JBC PeproTech; Our Business is Cytokines!

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Erlitzki, R.
Right arrow Articles by Fry, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Erlitzki, R.
Right arrow Articles by Fry, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 25, Issue of June 20, 1997 pp. 15881-15890
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Sequence-specific Binding Protein of Single-stranded and Unimolecular Quadruplex Telomeric DNA from Rat Hepatocytes*

(Received for publication, February 10, 1997, and in revised form, April 16, 1997)

Ronit Erlitzki and Michael Fry Dagger

From the Unit of Biochemistry, The Bruce Rappaport Faculty of Medicine, Technion-Israel Institute of Technology, P. O. Box 9649, Haifa 31096, Israel

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

A rat liver nuclear protein, unimolecular quadruplex telomere-binding protein 25, (uqTBP25) is described that binds tightly and specifically single-stranded and unimolecular tetraplex forms of the vertebrate telomeric DNA sequence 5'-d(TTAGGG)n-3'. A near homogeneous uqTBP25 was purified by ammonium sulfate precipitation, chromatographic separation from other DNA binding proteins, and three steps of column chromatography. SDS-polyacrylamide gel electrophoresis and Superdex© 200 gel filtration disclosed for uqTBP25 subunit and native Mr values of 25.4 ± 0.5 and 25.0 kDa, respectively. Sequences of uqTBP25 tryptic peptides were closely homologous, but not identical, to heterogeneous nuclear ribonucleoprotein A1, heterogeneous nuclear ribonucleoprotein A2/B1, and single-stranded DNA-binding proteins UP1 and HDP-1. Complexes of uqTBP25 with single-stranded or unimolecular quadruplex 5'-d(TTAGGG)4-3', respectively, had dissociation constants, Kd, of 2.2 or 13.4 nM. Relative to d(TTAGGG)4, complexes with 5'-r(UUAGGG)4-3', blunt-ended duplex telomeric DNA, or quadruplex telomeric DNA had >10 to >250-fold higher Kd values. Single base alterations within the d(TTAGGG) repeat increased the Kd of complexes with uqTBP25 by 9-215-fold. Association with uqTBP25 protected d(TTAGGG)4 against nuclease digestion, suggesting a potential role for the protein in telomeric DNA transactions.


INTRODUCTION

Linear eukaryotic chromosomes end with a specialized DNA-protein structure termed the telomere that guards the chromosome terminus against degradative attack or fusion with ends of other chromosomes (1-4). Telomeric DNA consists of evolutionarily conserved short, tandemly repeated nucleotide sequences. The telomeric DNA strand, oriented 5' to 3' toward the chromosome end ("G-strand") in all vertebrates, slime molds, filamentous fungi, and Trypanosoma, is a repeated 5'-d(TTAGGG)-3' sequence paired to a complementary 5'-d(CCCTAA)-3' strand. At their 3'-end, vertebrate telomeres terminate with a 12-16-nucleotide-long unpaired overhang of the G-strand (1-5). This single-stranded tract was shown to be capable of forming in vitro under physiological conditions a hairpin or unimolecular or bimolecular tetrahelical structures (5-14), which may have a role in telomere transactions (5).

The telomere hypothesis of cellular aging and tumorigenesis claims that progressive shortening of telomeres during the life span of somatic cells leads to the cessation of cell division and to cellular senescence (15). In contrast, by maintaining a stable length of either long or short telomeres, respectively, germ line cells and tumor cells avoid division cycle exit and continue to divide infinitely (15). This hypothesis is sustained by data showing that whereas telomeric DNA is progressively trimmed in the course of the aging of diverse somatic cells, its length persists in immortal germ line and cancer cells (Refs. 16-19; reviewed in Ref. 15). The progressive shortening of telomeres in somatic cells and the contrasting maintenance of their length in indefinitely dividing cells is partly accounted for by their different levels of activity of telomerase, the telomeric G-strand-extending enzyme. Whereas telomerase activity is undetectable in numerous somatic tissues and in dividing primary cells, many cancer cells retain an active enzyme (Refs. 17-21; reviewed in Refs. 22 and 23). That telomerase does not exclusively determine telomere length is inferred, however, by the observation that some tumor cells whose telomere length remains stable have no measurable telomerase activity (24), and conversely, an active telomerase is detected in normal bone marrow cells and blood cells (25). Further, the loss of 50-200-nucleotide-long segments of telomeric DNA with each round of replication of somatic cells (26-28) suggests that exonucleolytic degradation of the terminus of telomeric DNA may also contribute to its progressive trimming. It has been suggested, therefore, that telomeric DNA binding proteins that were identified in diverse species may participate in the complex dynamics of elongation and shortening of telomeric DNA (4, 29). Some such proteins from different species bind tightly single-stranded telomeric DNA (30-33). Other proteins bind to or mediate the formation of tetraplex forms of telomeric DNA (33-42). Proteins of a third category selectively associate with the duplex region of telomeric DNA (43-46).

In this work we describe the purification from rat hepatocytes and characterization of a 25-kDa monomeric protein, termed uqTBP25, that binds tightly and in a sequence-specific fashion single-stranded and unimolecular tetraplex forms of the G-strand of telomeric DNA. A partial amino acid sequence of uqTBP25 is closely homologous but not identical with sequences of hnRNP1 A1 and hnRNP A2/B1 and their respective derivative single-stranded DNA-binding proteins UP1 and HDP-1. Protein uqTBP25 is distinguished from hnRNP A1 and A2/B1 by its molecular size, preferential binding to DNA over RNA, and sequence-specific binding to the telomeric DNA G-strand. This protein also differs from UP1 and HDP-1 by its selective binding to the G-strand of telomeric DNA and by its failure to significantly stimulate the activity of DNA polymerase alpha .


EXPERIMENTAL PROCEDURES

Materials and Enzymes

Radioactively 5'-labeled [gamma -32P]ATP (~3000 Ci/mmol), [alpha -32P]dGTP (~3000 Ci/mmol), Klenow fragment of Escherichia coli polymerase I, and molecular mass RainbowTM marker proteins were products of Amersham Corp. Synthetic DNA oligomers, listed in Table I, were purchased from Operon Technologies. The HPLC-purified RNA oligomer r(UUAGGG)4 (Table I) was a product of Midland Reagent. Boric acid, beta -mercaptoethanol, dithiothreitol (DTT), N-ethylmaleimide (MalNEt), poly(dG)·poly(dC), thymidine 3',5'-diphosphate, dimethyl sulfate, leupeptin, aprotinin, benzamidine, phenylmethylsulfonyl fluoride, Nonidet P-40, Sephadex G-50, phenyl-Sepharose, proteinase K, salmon sperm DNA, soybean trypsin inhibitor, and micrococcal nuclease were supplied by Sigma. DEAE-cellulose (DE-52) and DE-81 filter paper were the products of Whatman. Total RNA from yeast was supplied by Boehringer Mannheim. Bacteriophage T4 polynucleotide kinase and RNasin were provided by Promega. Acryl/bisacrylamide (19:1 or 30:1.2) was purchased from Amresco. Bacteriophage T4 gene 32 protein was purchased from Boehringer Mannheim. Immunoaffinity-purified calf thymus DNA polymerase alpha  was the gift of Dr. L. A. Loeb (University of Washington). Kodak XAR5 and Biomax MR-1 autoradiographic film, urea, TEMED, bromphenol blue, and xylene cyanol FF were supplied by IBI. HiTrap Blue HPLC column and Superdex© 200 HPLC gel filtration column were provided by Pharmacia Biotech Inc. Econo-Pac S HPLC cartridge, reagents for sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), and molecular weight protein standards were the products of Bio-Rad. Novex provided MultimarkTM molecular size protein standards. Biotrace polyvinylidene difluoride binding matrix membranes were supplied by Gelman Sciences.

