Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Johnson, W.
Right arrow Articles by Jameson, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Johnson, W.
Right arrow Articles by Jameson, J. L.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 24, Issue of June 13, 1997 pp. 15405-15412
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Regulation of the Human Chorionic Gonadotropin alpha - and beta -Subunit Promoters by AP-2*

(Received for publication, November 12, 1996, and in revised form, March 19, 1997)

Wade Johnson Dagger , Chris Albanese Dagger §, Stuart Handwerger , Trevor Williams par **, Richard G. Pestell Dagger § and J. Larry Jameson Dagger Dagger Dagger

From the Dagger  Division of Endocrinology, Metabolism, and Molecular Medicine, Northwestern University Medical School, Chicago, Illinois 60611, the  Department of Endocrinology, Children's Hospital Medical Center, University of Cincinnati College of Medicine, Cincinnati, Ohio 45229, and the par  Department of Biology, Yale University, New Haven, Connecticut 06520

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES


ABSTRACT

Production of the placental hormone, chorionic gonadotropin (CG), increases dramatically as cytotrophoblasts fuse to form syncytiotrophoblasts. The CG alpha - and beta -promoters are both responsive to cAMP, although the kinetics of cAMP stimulation are different. In an effort to understand the mechanisms of coordinate induction of these genes, AP-2 binding sites were identified in the promoter regions of the alpha  and CGbeta genes. AP-2 bound to the upstream regulatory element (-186 to -156 base pairs (bp)) in the alpha -promoter and to several different regions of the CGbeta promoter, including footprints 2 and 4B (FP2, -311 to -279 bp; FP4B, 221 to -200 bp). AP-2 antibodies induced supershifts of these complexes, confirming the identity of the protein-DNA complex. In JEG-3 cells, which contain abundant AP-2, mutations in these CGbeta AP-2 sites reduced basal activity and decreased cAMP stimulation. In AP-2-deficient Hep-G2 cells, co-transfection of AP-2 stimulated expression of the CGbeta promoter 10-20-fold, and the alpha -promoter was induced by 3-6-fold. Mutations that eliminate AP-2 binding to CGbeta FP4B reduced AP-2 stimulation by more than 80%, whereas mutations in FP2 reduced AP-2 stimulation by less than 50%. Analyses of AP-2 mutants revealed a requirement for the DNA binding/dimerization domain and the amino-terminal proline-rich and acid-rich transactivation domains for stimulation of the CGbeta promoter. Primary cultures of placental cytotrophoblasts were differentiated into syncytiotrophoblasts in vitro to examine AP-2 expression by reverse transcriptase-polymerase chain reaction. AP-2 mRNA levels increased by day 2 and continued to rise in parallel with a marked increase in alpha  and CGbeta gene expression. We conclude that both the alpha  and CGbeta promoters contain binding sites for AP-2 and suggest that this transcription factor provides a mechanism for coordinating the induction of these genes during placental cell differentiation.


INTRODUCTION

Human chorionic gonadotropin (hCG)1 is a heterodimeric placental hormone encoded by separate alpha - and CGbeta -subunit genes (1-3). It is a member of a family of hormones that are expressed in the pituitary (luteinizing hormone (LH), follicle-stimulating hormone, and thyroid-stimulating hormone) and the placenta (CG). The alpha -subunit is common to these hormones, and it is expressed in both pituitary and placenta. The CGbeta gene is expressed almost exclusively in the placenta (3). The function of CG is to stimulate the corpus luteum in the ovary to produce progesterone during the early stages of pregnancy.

The dramatic exponential increase in CG expression in early pregnancy correlates with the formation of differentiated placental cells (4, 5). Trophoblast progenitor cells convert to proliferative cytotrophoblasts that invade the endometrium of the uterus. The cytotrophoblasts fuse to form nonmitotic syncytiotrophoblast cells. The production of CG is greatly enhanced upon the formation of syncytiotrophoblasts, which also produce a variety of other hormones including placental lactogen (5).

The cellular pathways that lead to activation of the alpha  and CGbeta genes have not been clearly established, although cAMP is able to induce expression of these genes in both placental cells (6) and choriocarcinoma cell lines (7, 8). Cyclic AMP-responsive DNA sequences have been characterized in the promoters of both genes (for review, see Ref. 9). In the alpha -gene, two identical repeats of a consensus cAMP response element (CRE) are located between -146 and -111 bp of the promoter (10-12). These CREs bind cAMP response element-binding protein (12-14) along with other members of the B-Zip family of transcription factors (15, 16). An adjacent element, termed the upstream response element (URE, -180 to -151), also contributes to basal expression and appears to contribute to placenta-specific expression of the alpha -promoter (12, 13, 17-20). The URE contains three overlapping protein binding sites referred to as the trophoblast-specific element (TSE, or URE2 (-187 to -159)) (12, 13, 18, 21), downstream domain (-172 to -151) (13, 19), and GATA (alpha -ACT, URE1) (-165 to -140) (22). Protein binding to the TSE and downstream domain are mutually exclusive (13, 19).

The cAMP-responsive region in the CGbeta promoter encompasses several protein binding domains between -311 and -200 bp (23-25). Maximal expression in placental cell lines and stimulation by cAMP requires this entire region, suggesting that it functions as a composite regulatory element (23). Nuclear extracts footprint two major regions (-311 to -274; -250 to -200) within this domain (23, 24). Neither region binds transcription factor cAMP response element-binding protein (23), nor are they competed by the CRE derived from the alpha -promoter (23, 24), suggesting distinct pathways for cAMP control of the two genes. Another B-Zip protein, c-Jun, negatively regulates both promoters, and it binds to the alpha -CRE and to the CGbeta gene promoter between -245 and -220 bp (16). However, based upon antibody-mediated supershift studies, c-Jun does not appear to represent the major protein that binds to this region of the CGbeta gene (16). Distinct sequences within the cAMP-responsive region of the CGbeta promoter may share common binding proteins, since they cross-compete for protein interactions (24). In addition, the TSE region from the alpha -promoter also competes for these proteins, suggesting that the same transcription factors might be involved in the coordinate regulation of the two promoters (24).

Transcription factor AP-2 has been shown to mediate cAMP responses in other genes including metallothionein IIA (26), acetyl-CoA carboxylase (27), insulin-like growth factor-binding protein-5 (28), and RII protein kinase beta  (29) among others (16, 30). AP-2 has also been implicated in developmentally regulated gene expression in a variety of cell types including NT-2 and P19 teratocarcinoma cells (31, 32), primary neural cells (33), keratinocytes (34-36), and adipocytes (27). AP-2 is a 52-kDa protein that binds to DNA as a homodimer (37) and can associate with c-Myc, inhibiting transactivation by c-Myc (38). Several AP-2 variants have been identified (37, 39), some of which act as inhibitors of AP-2 gene activation through an undetermined mechanism (37). In this report, we examine a potential role of AP-2 in the regulation of the alpha  and CGbeta genes. We find that AP-2 binds to regulatory elements in both promoters and regulates the expression of these genes. AP-2 is also induced during placental cell differentiation.


