INTRODUCTION

Prostaglandins (PGs)¹ contain prostanoic acid as a central structural element. PGs have two structural features in the prostanoic acid framework. First, they have functional groups on the cyclopentane ring, which classifies them into four types, D, E, F, and I. Second, they are classified into three series, 1, 2, and 3, by the number of double bonds in the side chains. Additionally, another cyclooxygenase product, thromboxane A₂ has an oxane ring instead of the cyclopentane ring. These prostanoids act on eight types and subtypes of the receptors. They are the PGD receptor (DP), the EP₁, EP₂, EP₃, and EP₄ subtypes of the PGE receptor, the PGF receptor (FP), the PGI receptor (IP), and the thromboxane A₂ receptor (TP) (1-4). These receptors can recognize the structural differences of prostanoid molecules. The binding affinities of these receptors to prostanoid molecules are determined primarily by the cyclopentane ring structures of ligands. For example, the DP receptor shows the highest affinities to PGD₂ and PGD₁, but affinities to other prostanoids are at least 2 orders of magnitude less. One exception is the IP receptor, which shows the affinity to PGE₁ almost comparable to PGI analogs such as iloprost. This receptor, however, can bind PGE₂ with much lower affinity, suggesting that the IP receptor can discriminate a difference in the side chains.

We have cloned cDNAs for all of these types and subtypes of the mouse prostanoid receptors (5-13). These studies revealed that the prostanoid receptors belong to the G protein-coupled rhodopsin type receptor superfamily. They have several regions conserved specifically among them. These conserved regions may participate in the construction of binding domains for structures common to prostanoid molecules, whereas the other regions may confer specificity for ligand binding. For example, the arginine in the seventh transmembrane domain, which is conserved in all of the prostanoid receptors, was proposed to be the binding site for the carboxyl group of prostanoid molecules (5, 14, 15). In fact, Funk et al. (16) have shown that a point mutation at this arginine residue in the human TP receptor results in loss of ligand binding activity. However, structural domains of the prostanoid receptors conferring specificity for ligand binding are as yet unknown.

Chimeric receptors have been used to determine the regions involved in various functions of the receptors. For example, this approach was used to determine the regions involved in selective agonist and antagonist binding in adrenergic receptors (17, 18). Chimeric receptors were also used to identify the binding site of non-peptide antagonists to the neurokinin receptors (19-22) and to the angiotensin receptors (23) and the G protein activation sites of the muscarinic and ₁-adrenergic receptors (24). These results show that this approach has been useful in locating functional domains of various receptors.

To identify the domains conferring the ligand binding specificity to the prostanoid receptors, we have constructed chimeric receptors from the mIP and mDP receptors in this study. This strategy is based on the high homology of their amino acid sequences as well as common signal transduction. The prostanoid receptors can be functionally grouped into three categories: the relaxant receptors, the contractile receptors, and the inhibitory receptor (14). The relaxant receptors, consisting of the IP, DP, EP₂, and EP₄ receptors, mediate increases in cAMP and induce smooth muscle relaxation. The contractile receptors, consisting of the TP, FP, and EP₁ receptors, mediate calcium mobilization and induce smooth muscle contraction. The EP₃ receptor is an inhibitory receptor that mediates decreases in cAMP and inhibits several biological processes such as neurotransmission, gastric acid secretion, and water reabsorption. Sequence homology among these functionally related receptors is higher than that among the three separate groups (25). The amino acid sequences of the mIP and mDP receptors, which belong to the same relaxant receptor group, show 58% identity in the transmembrane domains (Fig. 1), and both couple to the same G protein, Gs. Chimeric mIP/DP receptors were expressed in the COS 7 cells, and their ligand binding properties were examined.