Table I. DNA and RNA oligomers used in this study


Oligomer designation Length Nucleotide sequence

TeR-5a 38-mer 5'-GTCGACCCGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA)-3'
TeR-4a 24-mer 5'-d(TTAGGGTTAGGGTTAGGGTTAGGG)-3'
TeR-3a 23-mer 5'-d(GTCGACCCGGGTTAGGGTTAGGG)-3'
TeR-2a 23-mer 5'-d(TAGACATGTTAGGGTTAGGGTTA)-3'
TeR-1a 17-mer 5'-d(TAGACATGTTAGGGTTA)-3'
rTeR-4a 24-mer 5'-r(UUAGGGUUAGGGUUAGGGUUAGGG)-3'
TeR-4 Cb 24-mer 5'-d(CCCTAACCCTAACCCTTACCCTTA)-3'
TeR-3 Cb 23-mer 5'-d(CCCTAACCCTAACCCGGGTCGAC)-3'
TeT-4a,c 24-mer 5'-d(GGGGTTGGGGTTGGGGTTGGGGTT)-3'
TeT-2a,c 23-mer 5'-d(TAGACATGTTGGGGTTGGGGTTG)-3'
Mut1 TeR-4c 24-mer 5'-d(TTAGAGTTAGAGTTAGAGTTAGAG)-3'
Mut2 TeR-4c 24-mer 5'-d(TAAGGGTAAGGGTAAGGGTAAGGG)-3'
Hook TeR-4a 32-mer 5'-d(CTGGACCCGGGTTAGGGTTAGGGTTAGGGTTA)-3'
Hook TeR-4 Cb 29-mer 5'-d(TAACCCTAACCCTAACCCTAACCCGGGTC)-3'
Qa 20-mer 5'-d(TACAGGGGAGCTGGGGTAGA)-3'
Single Qa 7-mer 5'-(TTGGGT)-3'
Anti-Qb 20-mer 5'-d(TCTACCCCAGCTCCCCTGTA)-3'

a Clusters of guanine residues are underlined.
b Clusters of cytosine residues are underlined.
c Loci of a substituted nucleotide relative to TeR-4 DNA are doubly underlined.

Preparation of Single-stranded, Double-stranded, and Tetraplex DNA Oligomers

Full-length DNA oligomers were purified by electrophoresis through a 8 M urea, 15% polyacrylamide denaturing gel (acryl/bisacrylamide, 19:1) as we described (47). The purified DNA or RNA oligomers were labeled at their 5'-end with 32P in a bacteriophage T4 polynucleotide kinase-catalyzed reaction (48). Oligomers were maintained in their single-stranded conformation as a 0.25-0.70 µM solution in 1.0 mM EDTA, 10 mM Tris-HCl buffer, pH 8.0 (TE buffer), and were boiled immediately prior to use. Double-stranded telomeric DNA was prepared by annealing a 1.25-fold molar excess of a cytosine-rich sequence with a complementary guanine-rich oligomer, and duplex DNA molecules were electrophoretically resolved from residual DNA single strands as we described (33). Labeling of a protruding end of the annealed duplex DNA was catalyzed by the Klenow fragment of E. coli polymerase I using 5'-[alpha -32P]dGTP as we described previously (47). Unimolecular (G'4) and bimolecular (G'2) tetraplex forms of TeR DNA were prepared, their stoichiometry was verified, and their stabilization by Hoogsteen bonds was demonstrated, as we described in detail elsewhere (33). Parallel G4 quadruplex forms of oligomers Q and single Q were prepared according to Sen and Gilbert (48), and their stoichiometry was shown to be tetramolecular as recently described (33). The parallel quadruplex form of d(CGG)8 was prepared, and its structure was verified as previously detailed (49).

Electrophoretic Mobility Shift Assays, SDS-PAGE, and Southwestern Blotting

The DNA binding activity of uqTBP25 was monitored by electrophoretic mobility shift assay as we described previously (33, 50). In a typical assay for the binding of single-stranded TeR-4 or TeR-2 DNA, 5.0-15.0 ng of 32P-5'-labeled TeR-2 or TeR-4 DNA was incubated at 4 °C for 20 min with 30-3000 ng of purified or crude protein fraction in a 15-µl final volume of buffer D (0.5 mM EDTA, 20% glycerol in 25 mM Tris-HCl buffer, pH 7.5). The binding mixture was electrophoresed in a Mini PROTEAN II electrophoresis system (Bio-Rad) at 4 °C under 10 V/cm through a nondenaturing 6% polyacrylamide gel (acryl/bisacrylamide, 30:1.2) in 0.6 × TBE buffer (1.2 mM EDTA in 0.54 M Tris borate buffer, pH 8.3) until a bromphenol blue tracking dye migrated 2.5-4.0 cm into the gel. The gels were dried on DE-81 filter paper and exposed to x-ray film or to a phosphor imaging plate (Fuji). The proportion of free and uqTBP25-bound TeR DNA was determined by phosphor imaging, and their amounts were deduced from the known specific activity of the labeled DNA probe. One unit of uqTBP25 DNA binding activity was defined as the amount of uqTBP25 that bound 66 pmol of single-stranded TeR-2 DNA under the described standard conditions. Standard assay conditions were also employed for the binding of tetramolecular G4 quadruplex DNA and of double-stranded DNA. Binding of tetraplex G'2 TeR DNA or G'4 TeR DNA was assayed as described above except that 50 mM KCl or 50 mM NaCl, respectively, was added to the DNA binding mixture to preserve the quadruplex structure of the DNA, the 0.6 × TBE gel running buffer contained 50 mM KCl or 50 mM NaCl as necessary, and electrophoresis was performed at 4 °C.

SDS-PAGE and silver or Coomassie Blue staining of resolved protein bands was carried out as we described previously (50). Molecular size protein markers were the Amersham RainbowTM, Novex MultimarkTM, or Bio-Rad prestained or unstained molecular weight standards.

Southwestern analysis was conducted according to Petracek et al. (31) with the minor modifications that we recently introduced (33). TeR-4 DNA binding activity was detected in nuclear extracts by exposing the electrophoretically resolved proteins to 0.85 µg of 32P-5'-labeled TeR-4 DNA in the presence of 50 mM NaCl.