MATERIALS AND METHODS

Electrophoretic Mobility Shift Assays

Nuclear extracts were prepared by the Shapiro method (40) modified by the addition of protease inhibitors (1 µg/ml aprotinin, 1 µg/ml pepstatin, 1 µg/ml leupeptin, and 1 µg/ml p-aminobenzamide (Sigma) to the final dialysis buffer. Nuclear extracts (5-10 µg) were added to a 20-µl reaction containing: 2 µl of 10 × buffer (200 mM HEPES, pH 7.9, 400 mM KCl, 10 mM MgCl2, and 1% Nonidet P-40), 500 ng of dI-dC, and 1 µg of AP-2 or Sp-1 antibodies as indicated. Reactions were preincubated on ice for 30 min before the addition of 30 fmol of radiolabeled probe with or without unlabeled competitor DNA. Reactions were incubated at room temperature for 30 min before electrophoresis (180 V, 3 h) through nondenaturing 5% polyacrylamide gels in 0.5 × TBE (45 mM Tris borate, 1 mM EDTA).

Oligonucleotides for electrophoretic mobility shift assays are listed in Table I. Hybridized oligonucleotides were labeled by Klenow end filling. Klenow reactions included 5 pmol of annealed oligonucleotides, 1 µl of 10 × Klenow buffer (Promega, Madison, WI), 4 µl of 25 mM deoxynucleoside triphosphates (without dATP), 3 µl of [alpha -32P]dATP (3000 µCi/ml, DuPont NEN), and 1 µl of Klenow fragment (Promega). Reactions were incubated at 37 °C for 30 min before the addition of 5 µl of 25 mM dNTPs and incubation for an additional 10 min. After stopping the reactions, the solution was passed through Centricep columns (Adelphia, NJ) to remove unincorporated nucleotides.

Table I. Sequences of wild type and mutant oligonucleotides

Nucleotides that differ from wild type (WT) sequence are shown in boldface type. Underlined bases represent probable AP-2 binding sites.

hCGbeta FP4A -245 to -221
  WT CATTTCCGGGGACCGCTCCGGGCAT
hCGbeta FP4B -221 to -200
  WT ATCCTGGCTTGAGGGTAGAGTG
  beta 4B-m1 ATCCTTGATTGATGGTAGAGTG
  beta 4B-m2 ATCCTGGATTGAGGGTAGAGTG
  beta 4B-m3 ATCCTGGCTTGATGGTAGAGTG
hCGbeta FP2 -311 to -279
  WT AGCTGCCCCGTGGGCAGGACACACCTCCTGCGGGCAGCT
  beta FP-2A TTCGGCCCCGTGGGCAGGACACA
  beta FP-2B GTGGGCAGGACACACCTCCTGC
  beta FP-2C ACACACCTCCTGCGGGCCTATT
  beta FP2-m1 ACCTCCTGGAGACTTATTCAA
hCGalpha -180 to -156
  WT AAAAATGACCTAAGGGTTGAAACAA
  -172malpha AAAAATGATCTAAGGGTTGAAACAA
AP-2
  WT AGCTGACCGCCCGCGGCCCGTAGCT
Sp-1
  WT ATTCGATCGGGGCGGGGCGAGC

Reporter Genes and Construction

The alpha  and CGbeta luciferase constructs in the pA3LUC plasmid have been described previously (23, 25). Site-directed mutagenesis was performed using sequences that correspond to the mutant oligonucleotides used in gel mobility shift assays (Table I). Polymerase chain reactions were used to incorporate the mutations within the alpha and CGbeta promoters (25). All site-directed mutations were sequenced to verify the mutation as well as the correct native promoter sequence. Expression vectors containing wild type AP-2 and AP-2 mutants were driven by the Rous sarcoma virus promoter (41).

Transient Transfections

Transient transfections were performed using either the CaPO4 (42) or lipid-mediated (43) methods. CaPO4 reactions consisted of 4.5 µg of reporter plasmid, 250 µl of HEPES-buffered saline (137 mM NaCl, 5 mM KCl, 0.7 mM Na2PO4, 6 mM dextrose, 21 mM HEPES, pH 7.05) and 10 µl of 2 M CaCl2. Expression vectors (300-600 ng) were used as indicated, and equal amounts of empty vector were added to keep the total amount of expression vector constant in different reactions. Lipid transfections were performed using L-alpha -phosphatidylethanolamine, dioleoyl (Sigma) and dimethyldioctadecyl-ammonium bromide (Sigma) lipids prepared by the ethanol injection method (44). Cells were harvested for luciferase assays 18-24 h after transfection (45).

Western Blots

Nuclear extracts are described above (40). Whole cell placental extracts were kindly provided by Dr. T. Woodruff (Northwestern University). Primary antibodies included 1:1000 AP-2 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) and 1:1000 Sp-1 (Santa Cruz Biotechnology) and were added to nitrocellulose membranes for 60 min in solution containing albumin (5 mg/ml). After washing three times in 0.1% Tween phosphate-buffered saline, membranes were incubated with 1:10,000 secondary anti-rabbit antibody (Santa Cruz Biotechnology) in 3% milk phosphate-buffered saline. After washing, membranes were subjected to enzyme-linked chemiluminescence as described by the manufacturer (Amersham Corp.).

RT-PCR Assays for mRNA Expression in Placental Cells

Cytotrophoblast cells were isolated from human term placenta and cultured under conditions that allow fusion into syncytiotrophoblast cells (46). RNA was isolated from placental cells every 2 days over a 12-day period of culture (46). Total RNA (1 µg) was reverse transcribed (37 °C, 2 h) by the addition of 15 units of reverse transcriptase (Promega) in the presence of 10 pmol of random hexamer primers, 25 mM deoxynucleoside triphosphates (dNTPs) in 1 × MI buffer (67 mM Tris, pH 8.8, 6.7 mM MgCl2, 16 mM (NH4)2SO4, 10 mM beta -mercaptoethanol) in a total volume of 20 µl. PCR reactions included specific primers for the alpha  and CGbeta genes, AP-2, and internal controls, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and ribosomal protein 19 (RPL19). The final PCR reaction (100 µl) included a 1-µl aliquot of the RT reaction product, 50 pmol of sense and antisense primers for AP-2, alpha , and CGbeta , along with one of the controls, GAPDH or hRPL19, in 1 × MI buffer (25 µM dNTPs, 10 µl of Me2SO, 0.5 µl of Taq DNA polymerase (Promega), and 0.1 µl of [32P]dATP (DuPont NEN). Cycle conditions were 96 °C for 30 s, 94 °C for 1 min, 58 °C for 1 min, and 72 °C for 1 min. An aliquot (20 µl) of each reaction was subjected to polyacrylamide (6%) gel electrophoresis, and the specific products were quantitated using a Fujix 2000 phosphoimager (Fuji Medical Systems, Stamford, CT). Data were analyzed by one-way analysis of variance using Dunnett's test.

