric receptors by successively replacing the regions from the carboxyl-terminal tail of mouse prostacyclin (prostaglandin I (PGI)) receptor (mIP) with the corresponding regions of the mouse PGD receptor (mDP). The mIP receptor expressed in COS 7 cells bound [3H]iloprost, a PGI2 analog, and [3H]PGE1 with Kd values of 13 and 27 nM, respectively. This receptor did not bind [3H]PGD2, [3H]PGE2, and [3H]PGF2alpha . The mDP receptor bound only [3H]PGD2 with a Kd value of 43 nM. The chimeric IPN-VII/DPC receptor with replacement of the carboxyl tail of the mIP receptor with that of the mDP receptor showed 12-16-fold higher affinities for [3H]iloprost and [3H]PGE1 than the mIP receptor. The region extending from the sixth transmembrane domain to the carboxyl terminus of the mIP receptor was next replaced with the corresponding region of the mDP receptor. This chimeric IPN-V/DPVI-C receptor acquired the ability to bind [3H]PGD2 and [3H]PGE2 without decreasing the affinities of the mIP receptor to [3H]iloprost and [3H]PGE1. These binding characteristics did not change when the fourth and fifth transmembrane domains of the mIP receptor were further replaced with the corresponding regions of the mDP receptor. However, when the first extracellular to second intracellular loop of the mIP receptor containing the third transmembrane domain was further replaced with those of the mDP receptor, the affinities for [3H]PGE1, [3H]PGE2, and [3H]iloprost were markedly decreased, whereas that for [3H]PGD2 was increased by about 2-fold. [3H]PGF2alpha showed no affinity for the mIP, mDP, and all the chimeric receptors. These results suggest that the sixth to seventh transmembrane domain of the mIP receptor confers the specificity of this receptor to bind selectively to PGE1 and not to PGE2 and that the third transmembrane domain of the mDP receptor confers the selective binding of PGD2 to this receptor.


INTRODUCTION

Prostaglandins (PGs)1 contain prostanoic acid as a central structural element. PGs have two structural features in the prostanoic acid framework. First, they have functional groups on the cyclopentane ring, which classifies them into four types, D, E, F, and I. Second, they are classified into three series, 1, 2, and 3, by the number of double bonds in the side chains. Additionally, another cyclooxygenase product, thromboxane A2 has an oxane ring instead of the cyclopentane ring. These prostanoids act on eight types and subtypes of the receptors. They are the PGD receptor (DP), the EP1, EP2, EP3, and EP4 subtypes of the PGE receptor, the PGF receptor (FP), the PGI receptor (IP), and the thromboxane A2 receptor (TP) (1-4). These receptors can recognize the structural differences of prostanoid molecules. The binding affinities of these receptors to prostanoid molecules are determined primarily by the cyclopentane ring structures of ligands. For example, the DP receptor shows the highest affinities to PGD2 and PGD1, but affinities to other prostanoids are at least 2 orders of magnitude less. One exception is the IP receptor, which shows the affinity to PGE1 almost comparable to PGI analogs such as iloprost. This receptor, however, can bind PGE2 with much lower affinity, suggesting that the IP receptor can discriminate a difference in the side chains.

We have cloned cDNAs for all of these types and subtypes of the mouse prostanoid receptors (5-13). These studies revealed that the prostanoid receptors belong to the G protein-coupled rhodopsin type receptor superfamily. They have several regions conserved specifically among them. These conserved regions may participate in the construction of binding domains for structures common to prostanoid molecules, whereas the other regions may confer specificity for ligand binding. For example, the arginine in the seventh transmembrane domain, which is conserved in all of the prostanoid receptors, was proposed to be the binding site for the carboxyl group of prostanoid molecules (5, 14, 15). In fact, Funk et al. (16) have shown that a point mutation at this arginine residue in the human TP receptor results in loss of ligand binding activity. However, structural domains of the prostanoid receptors conferring specificity for ligand binding are as yet unknown.

Chimeric receptors have been used to determine the regions involved in various functions of the receptors. For example, this approach was used to determine the regions involved in selective agonist and antagonist binding in adrenergic receptors (17, 18). Chimeric receptors were also used to identify the binding site of non-peptide antagonists to the neurokinin receptors (19-22) and to the angiotensin receptors (23) and the G protein activation sites of the muscarinic and beta 1-adrenergic receptors (24). These results show that this approach has been useful in locating functional domains of various receptors.

To identify the domains conferring the ligand binding specificity to the prostanoid receptors, we have constructed chimeric receptors from the mIP and mDP receptors in this study. This strategy is based on the high homology of their amino acid sequences as well as common signal transduction. The prostanoid receptors can be functionally grouped into three categories: the relaxant receptors, the contractile receptors, and the inhibitory receptor (14). The relaxant receptors, consisting of the IP, DP, EP2, and EP4 receptors, mediate increases in cAMP and induce smooth muscle relaxation. The contractile receptors, consisting of the TP, FP, and EP1 receptors, mediate calcium mobilization and induce smooth muscle contraction. The EP3 receptor is an inhibitory receptor that mediates decreases in cAMP and inhibits several biological processes such as neurotransmission, gastric acid secretion, and water reabsorption. Sequence homology among these functionally related receptors is higher than that among the three separate groups (25). The amino acid sequences of the mIP and mDP receptors, which belong to the same relaxant receptor group, show 58% identity in the transmembrane domains (Fig. 1), and both couple to the same G protein, Gs. Chimeric mIP/DP receptors were expressed in the COS 7 cells, and their ligand binding properties were examined.