Purification of uqTBP25

In a typical preparation, protein uqTBP25 was purified to near homogeneity from ~700 g of liver tissue from adult rats. Salt extracts of nonhistone nuclear proteins were prepared from isolated hepatocyte nuclei as we described elsewhere (52), except that the composition of the extraction buffer was 0.4 M NaCl, 1 mM phenylmethylsulfonyl fluoride, 0.1 mM benzamidine, and 10 µg/ml each of the protease inhibitors soybean trypsin inhibitor, leupeptin, and aprotinin in buffer D. The preparation of protein extracts and all of the subsequent steps of uqTBP25 purification were conducted at 4 °C. Electrophoretic mobility shift assays and Southwestern analysis showed that rat liver nuclear extracts contained G'4 TeR-4 DNA binding activity with an approximate molecular size of 24 kDa (see "Results"). This protein was further purified by successive steps of ammonium sulfate precipitation and column chromatography. Elution profiles of the DNA binding activity from the various columns, as assessed by electrophoretic mobility shift analysis were identical when 32P-5'-labeled single-stranded TeR-2 or TeR-4 DNA or unimolecular tetraplex G'4 TeR-4 DNA were used as probes. In an initial purification step, extract proteins were precipitated by 50% ammonium sulfate and removed by centrifugation. The majority of the TeR DNA binding activity that remained in the supernatant was subsequently precipitated by 70% ammonium sulfate. The 70% ammonium sulfate precipitate was resuspended in buffer D and was dialyzed overnight at 4 °C against ~200 volumes of the same buffer. After adding NaCl to the dialyzed protein fraction to a final concentration of 50 mM, it was mixed with heat-denatured salmon sperm DNA and incubated for 20 min at 4 °C at a protein:DNA ratio of 30:1 (w/w). Whereas the major TeR-binding protein qTBP42 (33) and additional single-stranded DNA-binding proteins associated tightly with the denatured DNA, uqTBP25 did not bind detectably to it. The strong binding of DNA and DNA-protein complexes to DEAE-cellulose (53) was subsequently utilized to separate uqTBP25 from qTBP42 (33) and from additional proteins that associated with denatured DNA. The protein-DNA mixture was loaded at a ratio of 4.0 mg of protein/ml of packed resin, onto a DE-52 column equilibrated in buffer D containing 50 mM NaCl. The protein-loaded column was washed with 0.5 and subsequently with 1.5 packed column volumes of the equilibration buffer, and bound proteins were eluted by two packed column volumes each of 100 and 225 mM NaCl in buffer D. Electrophoretic mobility shift analysis and SDS-PAGE separation of UV cross-linked TeR-4 DNA-protein complexes, respectively, revealed TeR-4 DNA binding activity and UV cross-linked TeR-4 DNA-protein complexes of 34 kDa in the 50 mM NaCl wash fractions. Similar analysis did not reveal DNA-protein complexes in the 100 mM NaCl fraction; instead, multiple complex bands, the dominant of which was qTBP42 (33), were present in the 225 mM NaCl eluate. The 50 mM NaCl eluate fractions were pooled together and dialyzed overnight against ~50 volumes of buffer P (0.5 mM EDTA, 20% glycerol in 25 mM NaPO4 buffer, pH 7.0). The dialyzed fractions were loaded at a ratio of 24.0 mg of protein/ml of packed resin onto a 5.0-ml Econo-Pac S column equilibrated in buffer P and mounted on a GradiFrac low pressure chromatography device (Pharmacia). The loaded column was washed with 7.5 packed resin volumes of buffer P, and bound proteins were eluted from the column by a linear gradient of 19.5 column volumes of 0.0-1.0 M NaCl in buffer P. Fifty fractions were collected, and as done in every subsequent chromatography, aliquots were dialyzed overnight against 150 volumes of buffer D and then assayed for G'4 TeR-4 DNA binding. G'4 TeR-4 DNA binding activity of uqTBP25 was detected in the 150-320 mM NaCl eluate both by electrophoretic mobility shift analysis and by the identification in SDS-PAGE of a ~34-kDa UV-cross-linked protein-TeR-4 DNA complex. The active fractions were pooled together, dialyzed overnight against 150 volumes of P2 buffer (0.5 mM EDTA, 20% glycerol in 10 mM NaPO4, pH 7.0), and loaded at a ratio of 8.5 mg of protein/ml of packed resin onto a 1.0-ml HiTrap Blue HPLC column equilibrated in P2 buffer and mounted on a GradiFrac device. The loaded column was washed by six column volumes of the equilibration buffer, and adsorbed proteins were eluted by a 21-packed column volume linear gradient of 0.0-4.0 M NaCl in P2 buffer. Fifty fractions were collected, aliquots were dialyzed, and uqTBP25 binding activity was detected by electrophoretic mobility shift analysis and SDS-PAGE of UV cross-linked protein-TeR-4 DNA complexes in fractions that were eluted from HiTrap Blue by 2.5-3.5 M NaCl. Fractions containing the binding activity were pooled together and dialyzed overnight against ~50 volumes of 4.0 M NaCl in buffer S (1.0 mM EDTA in 25 mM Tris-HCl buffer, pH 7.5) and loaded at a ratio of 1.0 mg of protein:1.0 ml of packed resin onto a phenyl-Sepharose column equilibrated in buffer S. The loaded column was washed with two packed column volumes of the equilibration buffer, and bound proteins were eluted by a stepwise gradient of 4.0-0.0 M NaCl in buffer S followed by a 40% ethylene glycol wash to elute proteins that remained adsorbed to phenyl-Sepharose at 0.0 M NaCl. Fractions were collected into Nonidet P-40 (0.05% final concentration), and the activity of uqTBP25 was detected in fractions that were eluted from the phenyl-Sepharose column by 1.0-0.5 M NaCl. Silver and Coomassie Blue staining of the eluted proteins indicated that a 25-kDa species was the major protein eluted by 1.0-0.5 M NaCl (Fig. 2C), whereas the majority of the proteins that were loaded onto the column were eluted by 40% ethylene glycol. Determination of the protein content of the collected fractions and silver or Coomassie Blue staining of SDS-PAGE-resolved protein bands was directly performed on fractions that were dialyzed against water. Fractions that were used for the assay of DNA binding activity were stabilized by the immediate addition soybean trypsin inhibitor protein (200 µg/ml final concentration), and following their dialysis overnight against ~200 volumes of buffer D, they were stored in aliquots at -80 °C. Under these storage conditions, the DNA binding activity was fully preserved for at least 4 months.