Primers (Life Technologies, Inc.) were designed to span exon-intron boundaries to avoid amplification of genomic DNA. The primers include the following: alpha  sense, 5'-CCAGAATGCACGCTACAG-3', alpha  antisense, 5'CGCCGTGTGGTTCTCCAG3', product 222 bp; hCGbeta sense, 5'-GTGGAGAAGGAGGGCTGC-3', hCGbeta antisense, 5'-GGCGGCAGAGTGCACATT-3', product 232 bp; AP-2 sense, 5'-CTGCCAACGTTACCCTGC-3', AP-2 antisense 5'-TAGTTCTGCAGGGCCGTG-3', product 339 bp; GAPDH sense, 5'-GAGCCACATCGCTCAGAC-3', GAPDH antisense, 5'-CTTCTCATGGTTCACACCC-3', product 430 bp.


RESULTS

AP-2 Binds to Regulatory DNA Elements in the alpha  and CGbeta Promoters

The alpha  and CGbeta regulatory elements that have been shown to bind proteins in JEG-3 nuclear extracts are depicted in Fig. 1A (12, 13, 23, 24). Previous studies have shown cross-competition by a subset of these elements, including the alpha URE/TSE and several of the CGbeta footprinted elements, suggesting that these sequences may share common transcription factors (24, 47). The size of the URE/TSE binding protein (24) and the GC-rich nature of the DNA sequences shared by these elements raised the possibility that AP-2 might interact at these sites.


Fig. 1. Identification of AP-2 binding sites in the alpha  and CGbeta genes. A, schematic representation of regulatory elements and protein binding sites in the alpha  and CGbeta genes. GATA, GATA sequence binding site; ACT, activator; JRE, junctional regulatory element. B, gel mobility shift assays for AP-2 binding. Radiolabeled DNA sequences are indicated below the gel and include alpha URE (-186 to -156 bp), hCGbeta FP2 (-311 to -279 bp), hCGbeta FP4A (-240 to -221 bp), hCGbeta FP4B (-221 to -200 bp), hMTIIA AP-2 site (-186 to -165 bp), and the Sp-1 consensus site. Competition with a 100-fold excess of the AP-2 sequence from the hMTIIA promoter is indicated at the top of the gel.
[View Larger Version of this Image (54K GIF file)]

Electrophoretic mobility shift assays were performed using JEG-3 nuclear extracts to assess whether a consensus AP-2 sequence competed for binding to the alpha  and CGbeta elements (Fig. 1B). Excess (100-fold) unlabeled AP-2 oligonucleotide inhibited binding to the alpha URE and CGbeta FP4B. The lower part of the complex that binds to CGbeta FP2 was also reduced by the AP-2 competitor. As a positive control, the AP-2 competitor was shown to compete well for protein binding to the homologous AP-2 sequence derived from the human metallothionein IIA (hMTIIA) promoter (-185 to -167) (26, 48). However, excess unlabeled AP-2 oligonucleotide did not compete with complexes that bind to the Sp-1 binding site or to CGbeta FP4A, indicating that the competition is specific. These results suggest that AP-2 binds to sequences within both the alpha  and CGbeta promoters.

AP-2 antibody was used in supershift assays to confirm whether AP-2 was present in the protein complexes that bind to the alpha  and the CGbeta promoter elements (Fig. 2A). The AP-2 antibody supershifted the major complex binding to the alpha URE and to CGbeta FP4B as well as proteins that bind to the control AP-2 element, hMTIIA. In contrast, the AP-2 antibody had no effect on protein binding to an Sp-1 element. The Sp-1 antibody had no effect on protein binding to the putative AP-2 sites, whereas it caused a supershift of the Sp-1 complex.


Fig. 2. AP-2 antibodies supershift protein complexes that bind to alpha  and CGbeta DNA sequences. Gel mobility shift assays were performed with reagents defined in Fig. 1. A, AP-2 or Sp-1 antibodies were added to extracts, as indicated at the top of the panel, for 60 min before the addition of radiolabeled DNA. The positions of antibody-induced supershifts of AP-2 and Sp-1 complexes are denoted by arrows. B, delineation of AP-2 and Sp-1 binding sites in CGbeta FP2. Overlapping fragments spanning the FP2 sequence are depicted at the top of the panel. Added competitor DNA, sera, and antibodies are indicated at the top of the gel. As a control, the properties of Sp-1 binding to its consensus sequence are shown to the right of the gel. The positions of AP-2 and Sp-1 complexes are indicated by arrows. C, delineation of the AP-2 complex with FP2 by competition for Sp-1. Added competitor DNA, sera, and antibodies are indicated at the top of the gel. As a control, the properties of Sp-1 binding to its consensus sequence are shown to the right of the gel. The positions of AP-2 and Sp-1 complexes are indicated by arrows.
[View Larger Version of this Image (50K GIF file)]

Protein interactions with different domains within CGbeta FP2 are illustrated in Fig. 2B. When the full-length FP2 fragment was used, multiple protein complexes were observed. The addition of either AP-2 or Sp-1 antibody, but not preimmune AP-2 sera, appeared to shift part of the major protein complex, suggesting that both proteins might bind to FP2. The FP2 fragment was divided into overlapping segments FP2A, FP2B, and FP2C. AP-2 competitor DNA inhibited protein binding to the FP2A and FP2C fragments, and these complexes were also supershifted by AP-2 antibody. On the other hand, Sp-1 competitor inhibited protein binding to FP2B, and Sp-1 antibody supershifted this complex. Additional experiments confirmed that these interactions were specific, since the Sp-1 antibody did not alter binding to FP2A and FP2C and the AP-2 antibody had no effect on the FP2B complex (data not shown). These experiments indicate that AP-2 binds to the 5'- and 3'-ends of the FP2, whereas Sp-1 binds to the central region (-306 to -285 bp).

The interaction of AP-2 with the FP2 region was resolved further by performing combinations of oligonucleotide competitions and antibody supershift experiments (Fig. 2C). In the presence of Sp-1 competitor oligonucleotide, several FP2 protein complexes were diminished, and the amount of the putative AP-2 complex was increased. The addition of AP-2 antibody in the presence of Sp-1 competitor supershifted the residual protein complex. These findings support the idea that both Sp-1 and AP-2 bind to FP2 and raise the possibility that these binding sites overlap partially.

AP-2 Is Present in JEG-3 Nuclear Extracts and in Placenta

Western blots were performed to determine whether AP-2 is present in cells that express the alpha  and CGbeta genes (Fig. 3). AP-2 antibody detected a 52-kDa protein in JEG-3 cells and extracts from whole placenta and trophoblasts. As controls, the same band was seen in HeLa cells but not in Hep-G2 cells, which have been shown previously to be deficient in AP-2 (41). The same blot was reprobed with an Sp-1 antibody and verified that the nuclear extracts from each of the cell lines contained similar levels of Sp-1 protein (Fig. 3B). However, little Sp-1 was detected in the whole cell extracts from placenta or trophoblast cells (Sp-1 was seen in these extracts with longer exposure, data not shown). These results indicate that AP-2 is abundant in the placenta.