Fig. 1. A membrane topology model of the mIP receptor. The model is based on hydrophobicity analysis of the mIP receptor according to the methods of Kyte and Doolittle (38). Solid circles indicate the residues that are identical to those of the mDP receptor. Sites for replacement in chimeric receptors are shown, and restriction endonucleases used for construction are indicated (see "Experimental Procedures").
[View Larger Version of this Image (29K GIF file)]


EXPERIMENTAL PROCEDURES

Materials

PGD2, PGE1, PGE2, and PGF2alpha were generous gifts from Ono Pharmaceuticals Co. Ltd. (Osaka, Japan). PGD1 was obtained from Cayman Chemical Co. (Ann Arbor, MI). [5,6,8,9,12,14,15-3H]PGD2 (115 Ci/mmol), [5,6-3H]PGE1 (52 Ci/mmol), [5, 6,8,11,12,14,15-3H]PGE2 (171 Ci/mmol), and [5,6,8,9,11,12,14,15-3H]PGF2alpha (179 Ci/mmol) were obtained from DuPont NEN. Iloprost and [3H]iloprost (15.3 Ci/mmol) were obtained from Amersham International plc, United Kingdom.

Construction of Chimeric Receptors

The mIP and mDP cDNAs were first subcloned into pCMX expression vector (26). The BalI-EcoRV fragment of CP302, a cDNA of mIP (11), and the Asp718-BamHI fragment of PGc9, a cDNA of mDP (12), were subcloned into the EcoRV sites and the Asp718 and BamHI sites of pCMX, respectively. Six types of mIP/DP chimeric receptors were then constructed (Fig. 2A). Six restriction sites of the mIP receptor cDNA (Asp718, PstI, PvuII, SphI, BspHI, BamHI), four restriction sites of the mDP receptor cDNA (BspHI, BspEI, PstI, BamHI), and newly introduced restriction sites (BamHI, SpeI, HaeII) were used to construct these chimeric receptor cDNAs so that they have no insertion or deletion in the amino acid sequences (Fig. 2B). The new restriction sites were introduced by PCR using oligonucleotides designed for each site (Table I). pCMX-mIP or -mDP (5 ng) was used as a template for amplification by PCR in a reaction mixture containing 10 mM Tris-HCl (pH 8.8), 50 mM KCl, 1.5 mM MgCl2, 0.1% Triton X-100, 10% dimethyl sulfoxide, 0.25 mM dNTPs, 1 unit of Pfu polymerase (Stratagene), and 20 pmol of each primer in a total volume of 20 µl. After a denaturation step at 94 °C for 3 min, 20 cycles of amplification step (94 °C for 1 min, 50 °C for 1 min, 72 °C for 3 min) were carried out and followed by a final elongation step of 3 min at 72 °C. PCR products were electrophoresed, excised, purified using DEAE membrane (Whatman International Ltd., Maidstone, U. K.), inserted into pCMX, and sequenced by the dideoxy chain termination method.


Fig. 2. Diagrams of the mIP, mDP, and chimeric receptors (panel A) and strategy for construction of chimeric receptors (panel B). Panel A, the part of receptors derived from the mIP receptor is shown by an open box, and that from the mDP receptor is shown by a closed box. Panel B, PCR products corresponding to the mIP sequence are shown by bold lines above each box of chimeric receptor cDNA and those to the mDP sequence by bold lines below each box. Sequences of primers used in PCR are shown in Table I. Numbers in parentheses indicate nucleotide numbers of the 5'- and 3'-termini of each fragment corrected for the residue numbers in the mIP receptor cDNA. Restriction sites used for construction are indicated.
[View Larger Version of this Image (30K GIF file)]

Table I. Primers used in PCR for amplification of the fragments of the mIP and mDP receptors


Fragment Sequence of 5' primera Sequence of 3' primera

I-1 TACCTGTACGCCCAGCTGGA AGGGATCCAGGATGGGGTTGAAGGCGTT
D-1 GTGGATCCCTGGATCTTCATCATCTTC GGGCTGCAGGAATTCGATCCGCGG
I-3 ACGTGCTTCTTGAGCCCTGCAGTG TCACTAGTAGGGCCATGAGACTGGCGTA
D-3 CTACTAGTCCTCGCAACCGTGGTGTGC GGGCTGCAGGAATTCGATCCGCGG
I-4 ACGTGCTTCTTGAGCCCTGCAGTG GCAATATTGCTGATGCTCGCCCAGGCC
D-4 AACAGCTGGTCACCTTGCGCCGGGGAGTGC GGGCTGCAGGAATTCGATCCGCGG
D-5 CCCTGCAGTCCTGGCTGCCTACGCGCA CTAGCTAGCTGGCCAGGATC
I-6 TAATACGACTCACTATAGGG CCAGCGCTAGCCCGTTGCCCACTACACC
D-6 CTAGCGCTGGTGCTGCTGGCGCG CTTCAGTGCTGATCCCTCTC

a All the sequences shown are from 5' to 3' direction.