Fig. 2. TeR-4 DNA binding activity and SDS-PAGE of proteins in phenyl-Sepharose-purified fractions of uqTBP25. A HiTrap Blue-purified fraction of uqTBP25 (1.3 mg of protein) was loaded onto a column of phenyl-Sepharose (1.3-ml packed volume), proteins were eluted by a stepwise gradient of 4.0-0.0 M NaCl, and fractions were collected into 0.05% Nonidet P-40 (final concentration) as described under "Experimental Procedures." A, mobility shift electrophoresis of fractions resolved by phenyl-Sepharose. Fractions were assayed for 32P-5'-labeled G'4 TeR-4 DNA binding activity as detailed under "Experimental Procedures." B, SDS-PAGE of UV-cross-linked phenyl-Sepharose-resolved proteins. To bind G'4 TeR-4 DNA to uqTBP25, 6.0-µl aliquots of each phenyl-Sepharose-resolved fraction were incubated at 4 °C for 15 min with 1.05 pmol of 32P-5'-labeled G'4 TeR-4 DNA in the presence of 50 mM NaCl in a final volume of 15.0 µl. Protein-DNA complexes were covalently cross-linked by irradiating the samples at 4 °C for 5 min in a microtiter plate at a distance of 6 cm from a UVP (San Gabriel, CA) UV light source (254 nm, 580 microwatts/cm2 at 6 inches). The irradiated samples were electrophoresed through an SDS, 13% polyacrylamide gel, which was dried and exposed to autoradiographic film. The position of a 34-kDa protein-DNA complex present in fractions 10-14 is marked with an arrow. C, Coomassie Blue staining of SDS-PAGE-resolved phenyl-Sepharose proteins. Electrophoresis and protein staining were conducted as described under "Experimental Procedures." An arrow marks the position of the 25-kDa band that was eluted into fractions 10-14.
[View Larger Version of this Image (32K GIF file)]

Measurement of the Effect of uqTBP25 on Polymerase alpha -Catalyzed DNA Synthesis

DNA synthesis was conducted for 30 min at 37 °C in a reaction mixture that contained in a final volume of 25 µl: 20 mM Tris-HCl buffer, pH 7.5, 3.0 mM MgCl2, 1.0 mM DTT, 2.1 units of immunoaffinity-purified calf thymus DNA polymerase alpha . The DNA primer-templates and dNTP substrates were either 1.0 µg of poly(dG)·poly(dC) and 25 µM [alpha -32P]dGTP (specific activity 5,450 cpm/pmol) or 0.5 µg of bacteriophage M13mp2 single-stranded DNA primed by a 17-mer universal primer and 25 µM concentration of each of the four dNTPs and [alpha -32P]dGTP (specific activity 1260 cpm/pmol). Increasing amounts of phenyl-Sepharose-purified uqTBP25 were added to the reaction mixtures as detailed under "Results." DNA synthesis was terminated, acid-insoluble DNA was precipitated, and incorporation of [32P]dGMP into DNA was measured as described previously (53).

Determination of the Amounts of Protein

The Bio-Rad protein assay kit was used to determine amounts of protein.


RESULTS

Purification of the Telomeric DNA-binding Protein uqTBP25

Activities that bind single-stranded and tetraplex forms of the vertebrate telomeric sequence TeR-4, 5'-d(TTAGGG)4-3', were detected by electrophoretic mobility shift analysis in extracts of nonhistone nuclear proteins from rat hepatocyte. Southwestern analysis of the unimolecular tetraplex G'4 TeR-4 DNA binding activity detected in replicate nuclear extracts a major protein-G'4 TeR-4 DNA complex band of ~24 kDa and two minor bands of 31 and 33 kDa, respectively (for a typical analysis, see Fig. 1A). To isolate the ~24-kDa binding activity, the nuclear extract was initially fractionated by ammonium sulfate precipitation. The major portion of an activity that bound single-stranded TeR-4 or unimolecular tetraplex G'4 TeR-4 DNA was detected by electrophoretic mobility shift analysis in the 50-70% (NH4)2SO4 precipitate. To resolve TeR DNA-specific binding activity from other proteins that bind nonspecifically to single-stranded DNA, the resuspended and dialyzed 70% ammonium sulfate precipitate was incubated with denatured salmon sperm DNA and than chromatographed on a DE-52 column. DNA and DNA-protein complexes strongly adsorb to the anion exchanger, whereas some proteins that do not bind to denatured DNA adsorb weakly to DE-52 (53). Electrophoretic mobility shift analysis of G'4 TeR-4 DNA binding activity and SDS-PAGE resolution of UV-cross-linked protein-G'4 TeR-4 DNA complexes revealed an electrophoretically retarded 34-kDa complex band in fractions that were eluted from DE-52 by 50 mM NaCl (see "Experimental Procedures"). Several additional proteins, including qTBP42 (33), that formed complexes with denatured DNA and tightly adsorbed to DE-52 were eluted from the column by 225 mM NaCl (see "Experimental Procedures"). The TeR-4 DNA binding activity that was eluted from DE-52 by 50 mM NaCl was further purified by successive steps of chromatography on columns of Econo-Pac S, HiTrap Blue and phenyl-Sepharose. Elution profiles of the TeR DNA binding activity from the different columns, as revealed by electrophoretic mobility shift analysis were identical when 32P-5'-labeled single-stranded TeR-2 or unimolecular tetraplex G'4 TeR-4 DNA were used as probes. SDS-PAGE resolution of proteins in the different fractions, and their silver staining demonstrated a progressive depletion of proteins in the course of uqTBP25 purification (Fig. 1B). Note a 25-kDa protein band that became discernible in the HiTrap Blue fraction of uqTBP25 (Fig. 1B). The intensity of Coomassie Blue staining of this 25-kDa protein band was directly proportional to the level of TeR-4 DNA binding activity in the HiTrap Blue fractions (results not shown). This protein became highly enriched after phenyl-Sepharose purification (Fig. 1B).


Fig. 1. Southwestern analysis of G'4 TeR-4 DNA binding activity in nuclear extract and protein purification. A, Southwestern blotting of unimolecular tetraplex G'4 TeR-4 DNA binding activity in nuclear extract from rat hepatocyte. Aliquots of nonhistone nuclear protein extract from rat hepatocytes were either boiled in the presence of 85 mM beta -mercaptoethanol (beta -ME) or were left untreated and without beta -mercaptoethanol. The protein samples were electrophoresed through an SDS-10% polyacrylamide gel, the resolved proteins were renatured and exposed to 32P-5'-labeled TeR-4 DNA in the presence of 50 mM NaCl, and unbound probe was washed (see "Experimental Procedures"). Shown is an autoradiogram of the dried blotted gel. An arrow marks the position of a major G'4 TeR-4 DNA-binding protein band of ~24 kDa. B, SDS-PAGE analysis of proteins in successively purified fractions of uqTBP25. Approximately 6 µg of protein of crude nuclear extract and of each partially purified fraction of uqTBP25 were electrophoresed through an SDS-13% polyacrylamide gel, and the resolved protein bands were stained with silver (see "Experimental Procedures"). A 25-kDa protein band that became detectable in the HiTrap Blue fraction and was enriched in the phenyl-Sepharose fraction is marked with an arrow.
[View Larger Version of this Image (66K GIF file)]