Fig. 3. Western blot analysis of AP-2 expression in placenta and various cell lines. Nuclear extract proteins (10 µg) for the indicated cell lines or whole cell extract proteins (10 µg) were subjected to 12% denaturing SDS-polyacrylamide gel electrophoresis and transferred to a nitrocellulose membrane that was sequentially probed with AP-2 (A) or Sp-1 antibodies (B). Molecular mass markers are shown at the left, and the location of the 52-kDa AP-2 and 110-kDa Sp-1 bands are shown by arrowheads.
[View Larger Version of this Image (43K GIF file)]

Role of the AP-2 Binding Sites in the Function of the alpha  and CGbeta Promoters

Transient expression assays were performed in Hep-G2 cells to examine the effects of co-transfected AP-2 on the alpha  and CGbeta promoters (Fig. 4) (41). AP-2 stimulated -3700 CGbeta promoter activity 22-fold (Fig. 4A). Deletions to -1700 or -345 bp decreased stimulation to 10-fold, and subsequent deletions to -248 bp essentially eliminated AP-2 stimulation. The deletion between -345 and -248 bp includes FP2 but not FP4. An internal deletion of FP4 (345 d-beta FP4) also eliminated AP-2 stimulation.


Fig. 4. Effect of AP-2 expression on alpha  and CGbeta promoter activity in AP-2-deficient Hep-G2 cells. A, Hep-G2 cells were co-transfected with 4.5 µg of the indicated CGbeta and 600 ng of an expression vector either with or without AP-2 cDNA sequences. B, Hep-G2 cells were transfected with alpha  promoter constructs (2 µg) and 200 ng of an expression vector either with or without AP-2 cDNA sequences. The mutant constructs are depicted schematically on the left and are defined under "Materials and Methods." The activity of the promoterless plasmid, pA3LUC is shown at the bottom of the panels. Results are the mean ± S.E. of triplicate transfections. -Fold stimulation by AP-2 is indicated at the right.
[View Larger Version of this Image (29K GIF file)]

AP-2 increased -846 alpha -promoter activity by 6.8-fold. This effect was reduced to 3-4-fold by deletion to -290 or -180 bp. Deletion to -156 bp eliminates the alpha URE and the AP-2 binding site. Deletion to -132 bp eliminates one of the two CREs. These deletions both reduced basal expression and also reduced AP-2 stimulation to 1.3- and 2.5-fold, respectively. A single point mutation (172Malpha ), shown previously to disrupt binding to the URE (19) (see below), decreased AP-2 stimulation further (0.9-fold).

Because deletion of CGbeta FP2 has been shown previously to eliminate cooperative interactions with more proximal sequences (23, 25), the roles of CGbeta FP2 and FP4B were examined further by creating point mutations within the individual domains. Electrophoretic mobility shift assays were used to determine the effects of the mutations on protein binding (Fig. 5A). Relative to the wild-type FP4B sequence, each of the CGbeta FP4B mutants (Table I) competed poorly for AP-2 binding. FP4B-m1 and FP4B-m3 showed little or no competition, whereas FP4B-m2 competed partially for AP-2 binding. The effects of mutations in CGbeta FP2 or the alpha URE are shown in Fig. 5B. Consistent with the AP-2 supershift studies in Fig. 2B, fragments FP2A and FP2C, but not FP2B competed for AP-2 binding. The FP2-m1 mutation, which alters the binding site in fragment FP2A did not compete for AP-2 binding. The 172 M in the alpha URE eliminated AP-2 binding to this fragment of the alpha -promoter (Fig. 5B).


Fig. 5. AP-2 binding to mutant CGbeta FP4B regulatory elements. A, AP-2 binding to hCGbeta FP4B was examined in the presence of increasing amounts of the indicated competitor DNA sequences. B, AP-2 binding to the alpha URE is shown on the left with competition by the native or 172Malpha mutant. Competition of various FP2 mutants for binding to a consensus AP-2 site is shown on the right. The sequences of the various mutants are shown in Table I.
[View Larger Version of this Image (48K GIF file)]

The effects of the CGbeta FP4 and FP2 mutations were examined in the context of the -345 bp construct (Fig. 6A). In Hep-G2 cells, each of the point mutations in FP4 reduced AP-2 induction by 80% or more, confirming that AP-2 exerts functional effects through the FP4 element (Fig. 6B). In contrast to the FP4B mutations, the FP2 mutations reduced basal activity, but AP-2 induction was reduced by only 30%.


Fig. 6. Functional effects of mutations in AP-2 sites in the CGbeta promoter studied in Hep-G2 cells. Hep-G2 cells were co-transfected with 4.5 µg of the indicated -345CGbeta promoter mutants and 600 ng of an expression vector either with or without AP-2 cDNA sequences. A, the locations of different CGbeta promoter mutations are depicted in FP2 and FP4B. B, CGbeta promoter activity in the absence and presence of AP-2. Results represent mean ± S.E. of triplicate transfections. -Fold stimulation by AP-2 is shown above the bars.
[View Larger Version of this Image (29K GIF file)]

JEG-3 cells have been used extensively for studies of alpha  and CGbeta gene expression (9). Because JEG-3 cells express abundant amounts of AP-2 (Fig. 3), they were used to assess the effects of the AP-2 mutations in the presence of the endogenous protein (Fig. 7). Each of the FP4 mutations greatly reduced basal activity, consistent with a role for endogenous AP-2 in the regulation of this site (Fig. 7A). The FP2 mutations caused an even greater decrease in basal activity, suggesting that the AP-2 and/or the Sp-1 sites in this region are also involved in basal expression.


Fig. 7. Functional effects of mutations in AP-2 sites in the CGbeta promoter studied in JEG-3 cells. JEG-3 cells were transfected with 4.5 µg of the indicated -345 CGbeta promoter mutations. The locations of the different mutations are shown in Fig. 6. A, basal activity. B, -fold stimulation after treatment with 0.5 mM 8-bromo-cAMP for 18 h. Results represent the mean ± S.E. of triplicate transfections. *, p <=  0.05 compared with wild type -345 CGbeta using a one-way analysis of variance.
[View Larger Version of this Image (27K GIF file)]

AP-2 has been implicated in cAMP regulation of gene expression (26-28), and cAMP is known to induce the CGbeta gene. The effect of mutations of the AP-2 binding site on cAMP stimulation of CGbeta promoter activity were assayed after 18 h of treatment (Fig. 7B). The wild-type -345 CGbeta promoter was induced 42-fold by cAMP (Fig. 7B). The AP-2 mutations in FP4 reduced cAMP stimulation to a variable extent (50-75% decrease). The FP2-m1 mutation, which eliminates AP-2 binding to the FP2A sequence, also decreased cAMP stimulation. In contrast, the FP2-m2 and FP2-m3 mutations, which disrupt Sp-1 binding, reduced basal activity but had little effect on cAMP stimulation. The AP-2 mutant in the alpha -promoter did not affect cAMP stimulation (data not shown), consistent with the presence of other consensus CREs in this promoter (9).

Domains of AP-2 Required for Induction of the CGbeta Promoter

Several functional domains have been delineated in AP-2, including a DNA binding domain, a dimerization domain, and transactivation domains (41, 49). Transient co-transfection studies were conducted in Hep-G2 cells comparing wild type and mutant AP-2 expression vectors using the -345 hCGbeta promoter as the reporter gene (Fig. 8). Deletion of the amino-terminal 50 amino acids of AP-2 (Delta N51) did not affect transactivation, but further deletion of the amino-terminal 165 amino acids (Delta N165) decreased CGbeta promoter activation by 70%. The region of difference between the two deleted stretches includes the proline-rich and acidic activation domains. A further deletion that also removes the DNA binding domain (Delta N278) was inactive. Carboxyl-terminal deletion from 437 to 413 (Delta C413) had no effect, whereas deletion into the dimerization domain (Delta C390) completely eliminated AP-2 induction of the CGbeta promoter. These results suggest that AP-2 induction of the CGbeta promoter requires dimerization and DNA binding together with the transactivation domains, similar to studies performed with the hMTIIA AP-2 site (41).


