|
Volume 272, Number 24,
Issue of June 13, 1997
pp. 15313-15322
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
Targeting of Endopeptidase 24.16 to Different Subcellular
Compartments by Alternative Promoter Usage*
(Received for publication, February 28, 1997)
Akira
Kato
,
Naoaki
Sugiura
§,
Yohko
Saruta
,
Takehiko
Hosoiri
,
Hiroshi
Yasue
¶ and
Shigehisa
Hirose
From the Department of Biological Sciences, Tokyo Institute of
Technology, 4259 Nagatsuta-cho, Midori-ku, Yokohama 226, Japan, the
§ Department of Biochemistry I, National Defense Medical
College, Tokorosawa, Saitama 359, Japan, and the ¶ Animal
Genome Research Group, National Institute of Animal Industry,
Inashiki-gun, Ibaraki 305, Japan
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
Endopeptidase 24.16 or mitochondrial
oligopeptidase, abbreviated here as EP 24.16 (MOP), is a thiol- and
metal-dependent oligopeptidase that is found in multiple
intracellular compartments in mammalian cells. From an analysis of the
corresponding gene, we found that the distribution of the enzyme to
appropriate subcellular locations is achieved by the use of alternative
sites for the initiation of transcription. The pig EP 24.16 (MOP) gene
spans over 100 kilobases and is organized into 16 exons. The core
protein sequence is encoded by exons 5-16 which match perfectly with
exons 2-13 of the gene for endopeptidase 24.15, another member of the
thimet oligopeptidase family. These two sets of 11 exons share the same
splice sites, suggesting a common ancestor. Multiple species of
mRNA for EP 24.16 (MOP) were detected by the 5 -rapid amplification
of cDNA ends and they were shown to have been generated from a
single gene by alternative choices of sites for the initiation of
transcription and splicing. Two types of transcript were prepared,
corresponding to transcription from distal and proximal sites. Their
expression in vitro in COS-1 cells indicated that they
encoded two isoforms (long and short) which differed only at their
amino termini: the long form contained a cleavable mitochondrial
targeting sequence and was directed to mitochondria; the short form,
lacking such a signal sequence, remained in the cytosol. The complex
structure of the EP 24.16 (MOP) gene thus allows, by alternative
promoter usage, a fine transcriptional regulation of coordinate
expression, in the different subcellular compartments, of the two
isoforms arising from a single gene.
INTRODUCTION
Metalloendopeptidases form a large family of peptidases that have
a His-Glu-X-X-His (HEXXH) zinc-binding motif and
preferentially cleave short substrates. For example, endopeptidase
24.15 (EP1 24.15), a member of this family, acts on
peptides of 6-18 amino acid residues and exhibits no or only very weak
proteolytic activity against proteins (1-3). Among the members of this
family, thimet oligopeptidase (TOP or EP
24.15)1 and oligopeptidase M (MOP or EP
24.16) are unique in their sensitivities to thiol reagents and they
constitute a subfamily, the thimet (thiol- and
metal-dependent) oligopeptidase subfamily.
Recent molecular cloning revealed the presence of a cysteine residue unique to members of this subfamily near position 483. This residue is
absent from the other members that exhibit no thiol dependence (4, 5).
In addition to the members of this family of mammalian origin, certain
oligopeptidases of microbial origin that belong to this family have
also been identified, including oligopeptidase A (OpdA) and dipeptidyl
carboxypeptidase (Dcp) of Escherichia coli and
Salmonella typhimurium (6), peptidase F of Lactococcus lactis (7), mitochondrial intermediate peptidase of rat and yeast
(8, 9), and saccharolysin (YCL57w or proteinase yscD) of yeast (10).
This report deals with the two best characterized mammalian enzymes,
namely, EP 24.15 (TOP) and EP 24.16 (MOP), which are members of the
thimet oligopeptidase family. This family has also been called the M3
family of metalloendopeptidases in the classification of Rawlings and
Barrett (11, 12).
EP 24.15 (TOP) was first identified as a collagenase-like peptidase or
Pz-peptidase in experiments with the Pz-peptide that was originally
designed by Wünsch and Heidrich (13) as a substrate for
collagenase. Although the Pz-peptide was a good substrate for
clostridial collagenase, it turned out not to be a substrate for avian
and mammalian collagenases (14). The Pz-peptide hydrolyzing activities
found in avian and mammalian tissues have, therefore, been designated
collagenase-like peptidases or simply Pz-peptidases. Independent
studies on the metabolism of brain peptides led to the discovery of two
enzymes: one was described by Camargo et al. (15) in 1972 and was named neutral endopeptidase and, later, endo-oligopeptidase A;
and the other, first described by Orlowski et al. (16) in
1983, was initially named soluble metalloendopeptidase and subsequently
endopeptidase 24.15. All these enzymes turned out to be the same and
are now known as thimet oligopeptidase (17). In this report we use the
abbreviated designation EP 24.15 (TOP). cDNA sequences for the
mammalian enzyme are now available for the rat (4, 18, 19), pig (20),
and human (21).
EP 24.16 (MOP) was also discovered independently in several different
laboratories. 1) Heidrich et al. (22) demonstrated a
Pz-peptide hydrolyzing activity in a mitochondrial fraction of rat
liver, which was later shown to be distinct from EP 24.15 (TOP) by both
biochemical characterization (23) and partial amino acid sequencing of
the purified enzyme; it was named oligopeptidase M (24). 2) We (25) and
Kiron and Soffer (26) identified a soluble angiotensin-binding protein
in pig and rabbit liver during the course of studies aimed at
identifying hepatic receptors for angiotensin II. After our publication
of the cDNA sequence of the binding protein from pig (27), McKie
et al. (18) pointed out the strong similarity between our
sequence and that of rat EP 24.15 (TOP) which had been determined by
Pierotti et al. (4, 19). We then obtained a second cDNA
clone which was very similar to but clearly different from that of the
cDNA for the binding protein, and we showed that the second clone
represented the pig homolog of rat EP 24.15 (TOP) (20). The
angiotensin-binding protein, although originally identified as a
binding protein, did indeed have thiol- and metal-dependent
oligopeptidase activity (20). At that time, therefore, the binding
protein appeared to represent a new member of the thimet oligopeptidase
family since the amino acid sequence of oligopeptidase M or EP 24.16 (MOP) from no mammalian species had yet been determined. 3) Kawabata et al. (28, 29) isolated an endopeptidase and the
corresponding cDNA clone as a candidate for an enzyme responsible
for the post-transcriptional processing of -carboxyglutamic
acid-containing blood coagulation factors. They failed to notice the
strong similarity to our binding protein, which was later pointed out
by McKie et al. (18). 4) Checler et al. (20, 31)
demonstrated the presence of a novel proteolytic activity capable of
inactivating neurotensin. They purified the peptidase from rat brain
synaptic membranes and characterized it (32). The enzyme, termed
neurolysin or endopeptidase 24.16, was shown to be distinct from EP
24.15 (TOP) and neprilysin (also known as enkephalinase or
endopeptidase 3.4.24.11) and to have a relatively broad
substrate-specificity and tissue distribution. Recent determination of
its amino acid sequence by cDNA cloning clearly indicated that
neurolysin is identical to the three enzymes mentioned above (33).
Thus, four separate lines of research have converged in the discovery
of a single new member of the thimet oligopeptidase family. In this
report we use the abbreviation EP 24.16 (MOP) for this protein, whose
identity has been only recently established.