Results shown in Fig. 2 indicated that the 25-kDa protein band, which was purified to near homogeneity by phenyl-Sepharose chromatography, corresponded to the TeR DNA binding activity. As seen in Fig. 2A, TeR-4 DNA binding activity was detected by mobility shift electrophoresis in phenyl-Sepharose fractions 10-14 (1.0-0.5 M NaCl eluate). Covalent UV cross-linking of labeled DNA to the phenyl-Sepharose-resolved proteins revealed in fractions 10-14 a 34-kDa protein-TeR-4 DNA complex (Fig. 2B), whose amount corresponded to the TeR DNA binding activity (Fig. 2A). Finally, SDS-PAGE resolution of the phenyl-Sepharose protein fractions showed that the intensity of a Coomassie Blue-stained 25-kDa band, which constituted >80% of the protein content of fractions 11-13 (Fig. 2C) was well correlated with the level of TeR-4 DNA binding activity in fractions 10-14 (Fig. 2A) and with the amount of the UV-cross-linked TeR-4-protein complex in these fractions (Fig. 2B). The ~25-kDa size of the unimolecular tetraplex G'4 TeR-4 DNA binding activity as detected in nuclear extracts by Southwestern analysis (Fig. 1A) as well as the 25-kDa molecular mass of the highly purified active protein (Fig. 2C) and the 34-kDa size of its complex with TeR-4 DNA (Fig. 2B) strongly suggested that the 25-kDa protein represented uqTBP25. Details of a typical purification scheme summarized in Table II indicated that, relative to crude nuclear extract, the phenyl-Sepharose fraction of uqTBP25 was purified more than 1000-fold with a final yield of 2.2%.

Table II. Purification of uqTBP25

The total volume of each fraction obtained in a typical purification procedure of uqTBP25 as well as its protein content and TeR-2 DNA binding activity were measured as described under "Experimental Procedures" except that the assay of 32P-5'-labeled TeR-2 binding was performed in the presence of a 25-fold molar excess of the nonspecific DNA competitor d(C-T)31. This competitor DNA associated in crude fractions with DNA-binding proteins other than uqTBP25 but did not significantly bind to uqTBP25 (see Table IV).

Purification step Total protein Binding activity Specific activity Yield Purification

mg units × 103 units × 103/mg % -fold
Crude nuclear extract 12,400.0 3,100.0 0.25 100.0 1.0
Ammonium sulfate 1,296.0 896.0 0.69 28.9 2.8
DNA-DEAE cellulose 480.0 393.6 0.82 12.7 3.3
Econo-Pac S 42.83 215.4 5.03 6.9 20.1
HiTrap Blue 5.81 77.3 13.30 2.5 53.2
Phenyl-Sepharose 0.26 69.6 267.70 2.2 1070.8

Chemical-Physical Properties of uqTBP25

Some properties of uqTBP25 are presented in Table III. That uqTBP25 was proteinaceous was demonstrated by its heat lability, inactivation by SDS, and sensitivity to proteinase K. The resistance of uqTBP25 to digestion by micrococcal nuclease (Table III) suggested that it did not require an essential nucleic acid component. Binding of TeR-4 DNA by uqTBP25 was not affected by exposure to 8.5 mM MalNEt (Table III), indicating that reduced protein sulfhydryl groups were not directly involved in the protein interaction with DNA. This was also corroborated by the equally efficient renaturation of the 25-kDa protein in Southwestern blotting with or without the presence of beta -mercaptoethanol (Fig. 1A).

Table III. Properties of uqTBP25

Binding of 32P-5'-labeled TeR-4 by phenyl-Sepharose-purified uqTBP25 was conducted under standard conditions without or with the indicated treatments. The uqTBP25-G'4 TeR-4 DNA complex was resolved by mobility shift electrophoresis, and its amount was quantified by phosphor imaging.

Treatment Percentage of initial activity

None 100.0
100 °C, 2 min 52.1
100 °C, 8 min 20.5
Proteinase K digestiona 1.5
0.25% SDS 0.0
Micrococcal nucleaseb 120.6
8.5 mM MalNEtc 98.0

a uqTBP25 protein (5.9 binding units) was incubated at 37 °C for 60 min with 26.7 µg/µl proteinase K and than incubated with 32P-5'-labeled G'4 TeR-4 DNA. Shown is an average result of four independent determinations.
b uqTBP25 protein (9.2 binding units) was incubated at 37 °C for 50 min with 15.0 µg/ml micrococcal nuclease in the presence of 1.0 mM CaCl2. Digestion was terminated by the addition of EGTA and thymidine 3',5'-diphosphate to final concentrations of 5.0 and 4.0 mM, respectively, and the treated protein was incubated with 32P-5'-labeled G'4 TeR-4 DNA. Shown is an average result of six determinations.
c uqTBP25 protein (2.5 binding units) was incubated at 4 °C for 15 min with 8.5 mM MalNEt, and the reaction was terminated by the addition of 15.0 mM DTT. The average result of three experiments is shown.

The highly purified uqTBP25 migrated in SDS-PAGE as a 25.4 ± 0.4-kDa polypeptide (n = 6). An apparent molecular size of 25.0 kDa (n = 2), which was found for native uqTBP25 by Superdex 200© gel filtration, suggested that uqTBP25 was a 25-kDa monomeric protein.

Sequence Homology among uqTBP25, Two hnRNP Species, and Their Derivative Single-stranded DNA-binding Proteins

To find out whether or not uqTBP25 represented a known protein, sequences of five tryptic peptides of uqTBP25 were determined. A computerized search through GenBankTM revealed all five uqTBP25 peptide sequences to be closely homologous, although not identical, to conserved amino acid sequences in hnRNP A1 and A2/B1 and in their derivative amino-terminal proteolytic fragments, calf thymus single-stranded DNA-binding proteins UP1 (58, 61, 64) and mouse HDP-1 (58, 64), respectively. The sequence of hnRNP A1 that remained identical in four mammalian species (Table IV) and of its cognate single-stranded binding protein UP1 (58, 61, 64) differed from the corresponding partial sequence of uqTBP25 by 4 amino acids out of 43 sequenced residues. One dissimilar amino acid represented a nonconservative G to Q substitution in uqTBP25 peptide IV (Table IV). Most notable, amino acid sequences of uqTBP25 were clearly distinct from those of cloned rat hnRNP A1 and of rat UP1 (Table IV; Refs. 61 and 62). The dissimilarity between uqTBP25 and rat hnRNP A1 extended to their different molecular sizes of 25 and 34.2 kDa, respectively (see above, under "Results"; Ref. 61), and uqTBP25 differed from both hnRNP A1 and UP1 by its nucleic acid binding preferences (see below, under "Results" and "Discussion"). Hence, despite their close sequence similarity, uqTBP25, hnRNP A1, and UP1 was each a distinct protein. An extensive sequence similarity was also found for uqTBP25 and human hnRNP A2/B1 (Table IV) and its derivative fragment, the DNA-binding protein HDP-1 (58, 64). However, six amino acid alterations were noted among the 43 sequenced uqTBP25 residues, two of which, E to A and N to A in uqTBP25 peptide V, constituted nonconservative substitutions (Table IV). Differences between rat uqTBP25 and human hnRNP A2/B1 also extended to their different molecular sizes of 25 and 36-37.4 kDa, respectively (Table IV; Ref. 54), and both hnRNP A2/B1 and HDP-1 differed from uqTBP25 by their nucleic acid binding specificity (see below, under "Results" and "Discussion").