Fig. 8. Functional domains in AP-2 required for stimulation of the CGbeta promoter. Hep-G2 cells were co-transfected with 4.5 µg of the -345CGbeta reporter gene and 600 ng of empty expression plasmid (pSP) or expression vectors encoding the indicated AP-2 deletion mutants. The AP-2 deletion mutants are depicted schematically to the left of the graph. Results represent the mean ± S.E. of triplicate transfections. *, p <=  0.05 compared with empty expression vector using a one-way analysis of variance.
[View Larger Version of this Image (38K GIF file)]

AP-2 Gene Expression Increases during in Vitro Differentiation of Trophoblast Cells

Cytotrophoblast cells were isolated from human placenta and induced to undergo differentiation into syncytiotrophoblasts (46). RNA was extracted over the course of 12 days of differentiation, and the levels of AP-2 and of alpha  and CGbeta mRNA were analyzed by RT-PCR (Fig. 9). AP-2 mRNA levels increased 3-fold after 2 days of differentiation and continued to increase gradually during the 12-day period (8-fold increase). The alpha  and CGbeta mRNA levels also increased during the first 2 days and showed more marked stimulation between days 2 and 4 before reaching a plateau (maximal -fold increase for alpha  was 16-fold and for CGbeta was 45-fold). GAPDH and hRPL19 were used to normalize expression of the other mRNAs, and they did not change substantially during the differentiation process (data not shown). The finding that AP-2 mRNA levels increase in conjunction with the stimulation of the alpha  and CGbeta genes is consistent with a role for AP-2 in the regulation of these genes in the placenta.


Fig. 9. Induction of AP-2 gene expression during trophoblast differentiation in vitro. RT-PCR was used to measure AP-2, alpha , and hCGbeta mRNA levels during in vitro differentiation of primary cultures of placental trophoblasts. A, example of radiolabeled RT-PCR products for AP-2, alpha , and hCGbeta during trophoblast differentiation. B, levels of specific mRNAs were corrected by comparison with an internal standard, GAPDH, as described under "Materials and Methods." Results are from a representative PCR reaction and are expressed as percentage of maximal level. Maximal -fold inductions relative to day 0 were as follows: AP-2 (8-fold), alpha  (16-fold), hCGbeta (45-fold).
[View Larger Version of this Image (26K GIF file)]


DISCUSSION

Chorionic gonadotropin gene expression in the placenta is a relatively recent evolutionary event, since its expression occurs almost exclusively in higher primates (9). In the case of the alpha -gene, modifications in the CRE sequence and in adjacent upstream regulatory elements appear to account for the ability of the alpha -gene to be expressed in the placenta as well as in the pituitary gland (17, 18). The CGbeta genes appear to have duplicated and diverged from an ancestral LHbeta gene (2). Although LHbeta expression is restricted to the pituitary gland, the CGbeta genes are expressed preferentially in the placenta, presumably reflecting the acquisition of new regulatory DNA sequences that direct placenta-specific expression (50).

The DNA regulatory elements that control CGbeta gene expression have been challenging to define. Mutational studies have suggested that several distinct elements may interact in an interdependent manner, a phenomenon that has made it difficult to clearly delineate discrete functional domains (23). Protein binding studies have therefore proven quite helpful for defining potential regulatory elements. DNase I footprinting analyses delineated several discrete binding sites, particularly between -311 and -200 bp (23, 24). More recently, it was found that several of these sites competed with one another, raising the possibility that a common protein was binding to multiple sites (24). Moreover, evidence that a key regulatory element (URE/TSE) for placental expression of the alpha -promoter also competed for binding to the CGbeta elements suggested that this protein might be involved in the coordinate expression of the two genes (24). These findings have underlined the importance of identifying the factors that bind to the CGbeta regulatory elements.

In this report, we provide several lines of evidence that a transcription factor that is immunoreactive with AP-2 antibodies binds to the CGbeta regulatory elements. Consensus AP-2 elements compete for binding to FP4B and for two of the complexes that bind to FP2. The identity of this protein as AP-2 is strengthened by the fact that an AP-2 antibody supershifts the complexes that bind to these sites. Similar data were found for the alpha URE site that competes for protein interactions with the CGbeta elements, supporting the notion that this protein is shared in common by these sequences. The molecular mass of AP-2 is similar (52 kDa) to the size of the protein previously purified by affinity chromatography using the alpha URE sequence (24). Last, in AP-2-deficient Hep-G2 cells, co-expression of AP-2 stimulated expression of the alpha -promoter and, to a greater degree, the CGbeta promoter. Taken together, these data suggest AP-2 may be a regulator of alpha  and CGbeta gene expression in the placenta.

AP-2 appears to interact with several CGbeta elements, including FP2 and FP4B. Additional AP-2 sites were also identified several kilobase pairs upstream in the CGbeta promoter.2 The proximal part of the CGbeta promoter is very G-C-rich and has yet to be tested for AP-2 binding. FP2 is also bound by Sp-1, and it appears that AP-2 and Sp-1 may bind to partially overlapping elements, since competition for Sp-1 facilitated the binding of AP-2 (Fig. 2C). Previous studies revealed that c-Jun binds close to FP4A, which is adjacent to one of the AP-2 sites (FP4B) (25). Thus, Jun, AP-2, and Sp-1 have now been shown to interact with the CGbeta promoter. Given evidence for combinatorial interactions among these sequences, an important question for future studies is to understand the mechanisms by which these regulatory elements interact. One possibility is that they may share transcriptional co-activators.

AP-2 has been suggested to mediate cAMP responsiveness in a variety of promoters (26-30). cAMP regulation of hCGbeta was partially reduced by AP-2 mutants in FP4B (50-75% decrease). In FP2, the mutation that eliminates AP-2 binding (FP2-m1) decreased cAMP stimulation (65% decrease), whereas the mutations within the Sp-1 binding site (FP2-m2, FP2-m3) had less effect on cAMP stimulation. These findings support the idea that AP-2 plays a role in cAMP stimulation of the CGbeta promoter. However, the fact that cAMP responsiveness is not eliminated by these mutations indicates that other sequences are probably involved in cAMP stimulation of the CGbeta promoter (50).