EP 24.15 (TOP) and EP 24.16 (MOP) are very similar in terms of size and
enzymatic properties: both are intracellular proteins of 78-80 kDa,
consisting of about 680-700 amino acids, and their sequences are 65%
homologous (20). They are, however, clearly distinguishable in several
respects. For example, they have different specificities for
inhibitors, different immunoreactivity, and different cleavage-site
specificities. EP 24.15 (TOP) hydrolyzes neurotensin exclusively at the
Arg-Arg bond whereas EP 24.16 (MOP) cleaves it at the Pro-Tyr bond (16,
24, 32). Another difference is found in the subcellular localizations
of these enzymes. EP 24.15 (TOP) is found in the cytosol while EP 24.16 (MOP) is found in both the cytosolic and mitochondrial compartments.
How can the product of a single gene be localized to more than one
intracellular compartment? To answer this question and to characterize
evolutionary relationships among the members of the thimet
oligopeptidase family, we investigated the structural organization of
the pig genes for EP 24.15 (TOP) and EP 24.16 (MOP) and of their
5 -proximal flanking regions. We discovered six species of mRNA for
EP 24.16 (MOP) that are generated from one single gene as a result of
the utilization of alternative sites for the initiation of
transcription. The six species of mRNA can be classified into two
categories: those containing an additional sequence that encodes a
mitochondrial targeting sequence and those that lack such a sequence.
The use of different promoters for the eventual targeting of proteins to appropriate subcellular compartments appears to be a useful mechanism for adjustment of local concentrations of proteins that function at different intracellular sites in response to the
physiological requirements of the cell.
EXPERIMENTAL PROCEDURES
Identification of 5 -Terminal Sequences of cDNAs for EP 24.16 (MOP)
The 5 -ends of cDNAs for EP 24.16 (MOP) were cloned
with the 5 -RACE (rapid amplification of cDNA ends) system
(CLONTECH, Palo Alto, CA). Two µg of
poly(A)+ RNA, isolated from pig liver (27), were
reverse-transcribed with a specific primer for the cDNA for pig EP
24.16 (MOP), 5RA-1 (5 -GTCTAGCATGGTTCGTTCC-3 ), and avian
myeloblastosis virus reverse transcriptase. The first-strand cDNA
was ligated at the 3 -end with an anchor
(5 -CACGAATTCACTATCGATTCTGGAACCTTCAGAGG-3 ) by T4 RNA ligase. A nested
specific primer for the cDNA for EP 24.16 (MOP), 5RA-2
(5 -CCGTCTACACCTTCACTTC-3 ), was used with an anchor primer
(5 -CTGGTTCGGCCCACCTCTGAAGGTTCCAGAATCGATAG-3 ) for amplification of the
5 -ends of the cDNAs by polymerase chain reaction. The products of
polymerase chain reaction were fractionated on a 3% agarose gel, and
fragments of 300-650 bp were isolated and cloned into pBluescript II
(Stratagene, La Jolla, CA). Positive clones were identified by colony
hybridization, with the 32P-labeled
EcoRI-EcoRV 592-bp fragment of PAB-L1 (27) as
probe, and sequenced.
Sequencing of DNA
DNA was sequenced by the dideoxy chain
termination method of Sanger et al. (34) with
double-stranded plasmids as templates. Termination reactions were
performed with SequiTherm DNA polymerase (Epicentre Technologies,
Madison, WI) and IRD41-labeled M13 universal or reverse primer (LI-COR,
Lincoln, NE). The products were analyzed with a DNA sequencer (model
4000; LI-COR). Sequences were organized and analyzed with GENETYX-MAC
program (Software Development, Tokyo, Japan).
Isolation of Genomic Clones for Pig EP 24.16 (MOP) and EP 24.15 (TOP)
A pig liver genomic library constructed in EMBL3 SP6/T7
(CLONTECH) was screened with the 2.7-kilobase
EcoRI-EcoRI fragment of a cDNA for EP 24.16 (MOP) clone (PAB-L1) (27), or with the 2.5-kilobase pair
EcoRI-EcoRI fragment of a cDNA clone for EP 24.15 (TOP) (PABH-L7); (20), both of which had been labeled with
[ -32P]dCTP (Amersham, Little Chalfont, UK) with a
random priming kit (Takara, Kyoto, Japan). Phage clones (2 × 106) were plated at a density of 30,000 plaque-forming
units per 135 × 95-mm plate on E. coli
NM538, from which duplicate replications were made on cellulose-nitrate
filters (Schleicher & Schuell, Dassel, Germany) and allowed to
hybridize with the 32P-labeled probe in a solution of
6 × SSPE (1 × SSPE is 0.15 M NaCl, 15 mM NaH2PO4, pH 7.0, 1 mM EDTA), 50% formamide, 0.1% SDS, and 5× Denhardt's
solution at 42 °C for 16 h. The filters were rinsed twice at
room temperature in 2 × SSC (1 × SSC is 0.15 M NaCl, 15 mM sodium citrate, pH 7.0) that contained 0.1%
SDS and washed twice at 60 °C in 1 × SSC that contained 0.1%
SDS for 1 h. Positive plaques were identified by autoradiography
and purified by the additional rounds of screening.
Restriction Mapping of Phages
Positions of the
EcoRI, SacI, and XbaI restriction
sites in genomic clones were determined by complete or partial
digestion with restriction enzymes and subsequent Southern blot
analysis. UV irradiation and formation of pyrimidine dimers were used
for preparation of incompletely digested genomic clones. EMBL3
SP6/T7 contains two unique SfiI or SalI sites and
bacteriophage promoters (SP6 and T7) that flank the insert. Arms were
separated with SfiI or SalI from the inserts,
which still contained promoter sequences at the both ends. DNA samples
were UV-irradiated for 0 or 20 min with UV Stratalinker 2400 (Stratagene) in 10 mM Tris, pH 7.5, 10 mM
MgCl2, and 1 mM dithiothreitol. UV-irradiated
samples (500 ng) were digested incompletely with EcoRI,
SacI, or XbaI (10 units) for 1 h at
37 °C, fractionated on a 0.7% agarose gel, and transferred to nylon
membranes (Magnagraph; MSI, Westboro, MA). A set of filters was
prepared and allowed to hybridize with end-labeled oligoprobes for T7
or SP6 promoter sequence, for 14 h at 37 °C in 6 × SSC, 5 × Denhardt's solution, 0.5% SDS, and 100 µg/ml herring
sperm DNA. The filters were washed twice in 1 × SSC, 0.1% SDS at
42 °C for 30 min, exposed to imaging plates, and analyzed with a
Bioimage Analyzer (model BAS 2000; Fuji Film, Tokyo, Japan).