Table IV. Amino acid sequences of tryptic peptides of uqTBP25 and of homologous proteins

Phenyl-Sepharose-purified uqTBP25 was resolved by SDS-PAGE, and the Coomassie Blue-stained 25-kDa band was excised from the gel, extracted, and digested by trypsin. Amino acid sequences of select HPLC-resolved tryptic peptides were determined by standard sequencing technique. The underlined areas mark homologies between the uqTBP25 peptides and hnRNP sequences as delineated by a computerized search through the GenBankTM sequence data base.

uqTBP25 and homologue protein-derived peptides Amino acid sequence Reference

uqTBP25 peptide I IFVGGIK
  Human hnRNP A2/B1a LFVGGIK 54, 55
  Human hnRNP A1b IFVGGIK 56, 57
  Bovine hnRNP A1 IFVGGIK 58, 59
  Mouse hnRNPA1 IFVGGIK 60
  Rat hnRNPA1 IFVGGIK 61, 62
  Xenopus laevis hnRNP A1 IFVGGIK 63
uqTBP25 peptide II DYFEQYGK
  Human hnRNP A2/B1 DYFEEYGK 54, 55
  Human hnRNP A1 DYFEQYGK 56, 57
  Bovine hnRNP A1 DYFEQYGK 58, 59
  Mouse hnRNP A1 DYFEQYGK 60
  Rat hnRNP A1 DYFEQYGK 61, 62
  X. laevis hnRNP A1 EYFEQYGK 63
uqTBP25 peptide III IVLQK
  Human hnRNP A2/B1 IVLQK 54, 55
  Human hnRNP A1 IVIQK 56, 57
  Bovine hnRNP A1 IVIQK 58, 59
  Mouse hnRNP A1 IVIQK 60
  Rat hnRNP A1 IVIQK 61, 62
  X. laevis hnRNP A1 IVIQK 63
uqTBP25 peptide IV SGKPGAHVTVK
  Human hnRNP A2/B1 SGKPGAHVTVK 54, 55
  Human hnRNP A1 SQRPGAHLTVK 56, 57
  Bovine hnRNP A1 SQRPGAHLTVK 58, 59
  Mouse hnRNP A1 SQRPGAHLTVK 60
  Rat hnRNP A1 SQRPGAHLTVK 61, 62
  X. laevis hnRNP A1 SSRPGAHLTVK 63
uqTBP25 peptide Vc (T)(V)(E)EVDAAMNAR
  Human hnRNP A2/B1  S  M  A EVDAAMAAR 54, 55
  Human hnRNP A1  T  V  E EVDAAMNAR 56, 57
  Bovine hnRNP A1  T  V  E EVDAAMNAR 58, 59
  Mouse hnRNP A1  T  V  E EVDAAMNAR 60
  Rat hnRNP A1  T  V  E EVDAAMNAR 61, 62
  X. laevis hnRNP A1  S  T  D EVDAAMTAR 63

a The single-stranded binding protein HDP-1 is 100% homologous to the amino-terminal end of hnRNP A2/B1, which includes all five sequences shown in this table (58, 64).
b The single-stranded binding protein UP1 is 100% homologous to the amino-terminal end of hnRNP A1, which includes all five sequences shown in this table (58, 61, 64).
c Minor or alternate residues were detected in the NH2-terminal three positions of the peptide: D, H, or T, in the first position, T or V in the second, and E or I in the third.

Sequence Specificity of the Binding of TeR DNA by uqTBP25

The sequence specificity of binding of DNA by uqTBP25 was first assessed by measurements of the relative association of the protein with 32P-5'-labeled TeR-2 DNA in the presence of a 50 or 75-fold molar excess of different unlabeled competing DNA sequences. Results summarized in Table V indicated that the binding of single-stranded TeR-2 DNA was not diminished significantly when a 50-fold molar excess of various unlabeled single-stranded DNA sequences was present. Similar results were obtained in reactions that contained a 75-fold molar excess of the competing sequences over TeR-2 DNA (data not shown). Notably, DNA sequences that did or did not contain guanine clusters were similarly ineffective as competitors with TeR-2 DNA. Hence, the guanine-rich oligomers d(G)16, the fragile X syndrome expanded sequence d(CGG)8, Tetrahymena telomeric TeT G-strand DNA, and the IgG switch region sequence oligomer Q did not compete efficiently with TeR-2 DNA upon its binding to uqTBP25 (Table V). As a result of quantitative annealing under the standard binding conditions of TeR-4 C DNA to TeR-4 DNA (Ref. 66; our results), the labeled single-stranded TeR-4 DNA was eliminated from the reaction, and the efficacy of TeR-4 C DNA as a competitor could not be assessed. However, a direct binding assay failed to reveal the formation of a detectable complex between uqTBP25 and 32P-5'-labeled TeR-4 C DNA when the labeled probe was added at concentrations of up to 560 nM (results not shown). Hence, unlike the recently described qTBP42 (33), uqTBP25 did not measurably bind to the cytosine-rich telomeric DNA strand. An excess of yeast total RNA also failed to compete with TeR-2 DNA upon binding to uqTBP25 (Table V), and a direct binding assay did not detect complex formation between uqTBP25 and labeled yeast total RNA at up to 200 nM (results not shown).

Table V. Specificity of binding of 32P-5'-labeled TeR-2 DNA by uqTBP25

Protein uqTBP25 (2.5 units) was incubated under standard binding conditions with 2.1 pmol of 32P-5'-labeled TeR-2 DNA with or without a 50-fold molar excess of the listed unlabeled competitor DNA sequences. Complexes of uqTBP25 with the labeled TeR-2 DNA were resolved by mobility shift electrophoresis and quantified by phosphor imaging. Results are presented as percentage of binding of 32P-5'-labeled Ter-2 DNA in the presence of competing DNA relative to its binding in the absence of competitor DNA. The number of independent determinations for each competing DNA ligand (n) is indicated in parenthesis. In control determinations under the same experimental conditions, the binding of 32P-5'-labeled TeR-2 DNA to uqTBP25 in the presence of an equimolar amount of unlabeled TeR-2 DNA was decreased to 50.3 ± 9.0% (n = 11).