EXPERIMENTAL PROCEDURES

PGD₂, PGE₁, PGE₂, and PGF₂ were generous gifts from Ono Pharmaceuticals Co. Ltd. (Osaka, Japan). PGD₁ was obtained from Cayman Chemical Co. (Ann Arbor, MI). [5,6,8,9,12,14,15-³H]PGD₂ (115 Ci/mmol), [5,6-³H]PGE₁ (52 Ci/mmol), [5, 6,8,11,12,14,15-³H]PGE₂ (171 Ci/mmol), and [5,6,8,9,11,12,14,15-³H]PGF₂ (179 Ci/mmol) were obtained from DuPont NEN. Iloprost and [³H]iloprost (15.3 Ci/mmol) were obtained from Amersham International plc, United Kingdom.

The mIP and mDP cDNAs were first subcloned into pCMX expression vector (26). The BalI-EcoRV fragment of CP302, a cDNA of mIP (11), and the Asp718-BamHI fragment of PGc9, a cDNA of mDP (12), were subcloned into the EcoRV sites and the Asp718 and BamHI sites of pCMX, respectively. Six types of mIP/DP chimeric receptors were then constructed (Fig. 2A). Six restriction sites of the mIP receptor cDNA (Asp718, PstI, PvuII, SphI, BspHI, BamHI), four restriction sites of the mDP receptor cDNA (BspHI, BspEI, PstI, BamHI), and newly introduced restriction sites (BamHI, SpeI, HaeII) were used to construct these chimeric receptor cDNAs so that they have no insertion or deletion in the amino acid sequences (Fig. 2B). The new restriction sites were introduced by PCR using oligonucleotides designed for each site (Table I). pCMX-mIP or -mDP (5 ng) was used as a template for amplification by PCR in a reaction mixture containing 10 mM Tris-HCl (pH 8.8), 50 mM KCl, 1.5 mM MgCl₂, 0.1% Triton X-100, 10% dimethyl sulfoxide, 0.25 mM dNTPs, 1 unit of Pfu polymerase (Stratagene), and 20 pmol of each primer in a total volume of 20 µl. After a denaturation step at 94 °C for 3 min, 20 cycles of amplification step (94 °C for 1 min, 50 °C for 1 min, 72 °C for 3 min) were carried out and followed by a final elongation step of 3 min at 72 °C. PCR products were electrophoresed, excised, purified using DEAE membrane (Whatman International Ltd., Maidstone, U. K.), inserted into pCMX, and sequenced by the dideoxy chain termination method.

Table I. Primers used in PCR for amplification of the fragments of the mIP and mDP receptors Fragment Sequence of 5 primera Sequence of 3 primera I-1 TACCTGTACGCCCAGCTGGA AGGGATCCAGGATGGGGTTGAAGGCGTT D-1 GTGGATCCCTGGATCTTCATCATCTTC GGGCTGCAGGAATTCGATCCGCGG I-3 ACGTGCTTCTTGAGCCCTGCAGTG TCACTAGTAGGGCCATGAGACTGGCGTA D-3 CTACTAGTCCTCGCAACCGTGGTGTGC GGGCTGCAGGAATTCGATCCGCGG I-4 ACGTGCTTCTTGAGCCCTGCAGTG GCAATATTGCTGATGCTCGCCCAGGCC D-4 AACAGCTGGTCACCTTGCGCCGGGGAGTGC GGGCTGCAGGAATTCGATCCGCGG D-5 CCCTGCAGTCCTGGCTGCCTACGCGCA CTAGCTAGCTGGCCAGGATC I-6 TAATACGACTCACTATAGGG CCAGCGCTAGCCCGTTGCCCACTACACC D-6 CTAGCGCTGGTGCTGCTGGCGCG CTTCAGTGCTGATCCCTCTC a All the sequences shown are from 5 to 3 direction.

BspHI sites at equivalent positions in the mIP and mDP receptor cDNAs (Fig. 2B) were utilized to construct this chimeric receptor. Fragment D-2 was excised from pCMX-mDP by digesting with BspHI and BamHI, and fragment I-2 was excised from pCMX-mDP by digesting with SphI and BspHI. Both excised fragments were ligated into the SphI and BamHI sites of pCMX-mIP.