S1 Nuclease Protection Assay
Three primers, namely, 108L
(CAAGCCTTGCGGCGGCCTAGCAAAGGAGGCAACAG) for exon 1; 107L
(GGTGTCCCTCGGGGTAGACCATGTGGGCTGTAGAA) for exon 2; and 106b
(GTCTCTCCATGAGAATGCTCCT) for exon 3, were designed for the synthesis of
single-stranded antisense DNA probes that would protect pig 5 -ends of
mRNAs for EP 24.16 (MOP). Ten pmol of each primer were labeled with
[ -32P]ATP (Amersham) by polynucleotide kinase (Takara)
and used for the synthesis of probes. End-labeled primers were annealed
with 5 µg of plasmid DNA that contained genomic fragments of the pig gene for EP 24.16 (MOP) (ApaI-XhoI 837-bp
fragment of PAB-G33 for exons 1 and 2;
BglII-EcoRI 923-bp fragment of PAB-G32 for exon 3); and antisense probes were synthesized with T7 DNA polymerase (Pharmacia, Uppsala, Sweden). The 3 -ends of the probes were digested with restriction enzymes (SmaI for exon 1, BssHII
for exon 2, and BglII for exon 3), fractionated by
electrophoresis on a 5% polyacrylamide gel that contained 7 M urea and exposed to x-ray film. Probes were detected as
bands of the expected mobility and extracted in 0.5 M
ammonium acetate, 10 mM magnesium acetate, 1 mM
EDTA, 0.1% SDS, and 10 µg/ml yeast tRNA at 37 °C for 12 h. Extracted probes were precipitated in ethanol, and probes (1 × 105 cpm each) were annealed with 5 µg of
poly(A)+ RNA from pig liver or with 10 µg of yeast tRNA,
as a control, for 12 h at 30 °C in 80% formamide, 40 mM PIPES, pH 6.4, 1 mM EDTA, and 400 mM NaCl. Non-annealed nucleic acids were digested with S1
nuclease (Boehringer Mannheim, Mennheim, Germany) at a final
concentration of 1,000 units/ml in 0.28 M NaCl, 0.05 M sodium acetate, pH 4.5, 4.5 mM
ZnSO4, and 20 µg/ml denatured herring sperm DNA. The
protected fragments were purified by extraction with phenol/chloroform
and precipitation with ethanol, and electrophoresed in 5%
polyacrylamide gels containing 7 M urea. Gels were dried and exposed to imaging plates for 48 h. Images were analyzed with the Bioimage Analyzer.
Production of Antiserum against Purified Pig EP 24.16 (MOP)
Rabbits were injected subcutaneously with 75 µg of
purified pig EP 24.16 (MOP) (formerly referred to as soluble
angiotensin-binding protein, sABP (27)) in complete Freund's adjuvant.
Booster injections with 75 µg of purified protein in incomplete
Freund's adjuvant were given 2, 4, and 6 weeks after the initial
injection. Rabbits were bled 10 days after the fourth injection.
Construction and Expression of cDNAs for Isoforms of Pig EP
24.16 (MOP)
Six plasmids, pcDNA3-MOP1 (exon 1-[5-16]);
-MOP1 (exon 1-4-[5-16]); -MOP2 (exon 2-[5-16]); -MOP2 (exon
2-4-[5-16]); -MOP3 (exon 3-[5-16]); and -MOP3 (exon
3-4-[5-16]), were constructed for expression analysis. For
pcDNA-MOP1, a 2732-bp EcoRI-EcoRI fragment of
PAB-L1 (27), which contained the entire open reading frame of type 1 cDNA for EP 24.16 (MOP), was subcloned to pcDNA3 (Invitrogen,
San Diego, CA). For the other plasmids, PAB-R5, -R302, -R305, -R8, and
-R1 (Fig. 1), which encoded only the 5 -ends of type 1 , 2, 2 , 3, and
3 cDNAs, respectively, were digested with AlwNI at
their 3 termini, ligated with the 2291-bp
AlwNI-EcoRI fragment of PAB-L1 and subcloned into
pcDNA3. COS-1 cells were maintained in Dulbecco's modified
Eagle's medium (Life Technologies, Inc., Gaithersburg, MD) that
contained 10 mM HEPES, pH 7.2, 10% fetal bovine serum, 50 units/ml penicillin, and 50 µg/ml streptomycin, in a controlled
atmosphere of 5% CO2 in air at 37 °C. Approximately 6 × 106 cells were electroporated with 20 µg of
each plasmid at 220 V at a capacitance setting of 960 microfarads in a
Gene Pulser apparatus (Bio-Rad) and harvested 48 h after
electroporation.
Fig. 1.
Nucleotide sequences of the six types of
5 -end of cDNAs for pig EP 24.16 (MOP). The six different
sequences revealed by 5 -RACE are aligned. Candidates for codons for
initiation of translation are boxed and labeled M1,
M2, and M3, respectively. These initiation sites are
aligned with the consensus sequence for sites of initiation of
translation (GCCA/GCCATGG) (45) which is shown in italics.
Three nucleotide replacements, due possibly to allelic polymorphism,
were found in exon 2 (underlined). Exon boundaries,
determined by comparison of genomic and cDNA sequences (Fig.
4D), are indicated by vertical arrows.
[View Larger Version of this Image (59K GIF file)]
Subcellular Fractionation of Cells and Western Blotting
All
steps were performed at 4 °C. Cells were washed by centrifugation in
Dulbecco's phosphate-buffered saline (2.7 mM KCl, 138 mM NaCl, 1.2 mM KH2PO4,
and 8.1 mM Na2HPO4, pH 7.4) at 700 rpm for 2 min. Approximately 2 × 107 cells were
suspended in 1 ml of 2.5 M sucrose and homogenized for 2 min. Nuclear fractions were removed by centrifugation at 3,000 rpm
(700 × g) for 10 min, and supernatants were
centrifuged at 9,200 rpm (7,000 × g) for 10 min to
recover mitochondrial fractions as pellets. Mitochondrial fractions
were washed twice by centrifugation at 25,000 rpm (24,000 × g) for 10 min. The post-mitochondrial supernatants were
centrifuged at 50,000 rpm (105,000 × g) for 100 min,
and the pellets (microsomes) and supernatants (cytosol) were recovered.
The concentration of protein in each fraction was determined with the
BCA protein assay reagent (Pierce). Five µg of each protein sample
were fractionated by SDS-PAGE (10% polyacrylamide) in standard glycine
running buffer (192 mM glycine, 25 mM Tris, and
0.1% SDS) or high-resolution running buffer (492 mM
glycine, 75 mM Tris, and 0.1% SDS). The separated proteins
were transferred to a polyvinylidene difluoride membrane (ATTO, Tokyo,
Japan) and probed with 2,000-fold diluted rabbit antiserum against pig
EP 24.16 (MOP). Bound antibodies were detected with alkaline
phosphatase-conjugated second antibodies, with 4-nitro blue tetrazolium
chloride and 5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) as
chromogen.
RESULTS
Differences among 5 -Terminal Sequences of mRNAs for EP 24.16 (MOP)
To delineate the complete structure of the gene for EP
24.16 (MOP), we determined the 5 -end of the corresponding mRNA by rapid amplification of 5 -ends of cDNA (5 -RACE) using preparations of poly(A)+ RNA from pig liver. More than five prominent
bands of fragments of 340-630 nucleotides were obtained. DNA
sequencing of these fragments revealed the presence of several
mRNAs whose sequences were completely different from others
starting 28 nt upstream from the ATG initiation codon (Fig.
1; M3). These results suggested that usage of
alternative promoters and exons might be involved in the generation of
the observed mRNA diversity. To determine the precise molecular
mechanism responsible for generation of such heterologous mRNAs, we
isolated and characterized the pig gene for EP 24.16 (MOP), which had
previously been shown to be present as only a single copy (27).
Structural Organization and 5 -Untranslated Exons of EP 24.16 (MOP)
Gene
To isolate the pig gene for EP 24.16 (MOP), we screened
approximately 2 × 106 independent plaques of a pig
genomic library in EMBL3 (CLONTECH) using the
PAB-L1 cDNA clone (27) as the probe. We isolated and mapped more
than 50 clones, and then we subcloned and sequenced the phage fragments
for the identification of exons. The exon-intron organization of the
pig gene for EP 24.16 (MOP) was deduced from an analysis of 11 independent clones, each of which contained part of the gene (Fig.
2). The gene extends over 100 kilobases and contains 16 exons and 15 introns of various sizes (Figs. 2B and
4B). All the introns have typical splice donor and acceptor boundaries (Fig. 4D) (35).
Fig. 2.
Structure of the cDNA for pig EP 24.16 (MOP) in relation to the structure of the gene (A),
exon-intron organization of the gene (B), restriction maps
for EcoRI, SacI, and XbaI
(C), and the relative locations of genomic clones used for
the analysis (D). The structure of cDNA for pig EP
24.16 (MOP) is described elsewhere (27).
[View Larger Version of this Image (19K GIF file)]
Fig. 4.
Comparison of the structures of genes for EP
24.16 (MOP) and EP 24.15 (TOP). A, comparison of the lengths
of pig genes for EP 24.16 (MOP) and EP 24.15 (TOP). The exons
corresponding to the zinc-binding motifs (exon 12 of EP 24.16 (MOP) and
exon 9 of EP 24.15 (TOP)) are aligned (dotted vertical
line). B, comparison of the exon-intron organization of
the gene for EP 24.16 (MOP) with that of EP 24.15 (TOP). Exons are
indicated by boxes and are numbered in bold
type. Coding regions for the peptidases are shown by filled
boxes and amino-terminal extension sequences generated from the
alternative sites of initiation of translation of EP 24.16 (MOP) are
hatched. Numbers indicate the sizes of exons and introns in base pairs and kilobase pairs, respectively. C,
the extent of sequence homology between the product of the gene for EP
24.16 (MOP) and related peptidases. Coding exons of the gene for EP
24.16 (MOP) (exon 5-16) were converted into deduced amino acid
sequences and compared with those of other peptidases, such as pig EP
24.15 (TOP), saccharolysin from S. cerevisiae
(10), rat mitochondrial intermediate peptidase (MIP) (8),
oligopeptidase A (OpdA) from E. coli (52), and
dipeptidyl carboxypeptidase (Dcp) from E. coli
(53). The extent of homology is indicated, as a percentage, below the
corresponding exons. Bold numbers indicate relatively
strongly conserved regions, with homology scores more than five points
above the average. Italic numbers indicate poorly conserved
regions, with homology scores more than five points lower than the
average. D, nucleotide sequences of exon-intron junctions.
The exons are shown in capital letters and the introns in
lowercase letters. The 5 -flanking regions of three sites of initiation of transcription are shown in italics.
[View Larger Version of this Image (61K GIF file)]
Comparison of the nucleotide sequences of the genomic clones PAB-G32
and PAB-G33 (Fig. 2D) with those of the products of 5 -RACE (Fig. 1) allowed us to identify the alternatively spliced leader exons (Fig. 2, A and B, and
6A). Six distinct species of mRNA for EP 24.16 (MOP)
appeared to be generated by differential use of three sites for
initiation of transcription located upstream of exons 1, 2, and 3, respectively, and by the alternative splicing of exon 4; exons 1, 2, and 3 are mutually exclusive (Fig. 6A). Exon 1 encodes a
putative mitochondrial targeting sequence, (M)IVRCLSAARRLHR (Fig.
6D), which is rich in basic amino acids and can be expected to form an amphipathic helix (36). The common exons 5 through 16 are
used to assemble the functional domain of the enzyme. The zinc-binding
motif HEFGH is encoded by exon 12 (Fig. 4B). The extreme 3
exon, exon 16, encodes the last 44 amino acid residues, the termination
codon, and the 3 -untranslated sequences that include three
polyadenylation signals, a short interspersed repetitive element (SINE
or PRE-1), and an AT repeat, all of which were identified previously by
cDNA cloning (27).
Fig. 6.
Generation of cytosolic and mitochondrial
forms of EP 24.16 (MOP) from a single gene by alternative usage of
three promoters (P1-P3) and three codons for initiation of translation
(M1-M3). A, schematic representation of the six isoforms of
the mRNA for EP 24.16 (MOP) and the organization of the 5 -region
of the gene for EP 24.16 (MOP), showing how the various isoforms are generated. Exons are indicated by boxes and numbered (box
patterns: black, coding regions for the peptidase;
hatched, reading frames encoding the amino-terminal
extensions; and white, non-coding regions). Three sites for
initiation of transcription (Fig. 5) are indicated by
arrows. The deduced amino acid sequences corresponding to
the reading frames of exons 1, 2, and 5 are shown in single letter code, that contains translational initiation sites
indicated by bold and large letters. Basic amino
acid residues which are necessary for mitochondrial targeting sequences
are indicated by bold letters. Alternative initiation of the
transcription of exons 1-3 (P1-P3) and alternative splicing of exon 4 generate six isoforms of the mRNA. B, subcellular
localization of the products of translation of isoforms of the cDNA
for EP 24.16 (MOP) expressed in COS-1 cells. Six cDNA species,
identified by 5 -RACE (Figs. 1 and panel A, of this figure),
were expressed in COS-1 cells and the products were detected by Western
blotting. Subcellular fractions were obtained by differential
centrifugation, as follows: cyt, cytosol (100,000 × g supernatant); mit, mitochondria (7,000 × g pellet); mic, microsomes (100,000 × g pellet). Construction of cDNA used for expression is
indicated by boxes on the right of panel
(A). C, resolution of mitochondrial and cytosolic
forms of EP 24.16 (MOP) by SDS-PAGE in the high-resolution buffer
system described in the text. M1a, precursor of the
mitochondrial form generated by use of the first site (M1) for
initiation of translation; M1b, the processed mature form
imported into mitochondria; M3, the cytosolic form generated
by translation from the M3 site of initiation of translation (for
details see Fig. 7). D, nucleotide and amino acid sequences
of the type 1, 1 , 2, and 3 isoforms. Three codons for initiation of
translation, M1, M2, and M3, are present in exon 1, exon 2, and exon 5, respectively. The mitochondrial targeting sequence of EP 24.16 (MOP),
containing six arginine residues (24), is underlined.
Serizawa et al. (24, 54) determined the amino-terminal amino
acid sequences of the isoforms of EP 24.16 (MOP) purified from
mitochondria and the cytosol and showed that the mitochondrial form has
a Ser residue at its amino terminus and that the major cytosolic form
begins with Thr; the Ser and Thr residues are indicated by white
lettering on a black background.
[View Larger Version of this Image (40K GIF file)]
There appears to be a "pseudo-exon" that encodes a protein that
resembles a ribosomal protein (11.5 kDa, L44 (37)) in reverse orientation (3 to 5 ) within the untranslated region of the 3 -most exon (Fig. 4B). The sequence encoding the homolog of
ribosomal L44 is flanked by the direct repeat TGTTTTAGAGAATTT and has a poly(A) tract, suggesting that the pseudogene might have arisen as a
result of retroposition.
Structural Comparison of the Genes for EP 24.15 (TOP) and EP 24.16 (MOP)
We wondered whether the complexity of organization of the
gene for EP 24.16 (MOP) might be reflected in the genes for other members of the thimet oligopeptidase family and, to this end, we also
characterized the gene for EP 24.15 (TOP). The gene for EP 24.15 (TOP)
was isolated from the same pig genomic DNA library as that used for
isolation of genes for EP 24.16 (MOP), and it was found to have a much
simpler structure in its 5 -region (Figs. 3 and
4B). The gene exists as a single copy, as
revealed by Southern blot analysis (data not shown); it spans
approximately 45 kilobase pairs (Fig. 4A); and it is
organized into 13 exons. The overall organization of the two genes is
very similar with the exception of the length of introns and the
5 -leader and untranslated exons (Fig. 4B). For example,
exons 2-12 of the gene for EP 24.15 (TOP) correspond precisely to
exons 5-15 of the gene for EP 24.16 (MOP) and there is strong
conservation of the respective exon-intron boundaries (Fig.