Unlabeled competitor DNA (50-fold molar excess) Percentage of initial activity (n)

~d(A)16~a 78.2  ± 18.2 (5)
~d(T)16~ 72.9  ± 3.7 (4)
~d(G)16~ 76.2  ± 12.5 (4)
~d(C)16~ 82.3  ± 15.3 (4)
~d(G-A)12~ 79.5  ± 16.5 (4)
d(G-C)20 77.3  ± 18.2 (4)
d(C-T)31 71.5  ± 13.8 (4)
d(CGG)8 85.0  ± 8.6 (4)
d(GCC)8 76.5  ± 11.3 (5)
TeT-4b 95.7  ± 21.3 (3)
Qb 68.5  ± 4.0 (3)
Anti-Qb 122.4  ± 5.4 (2)
Total yeast RNAc 105.9  ± 4.6 (4)

a The designation ~ marks an EcoRI recognition sequence AATTC and G, respectively, at the 5'- and 3'-ends of the competing oligomers.
b The full sequence of these oligonucleotides is presented in Table I.
c Based on an average molecular size of 6.5 kDa as determined by PAGE, the RNA was added at a 25-fold molar excess over TeR-2 DNA.

To assess more precisely the DNA sequence specificity and structure specificity of DNA binding by uqTBP25, we determined values of dissociation constants, Kd, for complexes of uqTBP25 with sequence and structure variants of telomeric DNA. Fig. 3 shows a typical steady-state binding analysis of complex formation between uqTBP25 and TeR-2 DNA. A constant amount of phenyl-Sepharose-purified uqTBP25 protein was incubated under standard binding conditions with increasing amounts of 32P-5'-labeled TeR-2 DNA, and formed protein-DNA complexes were separated from unbound DNA by mobility shift electrophoresis (Fig. 3A). Amounts of protein-bound and free TeR-2 DNA were determined by phosphor imaging measurements of the respective bands, and the value of the dissociation constant, Kd, was inferred from the negative reciprocal of the slope of a Scatchard plot of the results (Fig. 3B). Compiled in Table VI are Kd values for complexes of uqTBP25 with different structures of TeR DNA or with oligomers closely homologous to the telomeric sequence. Apparently, complexes of uqTBP25 with single-stranded telomeric sequences that contained two or more d(TTAGGG) clusters had nanomolar range dissociation constants (Table VI). However, a complex of uqTBP25 with an oligomer that contained a single d(TTAGGG) cluster had a dissociation constant 8.5- or 12.5-fold higher than the Kd values of complexes with oligomers that had two or four telomeric repeat units, respectively (Table VI). As shown in Table VI, binding of TeR DNA by uqTBP25 was highly sequence-specific, such that complexes of uqTBP25 with oligomers that contained single base substitutions within the TeR-4 DNA repeat unit had considerably elevated Kd values. Substituting the single adenosine residue, d(TTAGGG), within the TeR DNA sequence with a guanine, d(TTGGGG), in TeT DNA increased the Kd value of the protein-TeT DNA complex 215-fold relative to the Kd of a uqTBP25-TeR-4 DNA complex (Table VI). Similarly, altering the TeR DNA d(TTAGGG) repeat unit into d(TTAGAG) in Mut1 TeR-4 DNA increased 85-fold the Kd value of the uqTBP25-Mut1 TeR-4 DNA complex (Table VI). Interestingly, an increase of only 9-fold in Kd value, was obtained when the TeR-4 DNA sequence d(TTAGGG) was changed into d(TAAGGG) in Mut2 TeR-4 DNA (Table VI).


Fig. 3. Determination of the dissociation constant for a uqTBP25-TeR-2 DNA complex. Phenyl-Sepharose-purified uqTBP25 protein (12.0 activity units) was incubated at 4 °C for 20 min with increasing amounts of TeR-2 DNA. The uqTBP25-TeR-2 DNA complex was resolved by mobility shift electrophoresis in a nondenaturing 6% polyacrylamide gel as detailed under "Experimental Procedures." A, mobility shift electrophoresis pattern of uqTBP25 with increasing amounts of TeR-2 DNA probe. B, Scatchard plot of results shown in A above. Quantification of complex formation was conducted by phosphor imaging.
[View Larger Version of this Image (29K GIF file)]

Table VI. Dissociation constants of complexes of uqTBP25 with different DNA sequences and structures

The dissociation constants, Kd, of complexes between phenyl-Sepharose-purified uqTBP25 and the different RNA and DNA sequences and structures were inferred from Scatchard plots of protein-DNA binding kinetics as illustrated in Fig. 3. The number of independently executed plots for the determination of the Kd value for complexes with each nucleic acid ligand is indicated in parentheses.

Nucleic acid ligand Kd of binding

10-9 mol/liter
Single stranded DNA
  TeR-4 d(TTAGGG)4a 2.2  ± 1.7 (3)
  TeR-2 ~d(TTAGGG)2~b 3.2  ± 0.7 (2)
  TeR-1 ~d(TTAGGG)~b 27.4  ± 5.1 (4)
Sequence homologues of single stranded TeR DNAa
  TeT-4 d(TTGGGG)4 475  ± 133 (3)
  TeT-2 ~d(TTGGGG)2~b 210  ± 40 (2)
  Mut1 TeR-4 d(TTAGAG)4 187  ± 30 (3)
  Mut2 TeR-4 d(TAAGGG)4 20.0  ± 2.6 (2)
  rTeR-4 r(UUAGGG)4c 25.6  ± 5.7 (3)
Double stranded DNAd
  blunt-ended ds TeRe Hook TeR-4 · Hook TeR-4 Cb 66.3  ± 4.0 (3)
  ds TeR with ss G-strand overhang     TeR-5 · TeR-3 Cb 1.6  ± 0.5 (3)
Tetraplex DNA
  G'4 TeR-4f 13.4  ± 0.3 (2)
  G'2 TeR-2g 122.0  ± 9.6 (2)
  G4 oligomer Qb >500

a Oligomers were maintained in a single-stranded conformation as described under "Experimental Procedures," and DNA binding was conducted in the absence of salt to preserve the single-strandedness of the DNA.
b The full sequence of these oligomers is presented in Table I.
c The RNA binding reaction was conducted at 4 °C for 20 min in the presence of 0.07 units/µl RNasin, 1.2 mM DTT, 4 mM KCl. Trace activity of RNase present in the highly purified preparation of uqTBP25 was fully inhibited under these conditions, and in a control experiment, the binding of TeR-2 DNA by uqTBP25 was unaffected by the presence of RNasin, DTT, and KCl.
d Blunt-ended double-stranded DNA and a hybrid that had a single-stranded d(TTAGGG)2 overhang were annealed and purified as described under "Experimental Procedures."
e The blunt-ended Hook TeR-4 · Hook TeR-4 C DNA was internally labeled in a Klenow fragment-catalyzed reaction as described under "Experimental Procedures."
f The maintenance of the unimolecular tetraplex form of telomeric DNA, G'4 TeR-4, and the DNA binding reaction were conducted in the presence of 50 mM NaCl to preserve the tetraplex structures of a single molecule of telomeric DNA.
g The bimolecular tetraplex form of telomeric DNA, G'2 TeR-2, was prepared, and its stoichiometry was verified as described under "Experimental Procedures." The binding reaction was conducted in the presence of 50 mM KCl to preserve the bimolecular G'2 TeR-2 DNA structure.