The Chimeric IPN-V/DPVI-C Receptor

BspHI sites at equivalent positions in the mIP and mDP receptor cDNAs (Fig. 2B) were utilized to construct this chimeric receptor. Fragment D-2 was excised from pCMX-mDP by digesting with BspHI and BamHI, and fragment I-2 was excised from pCMX-mDP by digesting with SphI and BspHI. Both excised fragments were ligated into the SphI and BamHI sites of pCMX-mIP.

The Chimeric IPN-VII/DPC Receptor

Fragments I-1 and D-1 were amplified by PCR with the primer pairs shown in Table I to have a BamHI site (Fig. 2B). Fragment I-1 was digested with SphI and BamHI, and fragment D-1 was digested with BamHI and BspEI. Both digested fragments were ligated into the SphI and BspEI sites of pCMX-IPN-V/DPVI-C.

The Chimeric IPN-IV/DPV-C Receptor

Fragments I-3 and D-3 were amplified by PCR with primer pairs shown in Table I to have an SpeI site (Fig. 2B). Fragment I-3 was digested with SphI and SpeI, and fragment D-3 was digested with SpeI and BspEI. Both digested fragments were ligated into the SphI and BspEI sites of pCMX-IPN-V/DPVI-C.

The Chimeric IPN-III/DPIV-C Receptor

Fragments I-4 and D-4 were amplified by PCR with the primer pairs shown in Table I. In the D-4 fragment, the PvuII site was introduced (Fig. 2B). Fragment I-4 was digested with PstI and PvuII, and fragment D-4 was digested with PvuII and PstI. Both digested fragments were ligated into the PstI sites of pCMX-IPN-V/DPVI-C.

The Chimeric IPN-II/DPIII-C Receptor

Fragment D-5 was amplified by PCR with the primer pairs shown in Table I. In the D-5 fragment, the PstI site was introduced (Fig. 2B). Fragment D-5 was digested with PstI and ligated into the PstI sites of pCMX-IPN-V/DPVI-C.

The Chimeric IPN-I/DPII-C Receptor

Fragments I-6 and D-6 were amplified by PCR with the primer pairs shown in Table I to have HaeII (Fig. 2B). Fragment I-6 was digested with Asp718 and HaeII, and fragment D-6 was digested with HaeII and BspEI. Both digested fragments were ligated into the Asp718 and BspEI sites of pCMX-IPN-V/DPVI-C.

Ligand Binding Studies

For transient expression of each prostanoid receptor, COS 7 cells cultured in 15-cm dishes were transfected with 20 µg of plasmid DNA by the lipofection method (27). After culture for 60 h, the cells were harvested, and crude membranes were prepared as described (11). Briefly, harvested COS 7 cells were homogenized using a Potter-Elvehjem homogenizer in a solution containing 25 mM Tris-HCl (pH 7.5), 250 mM sucrose, 10 mM MgCl2, 1 mM EDTA, and 0.1 mM phenylmethylsulfonyl fluoride. The homogenate was centrifuged at 800 × g for 1 min. The supernatant was collected and centrifuged at 100,000 × g for 1 h. The pellet was suspended in 20 mM MES (pH 6.0) containing 10 mM MgCl2 and 1 mM EDTA (the suspension buffer), and used as crude membranes. Binding assays were performed essentially as described previously (11). For Scatchard analysis, 50 µg of crude membranes was incubated in the suspension buffer with various concentrations of [3H]iloprost, [3H]PGE1, [3H]PGE2, [3H]PGD2, or [3H]PGF2alpha in a total volume of 200 µl at 4 °C for 2 h. In competition experiments, the crude membranes were incubated with 20 nM [3H]PGE1 or 60 nM [3H]PGD2 in the presence of various concentrations of PGD1 or PGD2. The incubation was terminated by the addition of 2 ml of the ice-cold suspension buffer, and the mixture was rapidly filtered through GF/C filters (Whatman). The filter was then washed with 5 ml of the ice-cold suspension buffer three times. The radioactivity on the filter was measured in 5 ml of Clear-Sol scintillation mixture (Nakalai Tesque, Kyoto, Japan). Nonspecific binding was determined in the presence of a 1,000-fold excess of unlabeled ligands in the incubation mixture. Ki values were calculated from IC50 values of radioligand binding as described previously (20).