4D), suggesting evolution from a common ancestor. The
zinc-binding motif HEFGH is encoded within exon 9. The 3 -terminal exon
13 is composed of a short coding sequence, the termination codon, and
the entire 3 -untranslated sequence. The promoter region of the gene
for EP 24.15 (TOP) lacks the TATA box but contains several putative
binding sites for ubiquitous factors including one CCAAT box, three
Sp1 sites, one NF-1 site, one AP-1 site, and two AP-2 sites (data
not shown).
Fig. 3.
Structure of the pig gene for EP 24.15 (TOP).
A, structural relationship to the cDNA. The structure of
cDNA for pig EP 24.15 (TOP) is described elsewhere (20).
B, exon-intron organization. C, restriction maps.
The following abbreviations are used for the restriction enzymes:
E, EcoRI; S, SacI;
X, XbaI. D, relative locations of
genomic clones.
[View Larger Version of this Image (17K GIF file)]
Identification of Three Major Sites of Transcription
Initiation
Characterization of the 5 -ends of mRNAs for EP
24.16 (MOP) by 5 -RACE (Fig. 1) revealed the presence of multiple sites
for initiation of transcription, at least one each in the upstream of
exons 1, 2, and 3. To determine the transcription start sites, we
performed S1 nuclease mapping using poly(A)+ RNA from pig
liver and using three probes, which were complementary to exons 1, 2, and 3, respectively. The locations of these probes are indicated in
Fig. 5A. As we had expected, we found three
sites (Fig. 5A): one located 172 nt upstream of the first
Met (ATG) codon of exon 1; another located at 106 nt upstream of the
Met codon of exon 2; and the third located 23 nt downstream of the TATA
box close to exon 3.
Fig. 5.
Identification of site of initiation of
transcription of the pig gene for EP 24.16 (MOP) by S1 nuclease mapping
(A) and sequences of promoter regions (B and
C). A, 5 µg of poly(A)+ RNA from
pig liver (lanes 2, 4, and 6) or yeast tRNA
(lanes 1, 3, and 5) were used. Sequencing with the same oligonucleotides was used for
calibration of mobilities. Strategies for the preparation of
single-stranded antisense DNA probes are shown on the right. B, the sequence of the 837-bp ApaI-XhoI
fragment of pig genomic DNA that contained exons 1 and 2. Sites of
initiation of transcription are indicated by arrows. Exon 1 and exon 2 are located in a very small region with a GC content of
67%. Nine binding sequences for Sp1, five binding sequences for AP-2,
and two Rb control elements (RCE) are indicated.
Capital letters represent exons and the deduced amino acid
sequences are shown. C, the sequence of the 923-bp BglII-EcoRI fragment of pig genomic DNA that
contained exon 3. A site of initiation of transcription is indicated by
an arrow. The sequence includes a TATA box at position 23
relative to the site of initiation of transcription of exon 3, three
binding sites for Myb, one for AP-1, and one for AP-2. The binding site
for Myb site near the TATA box is very similar to the sequence that is
found in the c-erbB-2 promoter that has been shown to
suppress this gene (44).
[View Larger Version of this Image (49K GIF file)]
Putative Sites for Binding of Transcription Factor Near Sites of
Initiation of Transcription
Inspection of the sequence of
5 -flanking regions of exons 1, 2, and 3, which we designated promoter
regions P1, P2, and P3, respectively (Fig. 4B), revealed
potential cis-acting DNA elements (Fig. 5, B and
C). Promoter regions 1 and 2 are very GC-rich and lack the
TATA and CAAT boxes that are typical of eukaryotic class II promoters;
promoter 3 contains a conserved TATA box, which begins 29 nt upstream
of the previously identified 5 -end of exon 3. The sequences upstream
of exons 1 and 2 contain several putative binding sites for
transcription factors AP-2 and Sp1. AP-2 mediates enhanced
transcription as a result of stimulation by the protein kinase C,
cAMP-dependent protein kinase A, and retinoic acid
(38-40); Sp1 is a protein that binds to the GC box specifically and is often involved in the regulation of so-called housekeeping genes (41).
The upstream region of exon 3 includes consensus binding sites for the
transcription factors Myb (product of the myeloblastosis oncogene),
AP-1, and GATA-1. The presence of multiple binding sites for
hematopoiesis-specific factors is intriguing: Myb has been demonstrated
to be important in the control of the proliferation and differentiation
of hematopoietic cells (42), while GATA-1 was originally found as an
erythroid-specific factor (43). The Myb-binding site immediately
downstream of the TATA box for exon 3 is of particular interest since
such a juxtaposed arrangement of a TATA box and a Myb target sequence
was recently demonstrated to serve as a Myb-suppressible promoter
(44).
Differential Subcellular Localization of EP 24.16 (MOP) Directed by
Alternatively Generated Speces of mRNA
The results described
above suggest that the organization of the 5 -region of the genes for
EP 24.16 (MOP) is unusually complex and that six mRNA species with
different 5 termini are generated as a consequence of the use of
separate promoters (Fig. 5) and the splicing of the 5 -leader exons 1 through 3 (in a mutually exclusive manner) and of exon 4. The cDNA
sequences corresponding to the six species of mRNA are shown
schematically in Fig. 6A, and they were used
for the expression experiments described below. It should be noted that
exon 1 has an in-frame ATG codon (designated M1), when connected
directly to exon 5, and the open reading frame in exon 1 encodes a
putative signal peptide for import into mitochondria; exon 2 also has
an in-frame ATG codon (M2) in an appropriate context for the initiation
of translation (Fig. 1) (45) and the open reading frame predicts an
enzyme with 64 more amino acids at its amino terminus than the product
generated by the open reading frame that starts with an ATG codon (M3)
in the common exon 5 (Figs. 1 and 6A). The fact that exon 1 could encode an amino-terminal leader sequence for targeting to
mitochondria strongly suggests that, upon selection or elimination of
the sequence of exon 1 via differential utilization of the multiple
promoters, the subcellular localization of the products of the gene for
EP 24.16 (MOP) is strictly and efficiently controlled. To confirm this
possibility, we carried out the following experiments.
The six cDNA constructs depicted on the right side of Fig.
6A (labeled types 1 through 3 and 1 through 3 ) were
inserted separately into the mammalian expression vector pcDNA3 and
used to transfect COS-1 cells. Then subcellular organelles were
isolated from the transfectants and the levels of EP 24.16 (MOP) in
these organelles were examined by Western blotting (Fig. 6,
B and C). The type 1 (1-[5 16]) construct
directed the synthesis of EP 24.16 (MOP) that was targeted to
mitochondria (Fig. 6, B, lane 3, and C,
MOP(M1b)); the mitochondrial enzyme was slightly smaller than the
unprocessed precursor that remained, as a consequence of overexpression of the protein, in the cytosol (Fig. 6, B, lane 2, and
C, MOP(M1a)). This difference in size indicates that the
amino-terminal mitochondrial targeting sequence is cleaved after
translocation of the protein into mitochondria. Type 1
(1-4-[5-16]), in which the connection between exons 1 and 5 is
interrupted by insertion of exon 4 which includes a stop codon (Fig.
6D), yielded only the cytosolic form of EP 24.16 (MOP)
generated from the ATG initiation codon (M3) in exon 5 (Fig. 6B,
lanes 5-8). Type 2 (2-[5-16]) allowed the synthesis of an
amino-terminally extended cytosolic form (Fig. 6B, lane 10, upper
band). Again, as seen with type 2 (2-4-[5-16]), insertion of
exon 4 generated a stop codon and only the short cytosolic form was
expressed (Fig. 6B, lanes 9-16). With type 1 and type 2, products of translation from the ATG codon in exon 5 (M3) were also
detected (Fig. 6, B, lane 10, lower band, and C,
MOP(M3)), suggesting that these mRNAs generate two isoforms of
the protein by alternative usage of codons for the initiation of
translation (M1 and M3 for type 1 and M2 and M3 for type 2). The
constructs having exon 3 as the 5 -leader exon (types 3 and 3 )
produced only the cytosolic form of the enzyme (Fig. 6B, lanes 17-24), as expected from the fact that exon 3 contains no
in-frame ATG codon.
DISCUSSION
In this study, we demonstrated the heterogeneity at the 5 -end of
the mRNA for EP 24.16 (MOP). Moreover, we showed that the heterogeneity is generated by alternative usage of promoters and splicing of multiple 5 -leader and untranslated exons and that it is
responsible for the differential subcellular localization of the
products of translation.
Targeting of Proteins to Different Subcellular Locations by
Alternative Usage of Promoters: EP 24.16 (MOP) Represents the First
Example of Such a Mechanism for Intracellular
Peptidases/Proteinases
Proteins, after their synthesis, must be
delivered to their sites of action. Delivery is usually accomplished
with the help of terminal or internal targeting sequences. Sequences
for the targeting proteins to the following sites have been identified: mitochondria, endoplasmic reticulum, lysosomes, nuclei, and
peroxisomes.
The presence of a putative mitochondrial targeting sequence at the
amino terminus of the precursor to EP 24.16 (MOP) was first deduced by
Serizawa et al. (24) from the potential ability of this
sequence to form an amphipathic -helix with a hydrophobic and a
positively charged face of the type expected for a mitochondrial leader
sequence (36, 46). This scenario explains the presence of EP 24.16 (MOP) in mitochondria. The enzyme is, however, known also to be present
in the cytosol and, prior to the present study, the mechanism
responsible for this distribution of EP 24.16 (MOP) has remained
unclear. Discovery of 5 -end variants of the mRNA for EP 24.16 (MOP) by the 5 -RACE technique led us to investigate the genetic basis
for such diversity. Through an analysis of the structure of the gene,
which led to the identification of the three 5 -leader exons that are
selected, in a mutually exclusive manner, by use of alternative
promoters and splicing, we provided the following resolution of this
problem (Fig. 7). If promoter 1 is used, the
mitochondrial isoform of EP 24.16 (MOP) is generated by splicing of
exon 1, which has a sequence that encodes a signal for transport to
mitochondria, to exon 5, which is the beginning of the common
translated region that encodes the mature portion of the protein (type
1 in Fig. 6, A and D). The precursor form (704 amino acid residues) with the mitochondrial targeting sequence is
processed to the mature mitochondrial form of 667 residues (Fig. 7).
The type 1 transcript can also yield the cytosolic form of 681 amino
acids when the M3 site of initiation of translation is used instead of
the M1 site. If promoter 3 is used and exon 3, which lacks an in-frame
ATG codon, is joined to exon 5 (type 5 in Fig. 6, A and
D), the cytosolic isoform is produced from the ATG
initiation codon in exon 5. The use of promoter 2, which directs the
synthesis of a cytosolic variant, is discussed below.
Fig. 7.
Schematic representation of the mechanism for
generation of multiple forms of EP 24.16 (MOP). Three promoters
(P1, P2, and P3) and three codons for the initiation of translation (M1, M2, and M3) are used for the expression of EP 24.16 (MOP). Activation of both P1 and M1 is necessary for expression of EP 24.16 (MOP) in mitochondria. Insertion of exon 4 prevents the translocation
of EP 24.16 (MOP) to mitochondria.
[View Larger Version of this Image (28K GIF file)]
Similar senarios have been reported for several other enzymes that are
known to occur and function in more than one subcellular compartment
(for a recent review, see Ref. 47). Typical examples are the histidine
and valine tRNA synthetases of Saccharomyces cerevisiae that
are involved in protein synthesis in the cytosol and the mitochondria
(48, 49). In these cases, two types of transcript (long and short) are
produced by alternative usage of promoters, and the long transcript
yields the mitochondrial isoform exclusively, while the short
transcript yields the cytosolic enzyme. In this way, adjustment of the
levels of the proteins to the needs of each compartment is possible.
Although the biological significance of this mechanism in the present
case is not immediately apparent since the true substrates of the
enzyme have not yet been identified, the general regulation of
expression of the gene for an oligopeptidase by transcription
regulatory factors and the unique regulation, as reported herein, of
targeting of the product by use of alternative promoters seems to
provide a powerful method by which cells can modulate the concentration
of specific peptides in certain intracellular compartments to reflect
the metabolic state of the cell.
Complex Organization of the Pig Gene for EP 24.16 (MOP)
As
compared with the gene for EP 24.15 (TOP), another member of the thimet
oligopeptidase family, the gene for EP 24.16 (MOP) have quite a
complicated structure in its 5 - and 3 -regions. The two genes do,
however, exhibit extensive similarity in the regions that encode the
mature proteins, which consist of 11 exons, namely, exons 2 through 12 in the case of the gene for EP 24.15 (TOP) and exons 5 through 15 in
the case of the gene for EP 24.16 (MOP). The similarity suggests that
these two genes and, probably, the genes for other members of this
family were generated from an ancestral gene as distinct sequences as a
consequence of gene duplication. The presence of a SINE in the
3 -untranslated region of the gene for EP 24.16 (MOP) suggests that
insertion of a SINE after the gene duplication might have destabilized
the gene for EP 24.16 (MOP) and stimulated extensive diversification of
5 - and 3 -regions by recruiting the entire gene for ribosomal protein L44 (in the reverse orientation) into the 3 -most exon (exon 16) and
the 5 -leader exons into the 5 -flanking region by, perhaps, retroposition and gene conversion.
Long and Short Forms of EP 24.16 (MOP)
The use of promoter 2 of the gene for EP 24.16 (MOP) yields the type 2 transcript, which is
predicted to have an amino-terminally elongated product (Fig. 7).
Consistent with this prediction, we detected a long form of the protein
in the cytosol of COS-1 cells transfected with the type 2 construct
after SDS-PAGE and Western blotting (Fig. 6B, lane 10).
Although the relative abundance of the corresponding mRNA, as
estimated from the data after 5 -RACE, in the pig liver is low
(<10%), the physiological significance of this form clearly merits
further study. The roles of the extended amino-terminal region of 64 amino acid residues (Fig. 6D) could include stabilization of
the enzyme, modulation of the substrate specificity, and/or mediation
of interactions with other cytosolic proteins.
In our analysis, we also noticed the presence of a splice variant that
lacked the sequence of exon 15.2 This
variant should encode a protein with a short and slightly different
carboxyl-terminal tail. The functional significance of this variant and
the tissue- and development-specific regulation of the splicing will be
the subject of further research. The presence of at least two forms of
EP 24.16 (MOP) has also been demonstrated in purified preparations of
the enzyme from rabbit and pig liver (50, 51).
The type 1, type 2, and type 3 species of mRNA all have splice
variants, designated type 1 , type 2 , and type 3 , respectively, with
an extra exon sequence (5 -untranslated exon 4, Fig. 7), but none of
them results in a long open reading frame from the first initiation
codon. It is unknown therefore, whether these variants have any
biological significance. However, the possibility exists that the
variant species of mRNA might contribute to the regulation of rates
of translation. Alternatively, they might produce short peptides with
as yet unidentified functions. In the case of the type 1 transcript,
the insertion of the sequence of exon 4 provides a mechanism by which
the synthesis of the mitochondrial isoform is suppressed even under
conditions under which promoter 1 is active but there is no
mitochondrial requirement for the oligopeptidase.
Conclusion
Analysis of the gene for EP 24.16 (MOP) revealed
the very complex organization of the gene and the presence of a variety
of transcripts generated by differential use of multiple sites of initiation of transcription and by alternative splicing of exons 2, 3, 4, and 15. In contrast to these complexities, a simple and definitive
answer was obtained to the question of how the product of a single gene
for EP 24.16 (MOP) is delivered to two different cellular compartments,
namely, the cytosol and the mitochondria.
FOOTNOTES
*
This work was supported in part by a Grant-in-Aid for
Scientific Research on Priority Areas (Intracellular Proteolysis) from the Ministry of Education, Science, Sports and Culture of Japan and by
research grants from SRF, the Cosmetology Research Foundation, and the
Life Insurance Association of Japan.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AB170[GenBank], AB171[GenBank], AB172[GenBank], AB173[GenBank], AB174[GenBank], AB175[GenBank], AB411[GenBank], AB412[GenBank], AB413[GenBank], AB414[GenBank], AB415[GenBank], AB416[GenBank], AB417[GenBank], AB418[GenBank], AB419[GenBank], AB420[GenBank], AB421[GenBank], AB422[GenBank], AB423[GenBank], AB424[GenBank], AB425[GenBank],
and AB000426[GenBank]- AB000438[GenBank].
Supported by a Research Fellowship for Young Scientists from the
Japan Society for the Promotion of Science.
To whom correspondence should be addressed: Dept. of
Biological Sciences, Tokyo Institute of Technology, 4259 Nagatsuta-cho, Midori-ku, Yokohama 226, Japan. Tel.: 81-45-924-5726; Fax:
81-45-924-5824.
1
The abbreviations used are: TOP, thimet
oligopeptidase; EP, endopeptidase; MOP, oligopeptidase M; PAGE,
polyacrylamide gel electrophoresis; bp, base pair(s); SINE(s), short
interspersed repetitive element(s); RACE, rapid amplification of
cDNA ends; PIPES, 1,4-piperazinediethanesulfonic acid; nt,
nucleotide(s).
2
A. Kato, N. Sugiura, and S. Hirose, unpublished
observation.
ACKNOWLEDGEMENTS
We thank Makoto Itakura, Takeshi Ihara, and
Hiromi Hagiwara for helpful discussions, and Setuko Satoh and Kazuko
Tanaka for expert secretarial and technical assistance.
REFERENCES
-
Bond, J. S., and Beynon, R. J.
(1985)
Int. J. Biochem.
17,
565-574
[CrossRef][Medline]
[Order article via Infotrieve]
-
Tisljar, U.
(1993)
Biol. Chem. Hoppe Seyler
374,
91-100
[Medline]
[Order article via Infotrieve]
-
Barrett, A. J., Brown, M. A., Dando, P. M., Knight, C. G., McKie, N., Rawlings, N. D., and Serizawa, A.
(1995)
Methods Enzymol.
248,
529-556
[Medline]
[Order article via Infotrieve]
-
Pierotti, A., Dong, K. W., Glucksman, M. J., Orlowski, M., and Roberts, J. L.
(1990)
Biochemistry
29,
10323-10329
[CrossRef][Medline]
[Order article via Infotrieve]
-
Orlowski, M., Reznik, S., Ayala, J., and Pierotti, A. R.
(1989)
Biochem. J.
261,
951-958
[Medline]
[Order article via Infotrieve]
-
Conlin, C. A., and Miller, C. G.
(1995)
Methods Enzymol.
248,
567-579
[Medline]
[Order article via Infotrieve]
-
Monnet, V.
(1995)
Methods Enzymol.
248,
579-592
[Medline]
[Order article via Infotrieve]
-
Isaya, G., Kalousek, F., and Rosenberg, L. E.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
8317-8321
[Abstract/Free Full Text]
-
Isaya, G., Miklos, D., and Rollins, R. A.
(1994)
Mol. Cell Biol.
14,
5603-5616
[Abstract/Free Full Text]
-
Buchler, M., Tisljar, U., and Wolf, D. H.
(1994)
Eur. J. Biochem.
219,
627-639
[Medline]
[Order article via Infotrieve]
-
Rawlings, N. D., and Barrett, A. J.
(1995)
Methods Enzymol.
248,
183-228
[Medline]
[Order article via Infotrieve]
-
Rawlings, N. D., and Barrett, A. J.
(1993)
Biochem. J.
290,
205-218
-
Wünsch, E., and Heidrich, H.-G.
(1963)
Hoppe-Seyler's Z. Physiol. Chem.
333,
149-151
[Medline]
[Order article via Infotrieve]
-
Harper, E., and Gross, J.
(1970)
Biochim. Biophys. Acta
198,
286-292
[Medline]
[Order article via Infotrieve]
-
Camargo, A. C., Ramalho-Pinto, F. J., and Greene, L. J.
(1972)
J. Neurochem.
19,
37-49
[CrossRef][Medline]
[Order article via Infotrieve]
-
Orlowski, M., Michaud, C., and Chu, T. G.
(1983)
Eur. J. Biochem.
135,
81-88
[Medline]
[Order article via Infotrieve]
-
Barrett, A. J., and Brown, M. A.
(1990)
Biochem. J.
271,
701-706
[Medline]
[Order article via Infotrieve]
-
McKie, N., Dando, P. M., Rawlings, N. D., and Barrett, A. J.
(1993)
Biochem. J.
295,
57-60
-
Pierotti, A., Dong, K. W., Glucksman, M. J., Orlowski, M., and Roberts, J. L.
(1994)
Biochemistry
33,
622
[Medline]
[Order article via Infotrieve]
-
Kato, A., Sugiura, N., Hagiwara, H., and Hirose, S.
(1994)
Eur. J. Biochem.
221,
159-165
[Medline]
[Order article via Infotrieve]
-
Thompson, A., Huber, G., and Malherbe, P.
(1995)
Biochem. Biophys. Res. Commun.
213,
66-73
[CrossRef][Medline]
[Order article via Infotrieve]
-
Heidrich, H.-G., Prokopova, D., and Hanning, K.
(1969)
Hoppe-Seyler's Z. Physiol. Chem.
350,
1430-1436
[Medline]
[Order article via Infotrieve]
-
Tisljar, U., and Barrett, A. J.
(1990)
FEBS Lett.
264,
84-86
[CrossRef][Medline]
[Order article via Infotrieve]
-
Serizawa, A., Dando, P. M., and Barrett, A. J.
(1995)
J. Biol. Chem.
270,
2092-2098
[Abstract/Free Full Text]
-
Hagiwara, H., Sugiura, N., Wakita, K., and Hirose, S.
(1989)
Eur. J. Biochem.
185,
405-410
[Medline]
[Order article via Infotrieve]
-
Kiron, M. A. R., and Soffer, R. L.
(1989)
J. Biol. Chem.
264,
4138-4142
[Abstract/Free Full Text]
-
Sugiura, N., Hagiwara, H., and Hirose, S.
(1992)
J. Biol. Chem.
267,
18067-18072
[Abstract/Free Full Text]
-
Kawabata, S., and Davie, E. W.