That uqTBP25 bound preferentially TeR-4 DNA over the homologous rTeR-4 RNA sequence is evident by the 11.6-fold higher Kd of the protein-rTeR-4 complex (Table VI). This preferential binding of DNA over RNA contrasts with the proclivity of several hnRNP species to bind RNA more tightly than DNA (Ref. 64; see "Discussion"). A preference of uqTBP25 for single-stranded over double-stranded TeR DNA was demonstrated by the 30-fold lower Kd of its complex with single-stranded TeR-4 DNA relative to the Kd of its complex with blunt-ended double-stranded telomeric DNA (Table VI). However, when the double-stranded TeR DNA ended with a d(TTAGGG)2 single-stranded overhang, its association with uqTBP25 was as tight as that of single-stranded TeR-4 DNA (Table VI). Of the various forms of tetraplex DNA, only a unimolecular antiparallel G'4 TeR-4 DNA structure bound tightly to uqTBP25. Although the Kd value of the complex of uqTBP25 with G'4 TeR-4 DNA was 6-fold higher than that of a uqTBP25-TeR-4 DNA complex (Table VI), this difference was due to the required presence of 50 mM NaCl in the binding mixture. We found that the dissociation constant of a complex of uqTBP25 with TeR-2 DNA, which could not form a tetraplex structure, was also increased in the presence of 50 mM KCl from 3.2 ± 0.7 × 10-9 mol/liter (Table VI) to 28.0 ± 0.3 × 10-9 mol/liter (n = 2) and to 36.0 ± 0.9 × 10-9 mol/liter (n = 2) in the presence of 50 mM NaCl. It was concluded, therefore, that the single-stranded and unimolecular quadruplex forms of TeR-4 DNA were bound by uqTBP25 with a very similar affinity. By contrast, a bimolecular G'2 TeR-2 tetraplex DNA bound poorly to uqTBP25, forming a complex having a Kd 38-fold higher than the dissociation constant of a complex with TeR-2 DNA (Table VI). Parallel tetramolecular G4 quadruplex forms of oligomer Q (33, 50), single Q (48), or d(CGG)8 at up to 123 nM (49) did not form detectable complexes with the protein (results not shown). Hence, our results indicated that uqTBP25 selectively bound single-stranded and unimolecular tetraplex forms of TeR DNA in a highly sequence-specific fashion.

Stabilization of uqTBP25-associated Telomeric DNA against Nucleolytic Attack

To inquire whether the stability of TeR DNA is affected by its association with uqTBP25, we compared the rate of digestion by micrococcal nuclease of unbound and protein-bound single-stranded TeR-4 DNA. Unbound single-stranded TeR-4 DNA or its complex with uqTBP25 were exposed for different lengths of time at 20 °C to 0.30 ng/µl micrococcal nuclease. The nucleolytic digestion was terminated by adding SDS to a final concentration of 0.25%, and the DNA samples were electrophoresed through a 6% nondenaturing polyacrylamide gel to separate the intact DNA oligomer from its digestion products, which migrated at the front of the gel. The kinetics of breakdown of the unbound or uqTBP25-bound single-stranded TeR-4 DNA indicated that whereas 53 or 77% of the unbound TeR-4 DNA was digested within 1 or 3 min, respectively, only 4 or 9% of the uqTBP25-bound TeR DNA was degraded after exposure to the nuclease for these periods of time (Fig. 4A). To assess the specificity of protection of TeR-4 DNA by uqTBP25 against nucleolytic attack, we examined the effect of the protein on the rate of digestion of the poorly bound TeT-4 DNA (Table VI). As seen in Fig. 4B, 25 or 39% of the unbound TeT-4 DNA were digested after a 1- or 3-min exposure to micrococcal nuclease, and similarly, 41 or 50% of the protein-associated TeT-4 DNA was degraded after digestion for the same periods of time. Hence, uqTBP25-associated TeT-4 DNA was not protected against nucleolytic attack, and its rate of breakdown was even modestly accelerated in the presence of the protein. It appeared, therefore, that the formation of a sequence-specific tight complex between TeR-4 DNA and uqTBP25 was responsible for the observed resistance of the protein-bound telomeric DNA to nuclease attack.


Fig. 4. uqTBP25 stabilizes TeR-4 DNA against nuclease digestion. Samples, 1.0 ng each, of 32P-5'-labeled single-stranded TeR-4 DNA or TeT-4 DNA were incubated at 4 °C for 20 min with or without phenyl-Sepharose-purified uqTBP25 (10.0 activity units). The naked or protein-bound DNA was exposed to 1.5 ng of micrococcal nuclease at 20 °C for the indicated periods of time in the presence of 1.0 mM CaCl2. Nuclease digestion was terminated, and TeR DNA was separated from its complex with uqTBP25 by the addition of SDS to a final concentration of 0.25%. The DNA samples were electrophoresed through a nondenaturing 6% polyacrylamide gel to separate intact DNA from its digestion products, which migrated at the front of the gel. Residual intact DNA was quantified by phosphor imaging analysis. A, kinetics of nuclease digestion of TeR-4 DNA with or without uqTBP25. The average value and S.D. of three independent determinations at each time point are indicated. black-triangle------black-triangle, nuclease-treated uqTBP25-bound TeR-4 DNA; black-square------black-square, nuclease-treated unbound TeR-4 DNA. B, kinetics of nuclease digestion of TeT-4 DNA with or without uqTBP25. The average value and S.D. of three independent determinations at each time point are indicated. black-triangle------black-triangle nuclease-treated uqTBP25-bound TeT-4 DNA; black-square------black-square, nuclease-treated unbound TeT-4 DNA.
[View Larger Version of this Image (16K GIF file)]

The Effect of uqTBP25 on DNA Polymerase alpha  Activity

The single-stranded DNA-binding protein UP1 and uqTBP25 are distinguished from one another by their closely homologous but nonidentical amino acid sequence (Table IV) and by their molecular sizes of 22 (58) and 25 kDa, respectively. One characteristic property of UP1 is its capacity to enhance the activity of calf thymus polymerase alpha  (51). To further compare uqTBP25 with UP1, we examined the effect of uqTBP25 on polymerase alpha -catalyzed DNA synthesis. Calf thymus polymerase alpha  was incubated under DNA synthesis reaction conditions with increasing amounts of uqTBP25 and with either a poly(dG)· poly(dC) primer-template or with singly primed bacteriophage M13mp2 single-stranded DNA. DNA synthesis was determined by measuring the incorporation of 32P dGMP into acid-insoluble product DNA (see "Experimental Procedures"). As seen in Fig. 5, the copying of a poly(dC) template strand was inhibited by uqTBP25 by up to ~20%, whereas the copying of M13mp2 DNA was increased by less than 2-fold. Under the same reaction conditions, bacteriophage T4 gene 32 protein inhibited by up to 90% the copying of poly(dC) by polymerase alpha  and stimulated the copying of M13mp2 DNA by more than 3-fold (results not shown). In modestly inhibiting polymerase alpha -catalyzed copying of poly(dC) and stimulating M13mp2 DNA copying by less than 2-fold, uqTBP25 contrasted UP1, which reportedly increased >5- or >10-fold the copying by polymerase