RESULTS

The mIP, mDP, and six chimeric receptors were expressed in COS 7 cells, and crude membranes were prepared for binding studies. Crude membranes were incubated with various concentrations of each of [3H]iloprost, [3H]PGE1, [3H]PGE2, [3H]PGD2, and [3H]PGF2alpha (Fig. 3). Saturation kinetics of these binding was obtained and subjected to Scatchard analysis. Representative analyses are shown in Fig. 4, and the results of several analyses are summarized in Table II. As shown in Fig. 4, A and a, the mIP receptor showed saturation binding to [3H]iloprost and [3H]PGE1, and Scatchard analysis revealed respective Kd values of 13 ± 2 and 27 ± 5 nM (Table II). Binding was observed also with [3H]PGD2 and [3H]PGE2, but their affinities were too low to be analyzed by the Scatchard analysis. This ligand binding specificity of the mIP receptor is consistent with previous reports on the cloned mIP receptor (11) and on native IP receptor in various cells (28, 29). On the other hand, the mDP receptor showed a high affinity binding only to [3H]PGD2 with a Kd value of 43 ± 6 nM (Fig. 4, H and h, and Table II). This is also consistent with previous reports on the cloned mouse and human DP receptors (12, 30) and on native human DP receptor (31). We then examined the binding properties of the chimeric receptors. The carboxyl tail of the mIP receptor was first replaced with that of the mDP receptor. This chimeric IPN-VII/DPC receptor showed a 12-16-fold increase in binding affinity to [3H]iloprost and [3H]PGE1 without an appreciable increase in the binding of [3H]PGE2 and [3H]PGD2 (Fig. 4, B and b, and Table II). The sixth to seventh transmembrane domain was then further replaced. The resultant chimeric IPN-V/DPVI-C receptor acquired the ability to bind [3H]PGD2 and [3H]PGE2 with Kd values of 69 ± 16 and 40 ± 6 nM, respectively. They bound [3H]iloprost and [3H]PGE1 with affinities comparable to those of the mIP receptor with Kd values of 11 ± 1 and 17 ± 8 nM, respectively (Fig. 4, C and c, and Table II). Similar ligand binding properties were shown by the chimeric IPN-IV/DPV-C and IPN-III/DPIV-C receptors, which have further substitution of the fifth and fourth transmembrane domains (Fig. 4, D and d, E and e, and Table II); they bound both [3H]PGE2 and [3H]PGD2 in addition to [3H]iloprost and [3H]PGE1 with affinities similar to those of the chimeric IPN-V/DPVI-C receptor. In contrast, the binding of [3H]iloprost, [3H]PGE1, and [3H]PGE2 was almost abolished when the first extracellular to second intracellular loop of the mIP receptor was replaced with that of the mDP receptor (Fig. 4, F and f). This chimeric IPN-II/DPIII-C receptor, on the other hand, showed about a 2-fold increase in the binding affinity for [3H]PGD2. The Kd value of 35 ± 3 nM was close to the value of the mDP receptor (Table II). Similar ligand binding specificity was exhibited by the chimeric IPN-I/DPII-C receptor (Fig. 4, G and g, and Table II).


Fig. 3. Structures of ligands used in this study. Structures of PGD1, PGD2, PGE1, PGE2, PGF2alpha , and a PGI2 analog, iloprost, are shown.
[View Larger Version of this Image (23K GIF file)]


Fig. 4. Saturation binding and Scatchard analyses of the mIP, mDP, and chimeric mIP/DP receptors. Specific binding of [3H]iloprost (square ), [3H]PGE1 (bullet ), [3H]PGE2 (open circle ), [3H]PGD2 (black-triangle), and [3H]PGF2alpha (black-square) to the membrane of COS 7 cells expressing each receptor shown above (panels A-H) and Scatchard plots of the respective binding data (panels a-h) are shown. Representative results of more than three experiments are shown.
[View Larger Version of this Image (43K GIF file)]

Table II. Summary of binding studies on the mIP, mDP, and chimeric IP/DP receptors


Compounds Kd
mIP IPN-VII/DPC IPN-V/DPVI-C IPN-IV/DPV-C IPN-III/DPIV-C IPN-II/DPIII-C IPN-I/DPII-C mDP

nM
Iloprost 13  ± 2 (4)a 1.1  ± 1 (3) 11  ± 1 (3) 11  ± 1 (3) 10  ± 0.6 (3) >150 >150 >150
PGE1 27  ± 5 (3) 1.7  ± 0.2 (3) 17  ± 8 (3) 10  ± 1 (3) 10  ± 1 (3) >150 >150 >150
PGE2 >150 >150 40  ± 6 (3) 35  ± 2 (3) 36  ± 2 (3) >150 >150 >150
PGD2 >150 >150 69  ± 16 (3) 83  ± 29 (3) 86  ± 18 (3) 35  ± 3 (3) 43  ± 3 (3) 43  ± 6 (5)
PGF2alpha >150 >150 >150 >150 >150 >150 >150 >150
Bmax (pmol/mg) 1.8-3.0 0.3-0.8 1.0-1.8  2.5-10.0 1.2-3.0 0.3-0.9 0.3-2.6 1.0-2.0

a Mean ± S.E., with the number of independent determinations indicated in parentheses.

The above results indicate that the mIP receptor may accommodate the cyclopentane ring structure of PGD and that it exerts its ligand binding specificity mainly by discriminating the structural difference in the alpha -side chain. To examine this hypothesis, PGD1 binding was analyzed by competition binding studies on the mIP, mDP, and chimeric IPN-V/DPVI-C receptors using [3H]PGE1 or [3H]PGD2 as a radioligand (Fig. 5). PGD1 effectively displaced [3H]PGD2 binding to the mDP receptor with a Ki value of 990 nM. PGD1 also displaced [3H]PGE1 binding to the chimeric IPN-V/DPVI-C receptor with the Ki values of 2.5 µM. On the other hand, PGD1 as well as PGD2 could not displace [3H]PGE1 binding to the mIP receptor at up to a 10 µM concentration.


Fig. 5. Competition by PGD1, PGD2, and PGE1 of [3H]PGE1 binding to the mIP receptor (panel A) and to the chimeric IPN-V/DPVI-C receptor (panel B) and of [3H]PGD2 binding to the mDP receptor (panel C). Radioligand binding was assessed in the presence of various concentrations of PGE1 (black-square), PGD1 (bullet ), and PGD2 (open circle ) and expressed as percent binding compared with the control without a competitor.
[View Larger Version of this Image (23K GIF file)]


DISCUSSION

The present study used chimeric receptors and examined domains of the prostanoid receptors conferring the ligand binding specificity of each receptor. The receptors we used are the mIP, mDP, and chimeric mIP/DP receptors. As shown under "Results," the mIP receptor shows high affinity binding only to [3H]iloprost and [3H]PGE1, and the binding of [3H]PGD2, [3H]PGE2, and [3H]PGF2alpha is negligible. These binding properties indicate that the mIP receptor exerts its ligand binding specificity in two ways. One is the recognition of the configuration of the side chains. PGI has a unique configuration of the alpha -side chain because of the presence of an additional ring attached to the cyclopentane ring. It is believed that PGE1 without a double bond in the alpha -side chain can mimic this configuration of the PGI molecule and bind to the IP receptor, but this is not achieved by PGE2. The other is the recognition of the cyclopentane ring structure. It appears that this receptor can accommodate the cyclopentane rings of I and E types of PG, but not D and F. However, the specificity of this receptor for the cyclopentane ring structure appears less strict than those of other prostanoid receptors including the mDP receptor. As shown, the mDP receptor can bind only [3H]PGD2 with high affinity, and the binding affinities for E, F, and I types of PG are much lower. This indicates that the mDP receptor has strict recognition of the cyclopentane ring structure. Therefore, questions addressed in this study were which region(s) of the IP receptor discriminate PGE1 and PGE2, which region(s) of the IP receptor and how strictly they accommodate the cyclopentane ring, and which region(s) of the DP receptor determines the specific recognition of the cyclopentane ring of D type.

We examined these questions by successively replacing the regions of the mIP receptor with those of the mDP receptor from the carboxyl terminus. Replacement of the region extending from the sixth transmembrane to the carboxyl terminus of the mIP receptor resulted in loss of ligand binding specificity of the mIP receptor mentioned above. This chimeric IPN-V/DPVI-C receptor bound [3H]PGD2 and [3H]PGE2 as well as [3H]iloprost and [3H]PGE1. The fact that this chimera binds PGE2, whereas neither mIP nor mDP binds this prostanoid, suggests that the domains recognizing the ring structure and the side chain configuration of prostanoid molecules are located in different regions of the prostanoid receptors. Because such a change was not observed in the chimeric IPN-VII/DPC receptor, these results suggest that the sixth to seventh transmembrane domain is responsible for recognition of the side chain configuration; this region of mDP appears to accommodate both 1 and 2 series of the prostanoid molecules, whereas that of mIP appears more strict, discriminating a structural difference in the alpha -side chain between PGE1 and PGE2. A more detailed analysis is required to locate an exact domain conferring this selectivity. The above results also suggest that the binding pocket of the mIP receptor for the cyclopentane ring of prostanoid molecules is localized in another region and can accommodate the cyclopentane rings of not only I and E but also D type, although we cannot exclude the possibility that the sixth to seventh transmembrane domain of the mDP receptor has contributed to accommodate the cyclopentane ring of D type in this chimeric receptor. Interestingly, the affinities for [3H]PGE1 and [3H]iloprost were not changed by further replacement of the fourth and fifth transmembrane domains, suggesting that the binding domain of the cyclopentane ring in the mIP receptor localizes in a region containing the first to third transmembrane domain. We have examined if the binding specificity of the mIP receptor is determined solely by recognition of the side chain structure by analyzing the binding of PGD1 to the mIP. As shown in Fig. 5, no appreciable binding of PGD1 was observed in the mIP receptor, suggesting that if the mIP receptor can accommodate the cyclopentane ring of D type, the relative configuration between the cyclopentane ring and the side chains is also important in determining the ligand binding affinity. On the other hand, PGD1 bound to the chimeric IPN-V/DPVI-C receptor, suggesting that the sixth to seventh transmembrane domain of the mIP receptor is also responsible for determining this binding specificity. Moreover, the facts that the affinity of PGD1 for the chimeric IPN-V/DPVI-C receptor was 1 order of magnitude lower than that of PGD2 and that this rank of binding is identical to that observed in the mDP receptor may indicate that the sixth to seventh transmembrane domain of the mDP receptor is responsible for determining these affinities.

A region determining the specificity of the mDP receptor was suggested by further replacement of the first extracellular to second intracellular loop of the mIP receptor with the corresponding region of the mDP receptor. This replacement resulted in loss of the binding of iloprost and E type of PGs but increased the binding affinity for PGD2. These observations indicate first that this region of the mIP receptor is indispensable for iloprost, PGE1, and PGE2 binding, and second and more importantly that this region of mDP receptor may be responsible for the ligand binding selectivity of this receptor. Then, which domain in this region is responsible for this selectivity? The ligand binding pocket in most rhodopsin-type receptors for small molecules is formed by transmembrane domains. If this is also the case for the prostanoid receptors, we can assume that the third transmembrane domain is responsible for the above selectivity. Surprisingly, the third transmembrane domain has only four amino acids different between the mIP and mDP receptors (Fig. 1). If this domain is responsible, it would be intriguing to examine if any of these four amino acids has an important influence on the recognition of the cyclopentane ring. The functional groups at the 9- and 11-positions of the cyclopentane ring of PG molecules are either oxo or hydroxy groups. One hypothesis is that these groups are involved in formation of hydrogen bonds to some amino acids of the prostanoid receptors. The vicinal hydroxyl groups of the catechol ring are shown to be involved in formation of hydrogen bonds to Ser204 and Ser207 of the beta 2-adrenergic receptor (32-34). These issues may be tested by construction of more detailed chimeric receptors in this region.

This investigation has also revealed that the affinities for iloprost and PGE1 of the mIP receptor are increased 12- and 16-fold by replacement of its carboxyl tail with that of the mDP receptor. There have been several reports concerning the effects of carboxyl tails of the rhodopsin-type receptors. We observed that alternative splicing of the EP3 and TP receptor in the carboxyl tail affects the specificity and efficacy of G-protein coupling (35, 36) as well as the sensitivity to agonist-induced desensitization (37). However, none of them showed a change in ligand binding properties. Whether a difference in the carboxyl tail increases the ligand binding affinity remains to be tested because our IPN-VII/DPC receptor also contains the replacement of several residues of the seventh transmembrane domain (Fig. 1).

In summary, the present study has identified the domains of the mIP and mDP receptors which confer ligand binding specificities to each receptor. Continued application of molecular biology including introduction of a point mutation to the identified regions will provide a more detailed understanding of the molecular basis of ligand recognition by the prostanoid receptors and will help design more specific therapeutic agents.


FOOTNOTES

*   This work was supported in part by grants-in-aid for scientific research from the Ministry of Education, Science, and Culture of Japan and by grants from the Japanese Society for Promotion of Science, the Smoking Research Foundation, the Uehara Memorial Foundation, and the Japanese Foundation on Metabolism and Diseases.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Dagger    To whom correspondence should be addressed. Tel.: 81-75-753-4392; Fax: 81-75-753-4693; E-mail: snaru{at}mfour.med.kyoto-u.ac.jp.
1   The abbreviations used are: PG(s), prostaglandin(s); G protein, heterotrimeric GTP-binding protein; PCR, polymerase chain reaction; MES, 4-morpholineethanesulfonic acid.

ACKNOWLEDGEMENT

We are grateful to T. Murata, H. Sawaragi, and T. Matsuoka of our department and H. Wise of the Chinese University, Hong Kong, for helpful discussions and comments, and to K. Okuyama for secretarial assistance.


REFERENCES

  1. Coleman, R. A., Kennedy, I., Humphrey, P. P. A., Bunce, K., and Lumley, P. (1990) in Comprehensive Medicinal Chemistry (Hansch, C., Sammes, P. G., Taylor, J. B., and Emmett, J. C., eds), Vol. 3, pp. 643-714, Pergamon Press, Oxford
  2. Samuelsson, B., Goldyne, M., Granström, E., Hamberg, M., Hammarstörm, S., and Malmsten, C. (1978) Annu. Rev. Biochem 47, 997-1029 [CrossRef][Medline] [Order article via Infotrieve]
  3. Moncada, S., Flower, R. J., and Vane, J. R. (1985) in The Pharmacological Basis of Therapeutics (Gilman, A. G., Goodman, L. S., Rall, T. W., and Murad, F., eds), 7th Ed., pp. 660-673, Macmillan, New York
  4. Halushka, P. V., Mais, D. E., Mayeux, P. R., and Morinelli, T. A. (1989) Annu. Rev. Pharmacol. Toxicol. 29, 213-239 [CrossRef][Medline] [Order article via Infotrieve]
  5. Hirata, M., Hayashi, Y., Ushikubi, F., Yokota, Y., Kageyama, R., Nakanishi, S., and Narumiya, S. (1991) Nature 349, 617-620 [CrossRef][Medline] [Order article via Infotrieve]
  6. Namba, T., Sugimoto, Y., Hirata, M., Hayashi, Y., Honda, A., Watabe, A., Negishi, M., Ichikawa, A., and Narumiya, S. (1992) Biochem. Biophys. Res. Commun. 184, 1197-1203 [CrossRef][Medline] [Order article via Infotrieve]
  7. Sugimoto, Y., Namba, T., Honda, A., Hayashi, Y., Negishi, M., Ichikawa, A., and Narumiya, S. (1992) J. Biol. Chem. 267, 6463-6466 [Abstract/Free Full Text]
  8. Honda, A., Sugimoto, Y., Namba, T., Watabe, A., Irie, A., Negishi, M., Narumiya, S., and Ichikawa, A. (1993) J. Biol. Chem. 268, 7759-7762 [Abstract/Free Full Text]
  9. Watabe, A., Sugimoto, Y., Honda, A., Irie, A., Namba, T., Negishi, M., Ito, S., Narumiya, S., and Ichikawa, A. (1993) J. Biol. Chem. 268, 20175-20178 [Abstract/Free Full Text]
  10. Sugimoto, Y., Hasumoto, K., Namba, T., Irie, A., Katsuyama, M., Negishi, M., Kakizuka, A., Narumiya, S., and Ichikawa, A. (1994) J. Biol. Chem. 269, 1356-1360 [Abstract/Free Full Text]
  11. Namba, T., Oida, H., Sugimoto, Y., Kakizuka, A., Negishi, M., Ichikawa, A., and Narumiya, S. (1994) J. Biol. Chem. 269, 9986-9992 [Abstract/Free Full Text]
  12. Hirata, M., Kakizuka, A., Aizawa, M., Ushikubi, F., and Narumiya, S. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 11192-11196 [Abstract/Free Full Text]
  13. Katsuyama, M., Nishigaki, N., Sugimoto, Y., Morimoto, K., Negishi, M., Narumiya, S., and Ichikawa, A. (1995) FEBS Lett. 372, 151-156 [CrossRef][Medline] [Order article via Infotrieve]
  14. Ushikubi, F., Hirata, M., and Narumiya, S. (1995) J. Lipid Mediators 12, 343-359
  15. Narumiya, S., Hirata, M., Namba, T., Hayashi, Y., Ushikubi, S., Sugimoto, Y., Negishi, M., and Ichikawa, A. (1993) J. Lipid Mediators 6, 155-161 [Medline] [Order article via Infotrieve]
  16. Funk, C. D., Furci, L., Moran, N., and Fitzgerald, G. A. (1993) Mol. Pharmacol. 44, 934-939 [Abstract]
  17. Kobilka, B. K., Kobilka, T. S., Daniel, K., Regan, J. W., Caron, M. G., and Lefkowitz, R. J. (1988) Science 240, 1310-1316 [Abstract/Free Full Text]
  18. Frielle, T., Daniel, K. W., Caron, M. G., and Lefkowitz, R. J. (1988) Proc. Natl. Acad. Sci. U. S. A 85, 9494-9498 [Abstract/Free Full Text]
  19. Gether, U., Johansen, T. E., Snider, R. M., Lowe, J. A., Nakanishi, S., and Schwartz, T. W. (1993) Nature 362, 345-348 [CrossRef][Medline] [Order article via Infotrieve]
  20. Gether, U., Yokota, Y., Emonds, A. X., Breliere, J. C., Lowe, J. A., Snider, R. M., Nakanishi, S., and Schwartz, T. W. (1993) Proc. Natl. Acad. Sci. U. S. A 90, 6194-6198 [Abstract/Free Full Text]
  21. Fong, T. M., Yu, H., and Strader, C. D. (1992) J. Biol. Chem. 267, 25668-25671 [Abstract/Free Full Text]
  22. Sachais, B. S., Snider, R. M., Lowe, J. A., III, and Krause, J. E. (1993) J. Biol. Chem. 268, 2319-2323 [Abstract/Free Full Text]
  23. Schambye, H. T., Hjorth, S. A., Bergsma, D. J., Sathe, G., and Schwartz, T. W. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 7046-7050 [Abstract/Free Full Text]
  24. Wong, S. K. F., and Ross, E. M. (1994) J. Biol. Chem. 269, 18968-18976 [Abstract/Free Full Text]
  25. Toh, H., Ichikawa, A., and Narumiya, S. (1995) FEBS Lett. 361, 17-21 [CrossRef][Medline] [Order article via Infotrieve]
  26. Umesono, K., Murakami, K. K., Thompson, C. C., and Evans, R. M. (1991) Cell 65, 1255-1266 [CrossRef][Medline] [Order article via Infotrieve]
  27. Felgner, P. L., Gadek, T. R., Holm, M., Roman, R., Chan, H. W., Wenz, M., Northrop, J. P., Ringold, G. M., and Danielsen, M. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 7413-7417 [Abstract/Free Full Text]
  28. Tsai, A., Hsu, M.-J., Vijjeswarapu, H., and Wu, K. K. (1989) J. Biol. Chem. 264, 61-67 [Abstract/Free Full Text]
  29. Leigh, P. J., Cramp, W. A., and MacDermot, J. (1984) J. Biol. Chem. 259, 12431-12436 [Abstract/Free Full Text]
  30. Boie, Y., Sawyer, N., Slipetz, D. M., Metters, K. M., and Abramovitz, M. (1995) J. Biol. Chem. 270, 18910-18916 [Abstract/Free Full Text]
  31. Town, M. H., Casals-Stenzel, J., and Schillinger, E. (1983) Prostaglandins 25, 13-28 [CrossRef][Medline] [Order article via Infotrieve]
  32. Strader, C. D., Candelore, M. R., Hill, W. S., Sigal, I. S., and Dixon, R. A. F. (1989) J. Biol. Chem. 264, 13572-13578 [Abstract/Free Full Text]
  33. Dixon, R. A. F., Sigal, I. S., and Strader, C. D. (1988) Cold Spring Harbor Symp. Quant. Biol. 53, 487-497
  34. Strader, C. D., Gaffney, T., Sugg, E. E., Candelore, M. R., Keys, R., Patchett, A. A., and Dixon, R. A. F. (1991) J. Biol. Chem. 266, 5-8 [Abstract/Free Full Text]
  35. Namba, T., Sugimoto, Y., Negishi, M., Irie, A., Ito, S., Ichikawa, A., and Narumiya, S. (1993) Nature 365, 166-170 [CrossRef][Medline] [Order article via Infotrieve]
  36. Sugimoto, Y., Negishi, M., Hayashi, Y., Watabe, A., Hirata, M., Namba, T., Honda, A., Narumiya, S., and Ichikawa, A. (1993) J. Biol. Chem. 268, 2712-2718 [Abstract/Free Full Text]
  37. Negishi, M., Sugimoto, Y., Irie, A., Narumiya, S., and Ichikawa, A. (1993) J. Biol. Chem. 268, 9517-9521 [Abstract/Free Full Text]
  38. Kyte, J., and Doolittle, R. F. (1982) J. Mol. Biol. 157, 105-132 [CrossRef][Medline] [Order article via Infotrieve]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Pharmacol. Exp. Ther.Home page
N. Gonzalez, S. J. Hocart, S. Portal-Nunez, S. A. Mantey, T. Nakagawa, E. Zudaire, D. H. Coy, and R. T. Jensen
Molecular Basis for Agonist Selectivity and Activation of the Orphan Bombesin Receptor Subtype 3 Receptor
J. Pharmacol. Exp. Ther., February 1, 2008; 324(2): 463 - 474.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. N. Hata, T. P. Lybrand, and R. M. Breyer
Identification of Determinants of Ligand Binding Affinity and Selectivity in the Prostaglandin D2 Receptor CRTH2
J. Biol. Chem., September 16, 2005; 280(37): 32442 - 32451.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Stitham, A. Stojanovic, B. L. Merenick, K. A. O'Hara, and J. Hwa
The Unique Ligand-binding Pocket for the Human Prostacyclin Receptor. SITE-DIRECTED MUTAGENESIS AND MOLECULAR MODELING
J. Biol. Chem., January 31, 2003; 278(6): 4250 - 4257.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Martinez del Pozo, V. Lacadena, J. M. Mancheno, N. Olmo, M. Onaderra, and J. G. Gavilanes
The Antifungal Protein AFP of Aspergillus giganteus Is an Oligonucleotide/Oligosaccharide Binding (OB) Fold-containing Protein That Produces Condensation of DNA
J. Biol. Chem., November 22, 2002; 277(48): 46179 - 46183.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Stitham, A. Stojanovic, and J. Hwa
Impaired Receptor Binding and Activation Associated with a Human Prostacyclin Receptor Polymorphism
J. Biol. Chem., May 3, 2002; 277(18): 15439 - 15444.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
J. Stitham, K. A. Martin, and J. Hwa
The Critical Role of Transmembrane Prolines in Human Prostacyclin Receptor Activation
Mol. Pharmacol., May 1, 2002; 61(5): 1202 - 1210.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
S. Narumiya, Y. Sugimoto, and F. Ushikubi
Prostanoid Receptors: Structures, Properties, and Functions
Physiol Rev, October 1, 1999; 79(4): 1193 - 1226.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
F. Neuschäfer-Rube, M. Oppermann, U. Möller, U. Böer, and G. P. Püschel
Agonist-Induced Phosphorylation by G Protein-Coupled Receptor Kinases of the EP4 Receptor Carboxyl-Terminal Domain in an EP3/EP4 Prostaglandin E2 Receptor Hybrid
Mol. Pharmacol., August 1, 1999; 56(2): 419 - 428.
[Abstract] [Full Text]


Home page
Mol. Pharmacol.Home page
K. M. Kedzie, J. E. Donello, H. A. Krauss, J. W. Regan, and D. W. Gil
A Single Amino-Acid Substitution in the EP2 Prostaglandin Receptor Confers Responsiveness to Prostacyclin Analogs
Mol. Pharmacol., September 1, 1998; 54(3): 584 - 590.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
T. H. Ji, M. Grossmann, and I. Ji
G Protein-coupled Receptors. I. DIVERSITY OF RECEPTOR-LIGAND INTERACTIONS
J. Biol. Chem., July 10, 1998; 273(28): 17299 - 17302.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Kobayashi, F. Ushikubi, and S. Narumiya
Amino Acid Residues Conferring Ligand Binding Properties of Prostaglandin I and Prostaglandin D Receptors. IDENTIFICATION BY SITE-DIRECTED MUTAGENESIS
J. Biol. Chem., August 4, 2000; 275(32): 24294 - 24303.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Tokita, S. J. Hocart, T. Katsuno, S. A. Mantey, D. H. Coy, and R. T. Jensen
Tyrosine 220 in the 5th Transmembrane Domain of the Neuromedin B Receptor Is Critical for the High Selectivity of the Peptoid Antagonist PD168368
J. Biol. Chem., January 5, 2001; 276(1): 495 - 504.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kobayashi, T.
Right arrow Articles by Narumiya, S.