(1992)
J. Biol. Chem.
267,
10331-10336
[Abstract/Free Full Text]
-
Kawabata, S., Nakagawa, K., Muta, T., Iwanaga, S., and Davie, E. W.
(1993)
J. Biol. Chem.
268,
12498-12503
[Abstract/Free Full Text]
-
Checler, F., Vincent, J. P., and Kitabgi, P.
(1983)
J. Neurochem.
41,
375-384
[CrossRef][Medline]
[Order article via Infotrieve]
-
Checler, F., Emson, P. C., Vincent, J. P., and Kitabgi, P.
(1984)
J. Neurochem.
43,
1295-1301
[CrossRef][Medline]
[Order article via Infotrieve]
-
Checler, F., Vincent, J.-P., and Kitabgi, P.
(1986)
J. Biol. Chem.
261,
11274-11281
[Abstract/Free Full Text]
-
Dauch, P., Vincent, J.-P., and Checler, F.
(1995)
J. Biol. Chem.
270,
27266-27271
[Abstract/Free Full Text]
-
Sanger, F., Nicklen, S., and Coulson, A. R.
(1977)
Proc. Natl. Acad. Sci. U. S. A.
74,
5463-5467
[Abstract/Free Full Text]
-
Breathnach, R., and Chambon, P.
(1981)
Annu. Rev. Biochem.
50,
349-383
[CrossRef][Medline]
[Order article via Infotrieve]
-
von Heijne, G., Steppuhn, J., and Herrmann, R. G.
(1989)
Eur. J. Biochem.
180,
535-545
[Medline]
[Order article via Infotrieve]
-
Davies, M. S., Henney, A., Ward, W. H., and Craig, R. K.
(1986)
Gene (Amst.)
45,
183-191
[CrossRef][Medline]
[Order article via Infotrieve]
-
Williams, T., Admon, A., Luscher, B., and Tjian, R.
(1988)
Genes Dev.
2,
1557-1569
[Abstract/Free Full Text]
-
Imagawa, M., Chiu, R., and Karin, M.
(1987)
Cell
51,
251-260
[CrossRef][Medline]
[Order article via Infotrieve]
-
Hyman, S. E., Comb, M., Pearlberg, J., and Goodman, H. M.
(1989)
Mol. Cell Biol.
9,
321-324
[Abstract/Free Full Text]
-
Kadonaga, J. T., Jones, K. A., and Tjan, R.
(1997)
Trends Biochem. Sci.
11,
20-23
[CrossRef]
(abstr.)
-
Luscher, B., and Eisenman, R. N.
(1990)
Genes Dev.
4,
2235-2241
[Free Full Text]
-
Ko, L. J., and Engel, J. D.
(1993)
Mol. Cell Biol.
13,
4011-4022
[Abstract/Free Full Text]
-
Mizuguchi, G., Kanei-Ishii, C., Takahashi, T., Yasukawa, T., Nagase, T., Horikoshi, M., Yamamoto, T., and Ishii, S.
(1995)
J. Biol. Chem.
270,
9384-9389
[Abstract/Free Full Text]
-
Kozak, M.
(1987)
Nucleic Acids Res.
15,
8125-8148
[Abstract/Free Full Text]
-
Hartl, F. U., Pfanner, N., Nicholson, D. W., and Neupert, W.
(1989)
Biochim. Biophys. Acta
988,
1-45
[Medline]
[Order article via Infotrieve]
-
Danpure, C. J.
(1995)
Trends Cell Biol.
5,
230-238
[CrossRef][Medline]
[Order article via Infotrieve]
-
Natsoulis, G., Hilger, F., and Fink, G. R.
(1986)
Cell
46,
235-243
[CrossRef][Medline]
[Order article via Infotrieve]
-
Chatton, B., Walter, P., Ebel, J.-P., Lacroute, F., and Fasiolo, F.
(1988)
J. Biol. Chem.
263,
52-57
[Abstract/Free Full Text]
-
Rosenberg, E., Russo, C., Kiron, M. A. R., and Soffer, R. L.
(1988)
Biochem. Biophys. Res. Commun.
156,
1230-1236
[CrossRef][Medline]
[Order article via Infotrieve]
-
Sugiura, N., Hagiwara, H., Ito, T., and Hirose, S.
(1991)
in
Peptide Regulation of Cardiovascular Function (Imura, H., Matsuo, H., and Masaki, T., eds), pp. 157-166, Academic Press, New York
-
Conlin, C. A., Trun, N. J., Silhavy, T. J., and Miller, C. G.
(1992)
J. Bacteriol.
174,
5881-5887
[Abstract/Free Full Text]
-
Henrich, B., Becker, S., Schroeder, U., and Plapp, R.
(1993)
J. Bacteriol.
175,
7290-7300
[Abstract/Free Full Text]
-
Serizawa, A., Dando, P. M., and Barrett, A. J.
(1997)
in
Proteolysis in Cell Functions (Hopsu-Havu, V. K., Järvinen, M., and Kirschke, H., eds), IOS Press, Amsterdam
, in press
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
E. J. Lim, S. Sampath, J. Coll-Rodriguez, J. Schmidt, K. Ray, and D. W. Rodgers
Swapping the Substrate Specificities of the Neuropeptidases Neurolysin and Thimet Oligopeptidase
J. Biol. Chem.,
March 30, 2007;
282(13):
9722 - 9732.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Saric, C. I. Graef, and A. L. Goldberg
Pathway for Degradation of Peptides Generated by Proteasomes: A KEY ROLE FOR THIMET OLIGOPEPTIDASE AND OTHER METALLOPEPTIDASES
J. Biol. Chem.,
November 5, 2004;
279(45):
46723 - 46732.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. J. Cotter, N. v. O. Sweeney, P. M. Coen, Y. A. Birney, M. J. Glucksman, P. A. Cahill, and P. M. Cummins
Regulation of Endopeptidases EC3.4.24.15 and EC3.4.24.16 in Vascular Endothelial Cells by Cyclic Strain: Role of Gi Protein Signaling
Arterioscler. Thromb. Vasc. Biol.,
March 1, 2004;
24(3):
457 - 463.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
C. N. Shrimpton, A. I. Smith, and R. A. Lew
Soluble Metalloendopeptidases and Neuroendocrine Signaling
Endocr. Rev.,
October 1, 2002;
23(5):
647 - 664.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. K. Brown, K. Madauss, W. Lian, M. R. Beck, W. D. Tolbert, and D. W. Rodgers
Structure of neurolysin reveals a deep channel that limits substrate access
PNAS,
March 1, 2001;
(2001)
51633198.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
S. Isenmann, Y. Khew-Goodall, J. Gamble, M. Vadas, and B. W. Wattenberg
A Splice-Isoform of Vesicle-associated Membrane Protein-1 (VAMP-1) Contains a Mitochondrial Targeting Signal
Mol. Biol. Cell,
July 1, 1998;
9(7):
1649 - 1660.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
T. Saric, J. Beninga, C. I. Graef, T. N. Akopian, K. L. Rock, and A. L. Goldberg
Major Histocompatibility Complex Class I-presented Antigenic Peptides Are Degraded in Cytosolic Extracts Primarily by Thimet Oligopeptidase
J. Biol. Chem.,
September 21, 2001;
276(39):
36474 - 36481.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. K. Brown, K. Madauss, W. Lian, M. R. Beck, W. D. Tolbert, and D. W. Rodgers
Structure of neurolysin reveals a deep channel that limits substrate access
PNAS,
March 13, 2001;
98(6):
3127 - 3132.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|