AP-2 has been implicated in developmental regulation in several cell types, and it is intriguing to consider the possibility that AP-2 may participate in a developmental cascade during trophoblast differentiation. For example, the expression of keratin genes in the developing epidermis correlates with the presence of cells that express high levels of AP-2 (35). In NT-2 teratocarcinoma cells, retinoic acid induces AP-2 expression as these cells undergo differentiation (31). We found that AP-2 mRNA levels increased early in the process of trophoblast differentiation in vitro, and AP-2 protein levels are high in normal placenta. Because the CG genes are expressed very early during embryogenesis and implantation, it is of interest to determine whether AP-2 is already expressed at this time of development. Recently, the AP-2 gene was disrupted by targeted mutagenesis in mice, revealing that it is necessary for neural tube closure and craniofacial development (51, 52). Potential effects on placental development were not evaluated, but one can speculate that there were no severe abnormalities as pregnancies proceeded to completion. It should be noted, however, that two additional AP-2-related genes (AP-2beta , AP-2gamma ) have recently been identified (37, 39), and it is possible that these genes may exert redundant functions in the placenta and other tissues. In addition, because the CGbeta genes are not expressed in mice, it is not possible to evaluate potential effects of the null mutants on CGbeta gene expression in the murine model.

In conclusion, we have shown that AP-2 expression increases as trophoblasts differentiate in an in vitro model. AP-2 appears to be a major regulator of the CGbeta gene, and to a lesser degree, the alpha -gene. As such, it may represent one of several factors that coordinate the expression of these genes. Future studies will help to define other factors that function in conjunction with AP-2 to regulate the combinatorial elements in these genes.


FOOTNOTES

*   This work was supported by National Institutes of Health (NIH) Grants HD23519 (to J. L. J.), HD07447 (to S. H.), and KO8 CA620008 (to R. G. P.) and by NIH Predoctoral Training Grant T32 GM0852 (to W. J.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§   Present address: Dept. of Medicine and Developmental and Molecular Biology, Albert Einstein College of Medicine, Bronx, NY 10461.
**   A Pew Scholar in the Biomedical Sciences.
Dagger Dagger    To whom correspondence should be addressed: Division of Endocrinology, Metabolism and Molecular Medicine, Northwestern University Medical School, Tarry 15-709, 303 E. Chicago Ave., Chicago, IL 60611. Tel.: 312-503-0469; Fax: 312-503-0474; E-mail: ljameson{at}nwu.edu.
1   The abbreviations used are: hCG, human chorionic gonadotropin; CG, chorionic gonadotropin; LH, luteinizing hormone; CRE, cAMP response element; bp, base pair; URE, upstream response element; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; RT, reverse transcriptase; PCR, polymerase chain reaction; TSE, trophoblast-specific element; hMTIIA, human metallothionein IIA; FP, footprint.
2   W. Johnson and J. Larry Jameson, unpublished data.