Fragments I-1 and D-1 were amplified by PCR with the primer pairs shown in Table I to have a BamHI site (Fig. 2B). Fragment I-1 was digested with SphI and BamHI, and fragment D-1 was digested with BamHI and BspEI. Both digested fragments were ligated into the SphI and BspEI sites of pCMX-IP_N-V/DP_VI-C.

Fragments I-3 and D-3 were amplified by PCR with primer pairs shown in Table I to have an SpeI site (Fig. 2B). Fragment I-3 was digested with SphI and SpeI, and fragment D-3 was digested with SpeI and BspEI. Both digested fragments were ligated into the SphI and BspEI sites of pCMX-IP_N-V/DP_VI-C.

Fragments I-4 and D-4 were amplified by PCR with the primer pairs shown in Table I. In the D-4 fragment, the PvuII site was introduced (Fig. 2B). Fragment I-4 was digested with PstI and PvuII, and fragment D-4 was digested with PvuII and PstI. Both digested fragments were ligated into the PstI sites of pCMX-IP_N-V/DP_VI-C.

Fragment D-5 was amplified by PCR with the primer pairs shown in Table I. In the D-5 fragment, the PstI site was introduced (Fig. 2B). Fragment D-5 was digested with PstI and ligated into the PstI sites of pCMX-IP_N-V/DP_VI-C.

Fragments I-6 and D-6 were amplified by PCR with the primer pairs shown in Table I to have HaeII (Fig. 2B). Fragment I-6 was digested with Asp718 and HaeII, and fragment D-6 was digested with HaeII and BspEI. Both digested fragments were ligated into the Asp718 and BspEI sites of pCMX-IP_N-V/DP_VI-C.

For transient expression of each prostanoid receptor, COS 7 cells cultured in 15-cm dishes were transfected with 20 µg of plasmid DNA by the lipofection method (27). After culture for 60 h, the cells were harvested, and crude membranes were prepared as described (11). Briefly, harvested COS 7 cells were homogenized using a Potter-Elvehjem homogenizer in a solution containing 25 mM Tris-HCl (pH 7.5), 250 mM sucrose, 10 mM MgCl₂, 1 mM EDTA, and 0.1 mM phenylmethylsulfonyl fluoride. The homogenate was centrifuged at 800 × g for 1 min. The supernatant was collected and centrifuged at 100,000 × g for 1 h. The pellet was suspended in 20 mM MES (pH 6.0) containing 10 mM MgCl₂ and 1 mM EDTA (the suspension buffer), and used as crude membranes. Binding assays were performed essentially as described previously (11). For Scatchard analysis, 50 µg of crude membranes was incubated in the suspension buffer with various concentrations of [³H]iloprost, [³H]PGE₁, [³H]PGE₂, [³H]PGD₂, or [³H]PGF₂ in a total volume of 200 µl at 4 °C for 2 h. In competition experiments, the crude membranes were incubated with 20 nM [³H]PGE₁ or 60 nM [³H]PGD₂ in the presence of various concentrations of PGD₁ or PGD₂. The incubation was terminated by the addition of 2 ml of the ice-cold suspension buffer, and the mixture was rapidly filtered through GF/C filters (Whatman). The filter was then washed with 5 ml of the ice-cold suspension buffer three times. The radioactivity on the filter was measured in 5 ml of Clear-Sol scintillation mixture (Nakalai Tesque, Kyoto, Japan). Nonspecific binding was determined in the presence of a 1,000-fold excess of unlabeled ligands in the incubation mixture. K_i values were calculated from IC₅₀ values of radioligand binding as described previously (20).