REFERENCES

  1. Pierce, J., and Parsons, T. F. (1981) Annu. Rev. Biochem. 50, 465-495 [CrossRef][Medline] [Order article via Infotrieve]
  2. Fiddes, J. C., and Talmadge, K. (1984) Recent Prog. Horm. Res. 40, 43-78
  3. Nagaya, T., and Jameson, J. L. (1994) in The Pituitary Gland (Imura, H., ed), 2nd Ed., pp. 63-89, Raven Press, New York
  4. Hoshina, M., Boothby, M., and Boime, I. (1982) J. Cell. Biol. 93, 190-198 [Abstract/Free Full Text]
  5. Kliman, H. J., Nestler, J. E., Sermasi, E., Sanger, J. M., and Strauss, J. F. (1986) Endocrinology 118, 1567-1582 [Abstract/Free Full Text]
  6. Ringler, G. E., Kao, L. C., Miller, W. L., and Strauss, J. F. (1989) Mol. Cell. Endocrinol. 61, 13-21 [CrossRef][Medline] [Order article via Infotrieve]
  7. Burnside, J., Nagelberg, S. B., Lippman, S. S., and Weintraub, B. D. (1985) J. Biol. Chem. 260, 12705-12709 [Abstract/Free Full Text]
  8. Jameson, J. L., Jaffe, R. C., Gleason, S. L., and Habener, J. F. (1986) Endocrinology 119, 2560-7 [Abstract/Free Full Text]
  9. Jameson, J. L., and Hollenberg, A. N. (1993) Endocr. Rev. 14, 203-221 [Abstract/Free Full Text]
  10. Silver, B. J., Bokar, J. A., Virgin, J. B., Vallen, E. A., Milsted, A., and Nilson, J. H. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 2198-2202 [Abstract/Free Full Text]
  11. Deutsch, P. J., Jameson, J. L., and Habener, J. F. (1987) J. Biol. Chem. 262, 12169-12174 [Abstract/Free Full Text]
  12. Delegeane, A. M., Ferland, L. H., and Mellon, P. L. (1987) Mol. Cell. Biol. 7, 3994-4002 [Abstract/Free Full Text]
  13. Jameson, J. L., Albanese, C., and Habener, J. F. (1989) J. Biol. Chem. 264, 16190-16196 [Abstract/Free Full Text]
  14. Hoeffler, J. P., Meyer, T. E., Yun, Y., Jameson, J. L., and Habener, J. F. (1988) Science 242, 1430-1433 [Abstract/Free Full Text]
  15. Habener, J. F. (1990) Mol. Endocrinol. 4, 1087-1094 [Abstract/Free Full Text]
  16. Pestell, R. G., and Jameson, J. L. (1994) in Molecular Endocrinology: Basic Concepts and Clinical Correlations (Weintraub, B., ed), pp. 59-76, Raven Press, New York
  17. Fenstermaker, R. A., Farmerie, T. A., Clay, C. M., Hamernik, D. L., and Nilson, J. H. (1990) Mol. Endocrinol. 4, 1480-1487 [Abstract/Free Full Text]
  18. Steger, D. J., Altschmied, J., Buscher, M., and Mellon, P. L. (1991) Mol. Endocrinol. 5, 243-255 [Abstract/Free Full Text]
  19. Pittman, R. H., Clay, C. M., Farmerie, T. A., and Nilson, J. H. (1994) J. Biol. Chem. 269, 19360-19368 [Abstract/Free Full Text]
  20. Bokar, J. A., Keri, R. A., Farmerie, T. A., Fenstermaker, R. A., Andersen, B., Hamernik, D. L., Yun, J., Wagner, T., and Nilson, J. H. (1989) Mol. Cell. Biol. 9, 5113-5122 [Abstract/Free Full Text]
  21. Jameson, J. L., Powers, A. C., Gallagher, G. D., and Habener, J. F. (1989) Mol. Endocrinol. 3, 763-72 [Abstract/Free Full Text]
  22. Steger, D. J., Hecht, J. H., and Mellon, P. L. (1994) Mol. Cell. Biol. 14, 5592-602 [Abstract/Free Full Text]
  23. Albanese, C., Kay, T. W. H., Troccoli, N. M., and Jameson, J. L. (1991) Mol. Endocrinol. 5, 693-702 [Abstract/Free Full Text]
  24. Steger, D. J., Buscher, M., Hecht, J. H., and Mellon, P. L. (1993) Mol. Endocrinol. 7, 1579-1588 [Abstract/Free Full Text]
  25. Pestell, R. G., Hollenberg, A. N., Albanese, C., and Jameson, J. L. (1994) J. Biol. Chem. 269, 31090-31096 [Abstract/Free Full Text]
  26. Imagawa, M., Chiu, R., and Karin, M. (1987) Cell 51, 251-260 [CrossRef][Medline] [Order article via Infotrieve]
  27. Park, K., and Kim, K. H. (1993) J. Biol. Chem. 268, 17811-17819 [Abstract/Free Full Text]
  28. Duan, C., and Clemmons, D. R. (1995) J. Biol. Chem. 270, 24844-24851 [Abstract/Free Full Text]
  29. Kurten, R. C., Levy, L. O., Shey, J., Durica, J. M., and Richards, J. S. (1992) Mol. Endocrinol. 6, 536-550 [Abstract/Free Full Text]
  30. Roesler, W. J., Vandenbark, G. R., and Hanson, R. W. (1988) J. Biol. Chem. 263, 9063-9066 [Free Full Text]
  31. Williams, T., Admon, A., Luscher, B., and Tjian, R. (1988) Genes & Dev. 2, 1557-1569 [Abstract/Free Full Text]
  32. Luscher, B., Mitchell, P. J., Williams, T., and Tjian, R. (1989) Genes & Dev. 3, 1507-1517 [Abstract/Free Full Text]
  33. Philipp, J., Mitchell, P. J., Malipiero, U., and Fontana, A. (1994) Dev. Biol. 165, 602-614 [CrossRef][Medline] [Order article via Infotrieve]
  34. Snape, A. M., Winning, R. S., and Sargent, T. D. (1991) Development 113, 283-293 [Abstract]
  35. Byrne, C., Tainsky, M., and Fuchs, E. (1994) Development 120, 2369-2383 [Abstract/Free Full Text]
  36. Magnaldo, T., Vidal, R. G., Ohtsuki, M., Freedberg, I. M., and Blumenberg, M. (1993) Gene Expression 3, 307-315 [Medline] [Order article via Infotrieve]
  37. Moser, M., Imhof, A., Pscherer, A., Bauer, R., Amselgruber, W., Sinowatz, F., Hofstadter, F., Schule, R., and Buettner, R. (1995) Development 121, 2779-2788 [Abstract]
  38. Gaubatz, S., Imhof, A., Dosch, R., Werner, O., Mitchell, P., Buettner, R., and Eilers, M. (1995) EMBO J. 14, 1508-1519 [Medline] [Order article via Infotrieve]
  39. Williamson, J. A., Bosher, J. M., Skinner, A., Sheer, D., Williams, T., and Hurst, H. C. (1996) Genomics 35, 262-264 [CrossRef][Medline] [Order article via Infotrieve]
  40. Shapiro, D. J., Sharp, P. A., Wahli, W. W., and Keller, M. J. (1988) DNA 7, 47-55 [Medline] [Order article via Infotrieve]
  41. Williams, T., and Tjian, R. (1991) Genes & Dev. 5, 670-682 [Abstract/Free Full Text]
  42. Graham, F. L., and van der Eb, A. J. (1973) Virology 52, 456-487 [CrossRef][Medline] [Order article via Infotrieve]
  43. Rose, J. K., Buonocore, L., and Whitt, M. A. (1991) Biotechniques 10, 520-525 [Medline] [Order article via Infotrieve]
  44. Campbell, M. J. (1995) Biotechniques 18, 1027-1032 [Medline] [Order article via Infotrieve]
  45. deWet, J. R., Wood, K. V., DeLuca, M., and Helinski, D. R. (1987) Mol. Cell. Biol. 7, 725-737 [Abstract/Free Full Text]
  46. Richards, R. G., Hartman, S. M., and Handwerger, S. (1994) Endocrinology 135, 321-329 [Abstract]
  47. Albanese, C., Colin, I. M., Crowley, W. F., Ito, M., Pestell, R. G., Weiss, J., and Jameson, J. L. (1996) Recent Prog. Horm. Res. 51, 23-61
  48. Mitchell, P. J., Wang, C., and Tjian, R. (1987) Cell 50, 847-861 [CrossRef][Medline] [Order article via Infotrieve]
  49. Williams, T., and Tjian, R. (1991) Science 251, 1067-1071 [Abstract/Free Full Text]
  50. Hollenberg, A. N., Pestell, R. G., Albanese, C., Boers, M. E., and Jameson, J. L. (1994) Mol. Cell. Endocrinol. 106, 111-119 [CrossRef][Medline] [Order article via Infotrieve]
  51. Zhang, J., Hagopian-Donaldson, S., Serbedzija, G., Elsemore, J., PlehnDujowich, D., McMahon, A. P., and Flavell, R. A. (1996) Nature 381, 238-241 [CrossRef][Medline] [Order article via Infotrieve]
  52. Schorle, H., Meier, P., Buchert, M., Jaenisch, R., and Mitchell, P. J. (1996) Nature 381, 235-238 [CrossRef][Medline] [Order article via Infotrieve]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Hum Reprod UpdateHome page
S.F. de Medeiros and R.J. Norman
Human choriogonadotrophin protein core and sugar branches heterogeneity: basic and clinical insights
Hum. Reprod. Update, January 1, 2009; 15(1): 69 - 95.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Ozturk, L. J. Donald, L. Li, H. W. Duckworth, and M. L. Duckworth
Proteomic Identification of AP2{gamma} as a Rat Placental Lactogen II Trophoblast Cell-Specific Enhancer Binding Protein
Endocrinology, September 1, 2006; 147(9): 4319 - 4329.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
D. Ghosh, S. Sachdev, M. Hannink, and R. M. Roberts
Coordinate Regulation of Basal and Cyclic 5'-Adenosine Monophosphate (cAMP)-Activated Expression of Human Chorionic Gonadotropin-{alpha} by Ets-2 and cAMP-Responsive Element Binding Protein
Mol. Endocrinol., April 1, 2005; 19(4): 1049 - 1066.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
J. S. Jorgensen, C. C. Quirk, and J. H. Nilson
Multiple and Overlapping Combinatorial Codes Orchestrate Hormonal Responsiveness and Dictate Cell-Specific Expression of the Genes Encoding Luteinizing Hormone
Endocr. Rev., August 1, 2004; 25(4): 521 - 542.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
Y.-H. Cheng, B. J. Aronow, S. Hossain, B. Trapnell, S. Kong, and S. Handwerger
Critical role for transcription factor AP-2{alpha} in human trophoblast differentiation
Physiol Genomics, June 17, 2004; 18(1): 99 - 107.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Knofler, L. Saleh, S. Bauer, B. Galos, H. Rotheneder, P. Husslein, and H. Helmer
Transcriptional Regulation of the Human Chorionic Gonadotropin {beta} Gene during Villous Trophoblast Differentiation
Endocrinology, April 1, 2004; 145(4): 1685 - 1694.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
Y.-H. Cheng, B. D. Richardson, M. A. Hubert, and S. Handwerger
Isolation and Characterization of the Human Syncytin Gene Promoter
Biol Reprod, March 1, 2004; 70(3): 694 - 701.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. W. Limesand, K. M. Jeckel, and R. V. Anthony
Pur{alpha}, a Single-Stranded Deoxyribonucleic Acid Binding Protein, Augments Placental Lactogen Gene Transcription
Mol. Endocrinol., February 1, 2004; 18(2): 447 - 457.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M. Li and R. E. Kellems
Sp1 and Sp3 Are Important Regulators of AP-2{gamma} Gene Transcription
Biol Reprod, October 1, 2003; 69(4): 1220 - 1230.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
Y.-H. Cheng and S. Handwerger
Identification of an Enhancer of the Human Activating Protein-2{alpha} Gene That Contains a Critical Ets1 Binding Site
J. Clin. Endocrinol. Metab., July 1, 2003; 88(7): 3305 - 3311.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
Y. Ikoma, S. Nomura, T. Ito, Y. Katsumata, M. Nakata, K. Iwanaga, M. Okada, F. Kikkawa, K. Tamakoshi, T. Nagasaka, et al.
Interleukin-1{beta} stimulates placental leucine aminopeptidase/oxytocinase expression in BeWo choriocarcinoma cells
Mol. Hum. Reprod., February 1, 2003; 9(2): 103 - 110.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. Ben-Zimra, M. Koler, and J. Orly
Transcription of Cholesterol Side-Chain Cleavage Cytochrome P450 in the Placenta: Activating Protein-2 Assumes the Role of Steroidogenic Factor-1 by Binding to an Overlapping Promoter Element
Mol. Endocrinol., August 1, 2002; 16(8): 1864 - 1880.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
H. J. Auman, T. Nottoli, O. Lakiza, Q. Winger, S. Donaldson, and T. Williams
Transcription factor AP-2{gamma} is essential in the extra-embryonic lineages for early postimplantation development
Development, January 6, 2002; 129(11): 2733 - 2747.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
T. Ito, S. Nomura, M. Okada, Y. Katsumata, A. Iwase, F. Kikkawa, M. Tsujimoto, and S. Mizutani
Transcriptional regulation of human placental leucine aminopeptidase/oxytocinase gene
Mol. Hum. Reprod., September 1, 2001; 7(9): 887 - 894.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
T. M. Thway and M. W. Wolfe
Epidermal Growth Factor Regulation of Equine Glycoprotein Hormone {{alpha}} Subunit Expression in Trophoblast Cells
Biol Reprod, July 1, 2001; 65(1): 197 - 203.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Knofler, L. Saleh, S. Bauer, R. Vasicek, G. Griesinger, H. Strohmer, H. Helmer, and P. Husslein
Promoter Elements and Transcription Factors Involved in Differentiation-Dependent Human Chorionic Gonadotrophin-{alpha} Messenger Ribonucleic Acid Expression of Term Villous Trophoblasts
Endocrinology, October 1, 2000; 141(10): 3737 - 3748.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
P. R. Kramer, R. Krishnamurthy, P. J. Mitchell, and S. Wray
Transcription Factor Activator Protein-2 Is Required for Continued Luteinizing Hormone-Releasing Hormone Expression in the Forebrain of Developing Mice
Endocrinology, May 1, 2000; 141(5): 1823 - 1838.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
C. LiCalsi, S. Christophe, D. J. Steger, M. Buescher, W. Fischer, and P. L. Mellon
AP-2 family members regulate basal and cAMP-induced expression of human chorionic gonadotropin
Nucleic Acids Res., February 15, 2000; 28(4): 1036 - 1043.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
B. L. Strauss and I. Boime
Cellular Localization of the Human Chorionic Gonadotropin {beta}-Subunit in Transgenic Mouse Placenta
Endocrinology, January 1, 2000; 141(1): 430 - 437.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
P.-Y. Chien, M. Ito, Y. Park, T. Tagami, B. D. Gehm, and J. L. Jameson
A Fusion Protein of the Estrogen Receptor (ER) and Nuclear Receptor Corepressor (NCoR) Strongly Inhibits Estrogen-Dependent Responses in Breast Cancer Cells
Mol. Endocrinol., December 1, 1999; 13(12): 2122 - 2136.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
T. W. Furlanetto, L. Q. Nguyen, and J. L. Jameson
Estradiol Increases Proliferation and Down-Regulates the Sodium/Iodide Symporter Gene in FRTL-5 Cells
Endocrinology, December 1, 1999; 140(12): 5705 - 5711.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
K. Yamada, H. Ogawa, S.-i. Honda, N. Harada, and T. Okazaki
A GCM Motif Protein Is Involved in Placenta-specific Expression of Human Aromatase Gene
J. Biol. Chem., November 5, 1999; 274(45): 32279 - 32286.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
W. Johnson and J. L. Jameson
AP-2 (Activating Protein 2) and Sp1 (Selective Promoter Factor 1) Regulatory Elements Play Distinct Roles in the Control of Basal Activity and Cyclic Adenosine 3',5'-Monophosphate Responsiveness of the Human Chorionic Gonadotropin-{beta} Promoter
Mol. Endocrinol., November 1, 1999; 13(11): 1963 - 1975.
[Abstract] [Full Text]