RESULTS

The mIP, mDP, and six chimeric receptors were expressed in COS 7 cells, and crude membranes were prepared for binding studies. Crude membranes were incubated with various concentrations of each of [³H]iloprost, [³H]PGE₁, [³H]PGE₂, [³H]PGD₂, and [³H]PGF₂ (Fig. 3). Saturation kinetics of these binding was obtained and subjected to Scatchard analysis. Representative analyses are shown in Fig. 4, and the results of several analyses are summarized in Table II. As shown in Fig. 4, A and a, the mIP receptor showed saturation binding to [³H]iloprost and [³H]PGE₁, and Scatchard analysis revealed respective K_d values of 13 ± 2 and 27 ± 5 nM (Table II). Binding was observed also with [³H]PGD₂ and [³H]PGE₂, but their affinities were too low to be analyzed by the Scatchard analysis. This ligand binding specificity of the mIP receptor is consistent with previous reports on the cloned mIP receptor (11) and on native IP receptor in various cells (28, 29). On the other hand, the mDP receptor showed a high affinity binding only to [³H]PGD₂ with a K_d value of 43 ± 6 nM (Fig. 4, H and h, and Table II). This is also consistent with previous reports on the cloned mouse and human DP receptors (12, 30) and on native human DP receptor (31). We then examined the binding properties of the chimeric receptors. The carboxyl tail of the mIP receptor was first replaced with that of the mDP receptor. This chimeric IP_N-VII/DP_C receptor showed a 12-16-fold increase in binding affinity to [³H]iloprost and [³H]PGE₁ without an appreciable increase in the binding of [³H]PGE₂ and [³H]PGD₂ (Fig. 4, B and b, and Table II). The sixth to seventh transmembrane domain was then further replaced. The resultant chimeric IP_N-V/DP_VI-C receptor acquired the ability to bind [³H]PGD₂ and [³H]PGE₂ with K_d values of 69 ± 16 and 40 ± 6 nM, respectively. They bound [³H]iloprost and [³H]PGE₁ with affinities comparable to those of the mIP receptor with K_d values of 11 ± 1 and 17 ± 8 nM, respectively (Fig. 4, C and c, and Table II). Similar ligand binding properties were shown by the chimeric IP_N-IV/DP_V-C and IP_N-III/DP_IV-C receptors, which have further substitution of the fifth and fourth transmembrane domains (Fig. 4, D and d, E and e, and Table II); they bound both [³H]PGE₂ and [³H]PGD₂ in addition to [³H]iloprost and [³H]PGE₁ with affinities similar to those of the chimeric IP_N-V/DP_VI-C receptor. In contrast, the binding of [³H]iloprost, [³H]PGE₁, and [³H]PGE₂ was almost abolished when the first extracellular to second intracellular loop of the mIP receptor was replaced with that of the mDP receptor (Fig. 4, F and f). This chimeric IP_N-II/DP_III-C receptor, on the other hand, showed about a 2-fold increase in the binding affinity for [³H]PGD₂. The K_d value of 35 ± 3 nM was close to the value of the mDP receptor (Table II). Similar ligand binding specificity was exhibited by the chimeric IP_N-I/DP_II-C receptor (Fig. 4, G and g, and Table II).

2

2

Table II. Summary of binding studies on the mIP, mDP, and chimeric IP/DP receptors Compounds Kd mIP IPN-VII/DPC IPN-V/DPVI-C IPN-IV/DPV-C IPN-III/DPIV-C IPN-II/DPIII-C IPN-I/DPII-C mDP nM Iloprost 13  ± 2 (4)a 1.1  ± 1 (3) 11  ± 1 (3) 11  ± 1 (3) 10  ± 0.6 (3) >150 >150 >150 PGE1 27  ± 5 (3) 1.7  ± 0.2 (3) 17  ± 8 (3) 10  ± 1 (3) 10  ± 1 (3) >150 >150 >150 PGE2 >150 >150 40  ± 6 (3) 35  ± 2 (3) 36  ± 2 (3) >150 >150 >150 PGD2 >150 >150 69  ± 16 (3) 83  ± 29 (3) 86  ± 18 (3) 35  ± 3 (3) 43  ± 3 (3) 43  ± 6 (5) PGF2 >150 >150 >150 >150 >150 >150 >150 >150 Bmax (pmol/mg) 1.8-3.0 0.3-0.8 1.0-1.8  2.5-10.0 1.2-3.0 0.3-0.9 0.3-2.6 1.0-2.0 a Mean ± S.E., with the number of independent determinations indicated in parentheses.

The above results indicate that the mIP receptor may accommodate the cyclopentane ring structure of PGD and that it exerts its ligand binding specificity mainly by discriminating the structural difference in the -side chain. To examine this hypothesis, PGD₁ binding was analyzed by competition binding studies on the mIP, mDP, and chimeric IP_N-V/DP_VI-C receptors using [³H]PGE₁ or [³H]PGD₂ as a radioligand (Fig. 5). PGD₁ effectively displaced [³H]PGD₂ binding to the mDP receptor with a K_i value of 990 nM. PGD₁ also displaced [³H]PGE₁ binding to the chimeric IP_N-V/DP_VI-C receptor with the K_i values of 2.5 µM. On the other hand, PGD₁ as well as PGD₂ could not displace [³H]PGE₁ binding to the mIP receptor at up to a 10 µM concentration.

DISCUSSION

The present study used chimeric receptors and examined domains of the prostanoid receptors conferring the ligand binding specificity of each receptor. The receptors we used are the mIP, mDP, and chimeric mIP/DP receptors. As shown under "Results," the mIP receptor shows high affinity binding only to [³H]iloprost and [³H]PGE₁, and the binding of [³H]PGD₂, [³H]PGE₂, and [³H]PGF₂ is negligible. These binding properties indicate that the mIP receptor exerts its ligand binding specificity in two ways. One is the recognition of the configuration of the side chains. PGI has a unique configuration of the -side chain because of the presence of an additional ring attached to the cyclopentane ring. It is believed that PGE₁ without a double bond in the -side chain can mimic this configuration of the PGI molecule and bind to the IP receptor, but this is not achieved by PGE₂. The other is the recognition of the cyclopentane ring structure. It appears that this receptor can accommodate the cyclopentane rings of I and E types of PG, but not D and F. However, the specificity of this receptor for the cyclopentane ring structure appears less strict than those of other prostanoid receptors including the mDP receptor. As shown, the mDP receptor can bind only [³H]PGD₂ with high affinity, and the binding affinities for E, F, and I types of PG are much lower. This indicates that the mDP receptor has strict recognition of the cyclopentane ring structure. Therefore, questions addressed in this study were which region(s) of the IP receptor discriminate PGE₁ and PGE₂, which region(s) of the IP receptor and how strictly they accommodate the cyclopentane ring, and which region(s) of the DP receptor determines the specific recognition of the cyclopentane ring of D type.

We examined these questions by successively replacing the regions of the mIP receptor with those of the mDP receptor from the carboxyl terminus. Replacement of the region extending from the sixth transmembrane to the carboxyl terminus of the mIP receptor resulted in loss of ligand binding specificity of the mIP receptor mentioned above. This chimeric IP_N-V/DP_VI-C receptor bound [³H]PGD₂ and [³H]PGE₂ as well as [³H]iloprost and [³H]PGE₁. The fact that this chimera binds PGE₂, whereas neither mIP nor mDP binds this prostanoid, suggests that the domains recognizing the ring structure and the side chain configuration of prostanoid molecules are located in different regions of the prostanoid receptors. Because such a change was not observed in the chimeric IP_N-VII/DP_C receptor, these results suggest that the sixth to seventh transmembrane domain is responsible for recognition of the side chain configuration; this region of mDP appears to accommodate both 1 and 2 series of the prostanoid molecules, whereas that of mIP appears more strict, discriminating a structural difference in the -side chain between PGE₁ and PGE₂. A more detailed analysis is required to locate an exact domain conferring this selectivity. The above results also suggest that the binding pocket of the mIP receptor for the cyclopentane ring of prostanoid molecules is localized in another region and can accommodate the cyclopentane rings of not only I and E but also D type, although we cannot exclude the possibility that the sixth to seventh transmembrane domain of the mDP receptor has contributed to accommodate the cyclopentane ring of D type in this chimeric receptor. Interestingly, the affinities for [³H]PGE₁ and [³H]iloprost were not changed by further replacement of the fourth and fifth transmembrane domains, suggesting that the binding domain of the cyclopentane ring in the mIP receptor localizes in a region containing the first to third transmembrane domain. We have examined if the binding specificity of the mIP receptor is determined solely by recognition of the side chain structure by analyzing the binding of PGD₁ to the mIP. As shown in Fig. 5, no appreciable binding of PGD₁ was observed in the mIP receptor, suggesting that if the mIP receptor can accommodate the cyclopentane ring of D type, the relative configuration between the cyclopentane ring and the side chains is also important in determining the ligand binding affinity. On the other hand, PGD₁ bound to the chimeric IP_N-V/DP_VI-C receptor, suggesting that the sixth to seventh transmembrane domain of the mIP receptor is also responsible for determining this binding specificity. Moreover, the facts that the affinity of PGD₁ for the chimeric IP_N-V/DP_VI-C receptor was 1 order of magnitude lower than that of PGD₂ and that this rank of binding is identical to that observed in the mDP receptor may indicate that the sixth to seventh transmembrane domain of the mDP receptor is responsible for determining these affinities.

A region determining the specificity of the mDP receptor was suggested by further replacement of the first extracellular to second intracellular loop of the mIP receptor with the corresponding region of the mDP receptor. This replacement resulted in loss of the binding of iloprost and E type of PGs but increased the binding affinity for PGD₂. These observations indicate first that this region of the mIP receptor is indispensable for iloprost, PGE₁, and PGE₂ binding, and second and more importantly that this region of mDP receptor may be responsible for the ligand binding selectivity of this receptor. Then, which domain in this region is responsible for this selectivity? The ligand binding pocket in most rhodopsin-type receptors for small molecules is formed by transmembrane domains. If this is also the case for the prostanoid receptors, we can assume that the third transmembrane domain is responsible for the above selectivity. Surprisingly, the third transmembrane domain has only four amino acids different between the mIP and mDP receptors (Fig. 1). If this domain is responsible, it would be intriguing to examine if any of these four amino acids has an important influence on the recognition of the cyclopentane ring. The functional groups at the 9- and 11-positions of the cyclopentane ring of PG molecules are either oxo or hydroxy groups. One hypothesis is that these groups are involved in formation of hydrogen bonds to some amino acids of the prostanoid receptors. The vicinal hydroxyl groups of the catechol ring are shown to be involved in formation of hydrogen bonds to Ser²⁰⁴ and Ser²⁰⁷ of the ₂-adrenergic receptor (32-34). These issues may be tested by construction of more detailed chimeric receptors in this region.

This investigation has also revealed that the affinities for iloprost and PGE₁ of the mIP receptor are increased 12- and 16-fold by replacement of its carboxyl tail with that of the mDP receptor. There have been several reports concerning the effects of carboxyl tails of the rhodopsin-type receptors. We observed that alternative splicing of the EP3 and TP receptor in the carboxyl tail affects the specificity and efficacy of G-protein coupling (35, 36) as well as the sensitivity to agonist-induced desensitization (37). However, none of them showed a change in ligand binding properties. Whether a difference in the carboxyl tail increases the ligand binding affinity remains to be tested because our IP_N-VII/DP_C receptor also contains the replacement of several residues of the seventh transmembrane domain (Fig. 1).

In summary, the present study has identified the domains of the mIP and mDP receptors which confer ligand binding specificities to each receptor. Continued application of molecular biology including introduction of a point mutation to the identified regions will provide a more detailed understanding of the molecular basis of ligand recognition by the prostanoid receptors and will help design more specific therapeutic agents.