Home page
Mol Hum ReprodHome page
M. Knofler
What factors regulate HCG production in Down's syndrome pregnancies?: Regulation of HCG during normal gestation and in pregnancies affected by Down's syndrome
Mol. Hum. Reprod., October 1, 1999; 5(10): 895 - 897.
[Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
P. Pena, A. T. Reutens, C. Albanese, M. D’Amico, G. Watanabe, A. Donner, I-W. Shu, T. Williams, and R. G. Pestell
Activator Protein-2 Mediates Transcriptional Activation of the CYP11A1 Gene by Interaction with Sp1 Rather than Binding to DNA
Mol. Endocrinol., August 1, 1999; 13(8): 1402 - 1416.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
Y. Sun and M. L. Duckworth
Identification of a Placental-Specific Enhancer in the Rat Placental Lactogen II Gene That Contains Binding Sites for Members of the Ets and AP-1 (Activator Protein 1) Families of Transcription Factors
Mol. Endocrinol., March 1, 1999; 13(3): 385 - 399.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
D. Shi and R. E. Kellems
Transcription Factor AP-2gamma Regulates Murine Adenosine Deaminase Gene Expression during Placental Development
J. Biol. Chem., October 16, 1998; 273(42): 27331 - 27338.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. Ito, R. N. Yu, and J. L. Jameson
Steroidogenic Factor-1 Contains a Carboxy-Terminal Transcriptional Activation Domain That Interacts with Steroid Receptor Coactivator-1
Mol. Endocrinol., February 1, 1998; 12(2): 290 - 301.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. D. Gehm, J. M. McAndrews, P.-Y. Chien, and J. L. Jameson
Resveratrol, a polyphenolic compound found in grapes and wine, is an agonist for the estrogen receptor
PNAS, December 9, 1997; 94(25): 14138 - 14143.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Terzano, A. Flora, F. Clementi, and D. Fornasari
The Minimal Promoter of the Human alpha 3 Nicotinic Receptor Subunit Gene. MOLECULAR AND FUNCTIONAL CHARACTERIZATION
J. Biol. Chem., December 22, 2000; 275(52): 41495 - 41503.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Jakacka, M. Ito, J. Weiss, P.-Y. Chien, B. D. Gehm, and J. L. Jameson
Estrogen Receptor Binding to DNA Is Not Required for Its Activity through the Nonclassical AP1 Pathway
J. Biol. Chem., April 20, 2001; 276(17): 13615 - 13621.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Johnson, W.
Right arrow Articles by Jameson, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Johnson, W.
Right arrow Articles by Jameson, J. L.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement