|
|
|
|||||||
|
|||||||||
(Received for publication, January 29, 1997, and in revised form, April 17, 1997)
From the Departments of Medicine and Physiology, Cardiovascular
Research Institute, University of California,
San Francisco, California 94143-0521
ABSTRACT The goal of this study was to compare single
channel water and glycerol permeabilities of mammalian aquaporins (AQP)
1-5 and the major intrinsic protein of lens fiber (MIP). Each of the
six cloned cDNAs from rat was left untagged or was epitope-tagged with c-Myc or FLAG at either the N or C terminus so that results would
not depend on epitope identity or location. The constructs were
expressed in Xenopus oocytes for measurement of osmotic
water permeability (Pf), [3H]glycerol
uptake, and protein expression. Each of the 30 epitope-tagged constructs was expressed strongly at the oocyte plasma membrane. The
10-min uptake of [3H]glycerol was increased significantly
(range of 4.5-8-fold over control) in oocytes expressing untagged AQP3
(GLIP) and each of the four tagged AQP3 constructs;
[3H]glycerol uptake was not increased in oocytes
expressing AQP1, AQP2, AQP4, AQP5, or MIP. In oocytes microinjected
with 5 ng of cRNA, average Pf values (in cm/s × 10 INTRODUCTION Five proteins with homology to the major intrinsic protein of lens
fiber (MIP) (1) have been cloned in mammals and given the name
aquaporins. AQP1 1 (original name CHIP28)
(2) is found in erythrocytes, kidney proximal tubule, and various
epithelia and endothelia. AQP2 (original name WCH-CD) (3) is the
vasopressin-inducible water channel expressed in kidney collecting
duct. AQP3 (alternate name GLIP (glycerol-transporting
intrinsic protein)) was cloned by three laboratories (4-6) and is expressed at the basolateral membrane of
kidney collecting duct and in multiple epithelia (7). AQP4 (original
name MIWC (mercurial-insensitive
water channel)) (8) is expressed strongly in
brain and colocalizes with AQP3 in several tissues (7). AQP5 (9) is
expressed in lung, salivary gland, and eye. Amino acid sequences for
various proteins share several conserved sequence motifs with overall
identities of 25-60% after sequence alignment. Subsequent to the
initial cloning reports cited above, various isoforms of AQP1-5 were
identified in different organs and/or species (see Refs. 10-13 for
review). In addition, an aquaporin (AQP2L, subsequently renamed AQP6)
(14) with 52% amino acid identity to human AQP2 was cloned that was
expressed only in human kidney, and several homologous
water-transporting proteins have been cloned from plants (15) and
amphibia (16, 17).
Functional studies have been carried out on AQP1-5 and MIP by
expression of cRNAs in Xenopus oocytes. Several studies
indicate that expression of AQP1, AQP2, AQP4, and AQP5 significantly
increases oocyte water permeability (2-6, 8, 9, 18-20), although
permeability values varied widely in different laboratories.
Transfection of AQP1 and AQP4 in cultured mammalian cells also confers
increased plasma membrane water permeability (21, 22), and transfection of AQP2 confers vasopressin-regulated water permeability (23). However,
there are conflicting reports for expression of AQP3: two groups report
increased oocyte water permeability (4, 6), whereas our laboratory
found little increase in water permeability for AQP3 expression in
oocytes (5). For MIP, studies in lens membrane vesicles and
proteoliposomes (24) and in Xenopus oocytes (25, 26) suggest
that MIP has some intrinsic water permeability, but probably much less
than the aquaporins. In the case of AQP1, where purification to
homogeneity has been possible, measurement of "per channel" or
"single channel" water permeability (pf) indicates that each AQP1 monomer has a relatively low
pf of ~6 × 10 The principal goal of this study was to determine quantitatively the
single channel water and glycerol permeabilities of mammalian AQP1-5
and MIP. A second goal was to examine whether activators of protein
kinases A and C regulate the water permeabilities of these proteins, a
controversial issue that has received recent attention (see
"Discussion"). Our strategy was to utilize epitope tagging to
detect oocyte plasma membrane expression of each protein with similar
efficiencies. Single channel water permeabilities were determined from
ratios of measured oocyte permeabilities to plasma membrane expression
levels. The principal findings were that significant glycerol
permeability was found only for AQP3 and that single channel water
permeabilities differed widely for the aquaporins. Phosphorylation by
protein kinase A or C did not affect MIP- or aquaporin-mediated water
permeability. The considerable heterogeneity in water channel function
of the aquaporin family proteins was an unexpected finding with
interesting implications for water channel structure and
physiology.
MATERIALS AND METHODS Full-length cDNAs encoding rat
AQP1-5 and MIP, without and with epitope tags, were subcloned into
oocyte expression plasmid S65T (which contains an upstream
Xenopus Full-length cDNAs encoding AQP1-3, AQP5, and MIP were polymerase
chain reaction-amplified using the following primers (engineered BamHI, BglII, or BclI and
XbaI restriction sites are underlined): AQP1 sense,
5 Complementary RNA was transcribed
in vitro using SP6 polymerase (Life Technologies, Inc.) and
5 µg of plasmid DNA in a 100-µl volume at 37 °C for 1 h in
the presence of diguanosine triphosphate (1 A250
unit; Pharmacia Biotech Inc.). Plasmid DNA was digested with RNase-free
DNase (Invitrogen), extracted with phenol/chloroform, and precipitated
twice in ethanol. The cRNA was suspended in distilled water for oocyte
injection.
In vitro transcribed cRNA
was added to a rabbit reticulocyte lysate mixture containing
[35S]methionine (32). Microsomes prepared from dog
pancreas were added in some experiments at the start of translation to
a final concentration of 8 A280 units.
Translation was performed at 24 °C for 1 h. Samples were
analyzed by SDS-polyacrylamide gel electrophoresis, EN3HANCE fluorography, and autoradiography.
Stage V and VI
oocytes from Xenopus laevis were isolated and defolliculated
with collagenase (type IA, Sigma; 1 mg/ml for 2-4 h at 20 °C) in
Barth's buffer (200 mosM). Oocytes were microinjected with
50-nl samples of cRNA (0-200 ng/µl) and incubated at 18 °C for
24-27 h. Osmotic water permeability (Pf) was
measured from the time course of oocyte swelling at 10 °C in
response to a 1.5- or 5-fold dilution of the extracellular Barth's
buffer with distilled water (33). Oocyte Pf was
calculated from the initial rate of swelling
(d(V/Vo)/dt) by the relation
Pf = (d(V/Vo)/dt)/((S/Vo)Vw(osMout Metabolic labeling was performed by
incubating groups of 10 oocytes for 24 h at 18 °C in 100 µl
of Barth's buffer containing 50 µCi of [35S]methionine
(Amersham Corp.). Oocytes were gently washed three times in ice-cold
Barth's buffer, and plasma membrane complexes were peeled from the
surface of the oocytes with fine forceps and collected. Membranes were
disrupted in 1 ml of homogenization buffer (7.5 mM
Na2HPO4, pH 7.4, 1 mM EDTA, 20 µg/ml phenylmethylsulfonyl fluoride, 1 µg/ml pepstatin A, and 1 µg/ml leupeptin) by vigorous vortexing and repeated pipetting.
Cellular debris was pelleted at 750 × g for 5 min, and
the membranes were then pelleted at 16,000 × g for 30 min. Membrane pellets were solubilized in 1 ml of phosphate-buffered
saline, pH 7.4, containing 100 mM Groups of 10-20 oocytes were immersed
in fixation solution (4% paraformaldehyde in phosphate-buffered saline
containing 0.1 M sucrose) for 4 h. Oocytes were
cryoprotected overnight in phosphate-buffered saline containing 30%
sucrose, embedded in ornithine carbamoyltransferase compound, and
frozen in dry ice/ethanol. Sections (~6-µm thickness) were stained
with c-Myc or FLAG antibody (1:500) for 1 h and with fluorescein-conjugated goat anti-mouse IgG (1:50; Boehringer Mannheim) for 30 min as described previously (34).
RESULTS The cDNAs encoding rat AQP1-5 and MIP were epitope-tagged at
the N or C terminus with the c-Myc or FLAG sequence, and the untagged
and tagged constructs were subcloned into an oocyte expression vector.
The constructs were confirmed by sequence analysis and characterized
initially by cell-free translation. Fig. 1 shows representative cell-free translation results for the C-terminal c-Myc
(A) and FLAG (B) epitope-tagged constructs. Each
construct was translated efficiently. Protein sizes were as expected
from prior translation and immunoblot studies after correction for the
small c-Myc (1.2 kDa) or FLAG (1.0 kDa) epitope. As found previously,
AQP1-3 and AQP5 were partially glycosylated, whereas AQP4 and MIP were
not. Similar cell-free translation profiles were obtained for the
N-terminal tagged constructs and after immunoprecipitation of each
of the 24 tagged cDNAs with c-Myc or FLAG antibody (data not
shown).
Functional measurements were made in Xenopus oocytes after
microinjection of 5 ng of each cRNA and a 24-27-h incubation at 18 °C. All 24 epitope-tagged constructs and the six untagged
constructs were tested. Fig. 2A shows
representative measurements of osmotic water permeability by oocyte
swelling, and Fig. 2B summarizes averaged results. For each
of the constructs tested, a consistent rank order of water
permeabilities was found, with Pf for AQP4 > AQP1 > AQP5 > AQP2 ~ AQP3
Fig. 3 shows a summary of 10-min glycerol uptake
measurements in oocytes from the same groups used for the water
transport measurements. Glycerol uptake was remarkably increased
compared with control in oocytes expressing untagged AQP3 as well as
each of the four tagged AQP3 constructs. Glycerol uptake was not
increased significantly above control in oocytes expressing AQP1, AQP2, AQP4, AQP5, or MIP.
Experiments were next carried out to determine the protein expression
levels of AQP1-5 and MIP in Xenopus oocytes microinjected with 5 ng of each cRNA. Several complementary approaches were used,
including immunofluorescence, immunoprecipitation, and immunoblot analysis. Fig. 4 shows representative immunofluorescence
data for oocytes expressing the C-terminal c-Myc epitope.
Immunofluorescence in oocytes expressing each of the tagged proteins
was clearly above control, with qualitatively the greatest expression
of AQP1 and the least expression of AQP4. However, the staining
efficiency and specificity of the monoclonal antibodies were inferior
to polyclonal AQP1 and AQP4 antibodies used previously for measurement of plasma membrane aquaporin expression (34) and were not suitable for
quantitative analysis.
Quantitative analysis of aquaporin plasma membrane expression was
accomplished by inclusion of [35S]methionine in the
incubation solution followed by oocyte plasma membrane microdissection
and immunoprecipitation. Fig. 5 shows autoradiograms of
immunoprecipitated proteins labeled with each of the epitopes (c-Myc or
FLAG) at their C or N termini. The relative expression levels of
AQP1-5 and MIP were in qualitative agreement with the data in Fig. 4,
with strong expression of AQP1 and the least expression of AQP4. Below
each lane is given the averaged Pf values measured
in the same oocytes that were blotted. These values are needed to
compute single channel water permeabilities (see below).
Control measurements were carried out to confirm the suitability and
linearity of the immunoprecipitation method. Oocytes were microinjected
with different amounts (0-10 ng) of cRNA encoding AQP1 tagged at its N
terminus with the c-Myc epitope. Pf was measured by
the swelling assay, and plasma membrane expression was measured by
densitometry of autoradiograms of immunoprecipitated protein. The AQP1
protein was immunoprecipitated with AQP1 antibody or c-Myc antibody.
Fig. 6A shows a representative autoradiogram of the immunoprecipitated proteins with different amounts of
microinjected cRNA. Fig. 6B shows a comparison of oocyte
Pp versus the amount of
immunoprecipitated protein (by densitometry of autoradiograms). There
was a nearly linear relationship between plasma membrane water
permeability and relative amount of 35S-labeled AQP1 in
immunoprecipitations performed with the AQP1 and c-Myc antibodies. The
y intercept of the line was just above zero because of the
non-zero base-line water permeability of control oocytes.
The strategy to determine single channel water permeabilities
(pf, in units of cm3/s) involves taking
ratios of oocyte Pf to integrated band intensity and
normalizing the ratios to that for untagged AQP1, which has a known
pf(AQP1) of 6 × 10
Volume 272, Number 26,
Issue of June 27, 1997
pp. 16140-16146
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
3) were 0.67 ± 0.06 (control), 19 ± 2 (AQP1), 10 ± 1 (AQP2), 8 ± 2 (AQP3), 29 ± 1 (AQP4),
10 ± 1 (AQP5), and 1.3 ± 0.2 (MIP), and they were
relatively insensitive to the presence, identity, or location of the
epitope tag. Pf values were not affected by protein
kinase A or C activation. After normalization for plasma membrane
expression by immunoprecipitation of microdissected plasma membranes,
single channel water permeabilities (pf, referenced to the AQP1 pf of 6 × 1014
cm3/s) were (in cm3/s × 1014) 3.3 ± 0.2 (AQP2), 2.1 ± 0.3 (AQP3),
24 ± 0.6 (AQP4), 5.0 ± 0.4 (AQP5), and 0.25 ± 0.05 (MIP); pf values were insensitive to epitope
identity and location. These results indicate very different intrinsic
water permeabilities for the mammalian aquaporin homologs, with the
pf value for AQP4 remarkably higher than those for
the others. The pf values establish limits on
aquaporin tissue densities required for physiological function and
suggest significant structural and functional differences among the
aquaporins.
14
cm3/s (27, 28). This relatively low pf
requires the presence of very high densities of AQP1 water channels in
membranes (>103/µm2, compared with generally
<1 ion channel/µm2) to confer significantly increased
water permeability. No information is available about
pf for the other aquaporins because purification and
reconstitution have not been accomplished. Most studies of aquaporin
function have concluded that AQP1, AQP2, AQP4, and AQP5 are selective
for transport of water without passage of ions, protons, urea, and
glycerol, whereas Abrami et al. (29) reported that AQP1 may
transport small polar non-electrolytes in addition to water. It is
difficult to compare these investigations because the levels of protein
expression at the plasma membrane have not been quantified.
-globin enhancer sequence) (18). The
epitope-tagged constructs encoded fusion proteins consisting of each
full-length aquaporin with 10 amino acids of the human c-Myc epitope
(EQKLISEEDL, nucleotides GAACAAAAGCTGATTTCTGAAGAAGACCTG) (30) or 8 amino acids of the FLAG epitope (DYKDDDDK, nucleotides GACTACAAAGACGATGACGACAAG) (31) at either the N or C terminus. Tagged AQP4 cDNAs were first prepared by polymerase chain reaction amplification using the following primers (engineered BglII
and EcoRI restriction sites are underlined): 5
-c-Myc/AQP4
sense, 5-GAAGATCTAGCATGGAACAAAAGCTGATTTCTGAAGAAGACCTGGGATCCATGGTGGCTTTCAAAGGCGTCTGGACTCAAGC; 5-FLAG/AQP4 sense,
5-GAAGATCTAGCATGACTACAAAGACGATGACGACAAGGGATCCATGGTGGCTTTCAAAGGCGTCTGGACTCAAGC; 3-TAA/AQP4 antisense,
5-GGAATTCTTATCTAGATACAGAAGATAATACCTCTCCA; 3-c-Myc/AQP4 antisense,
5-GGAATTCTTACAGGTCTTCTTCAGAAATCAGCTTTTGTTCTCTAGAGGATCCCACACTCTCCATCTCCACGGCTCCC; and 3-FLAG/AQP4 antisense,
5-GGAATTCTTACTTGTCGTCATCGTCTTTGTAGTCTCTAGAGGATCCCACACTCTCCATCTCCACGGCTCCC. Polymerase chain reaction products were subcloned into plasmid S65T at BglII and EcoRI sites. The plasmids
(pSP64T-N-c-Myc, pSP64T-C-c-Myc, pSP64T-N-FLAG, and pSP64T-C-FLAG) not
containing AQP4 were isolated by restriction digestion with
BamHI or BglII and XbaI and used for
subcloning of cDNAs encoding the other aquaporins (see below).
-CGGGATCCATGGCCAGCGAGTTAAAGAAGA-3; AQP1 antisense, 5-GCTCTAGATTTGGGCTTCATCTCCACCCTG-3; AQP2 sense,
5-CGAGATCTATGTGGGAACTCAGATCCATAG-3; AQP2 antisense,
5-GCTCTAGAGGCCTTGCTGCCGCGAGGCAGG-3; AQP3 sense, 5-CGGGATCCATGAACCGTTGCGGGGAGATGC-3; AQP3 antisense,
5-GCTCTAGAGATCTGCTCCTTGTGCTTCATG-3; AQP5 sense,
5-CGGGATCCATGAAAAAGGAGGTGTGCTCCCTTG-3; AQP5 antisense, 5-GCTCTAGAGTGTGCCGTCAGCTCGATGGTC-3; MIP sense,
5-CTTGATCAATGTGGGAACTTCGGTCTGCCTCCT-3; and MIP antisense,
5-GCTCTAGACAATGTCTGAATTCCATTGAT-3. Templates were
cDNAs prepared from rat kidney (AQP1-3), brain (AQP4), lung (AQP5), or lens (MIP). Each of the cDNAs contains engineered
BglII, BamHI, or BclI and
XbaI restriction sites for insertion into the tagged vectors
described above.
osMin)), where S/Vo = 50 cm1, Vw = 18 cm3/mol, and
osMout osMin = 190 mosM. In some experiments, oocytes were incubated with
forskolin or phorbol 12-myristate 13-acetate for 15-30 min at room
temperature prior to water permeability measurements. Uptake of
[3H]glycerol (200 mCi/mmol) was carried out as
described previously (5). Groups of 10 oocytes were incubated in 200 µl of Barth's buffer containing 20 µCi of the radiolabeled
glycerol (nonradioactive glycerol was added to give a 1 mM
final concentration) at room temperature. After 0 or 10 min, oocytes
were washed rapidly three times in ice-cold Barth's buffer, and
individual oocytes were dissolved in 5% SDS for scintillation
counting. Results are reported as percentage uptake assuming an oocyte
aqueous volume of 0.25 µl, after subtraction of the 0 time
contribution from surface binding (generally <5%).
-octyl glucoside for
1 h and incubated with protein A-Sepharose CL-4B beads (Pharmacia
Biotech Inc.) for 1 h at 4 °C with continuous rocking. The
beads were pelleted at 10,000 × g. The supernatant was
incubated with primary antibody (1:300) for 1 h and then with a
rabbit anti-mouse secondary antibody for 1 h. Protein A-Sepharose CL-4B beads were added, pelleted, and washed four times with
phosphate-buffered saline, pH 7.4, containing 0.1% SDS, 1%
deoxycholate, and 1% Triton X-100. The proteins were released from the
beads in 30 µl of SDS loading buffer and resolved on 12%
SDS-polyacrylamide gel. Gels were soaked in 15% (w/v)
2,5-diphenyloxazole in Me2SO for 30 min, dried, and exposed
to Hyperfilm (Amersham Corp.) at 70 °C for 3-10 days.
Fig. 1.
Cell-free translation of epitope-tagged
AQP1-5 and MIP. The cDNAs were translated in the presence of
[35S]methionine as described under "Materials and
Methods" in the absence and presence of endoplasmic reticulum-derived
microsomes. Translation products were electrophoresed and
autoradiographed. Data are shown for C-terminal c-Myc (A)
and FLAG (B) epitope-tagged constructs.
[View Larger Version of this Image (22K GIF file)]
MIP. The water
permeability of MIP-expressing oocytes was small, but was significantly
greater than that of control (water-injected) oocytes. The water
permeability values were relatively insensitive to the presence,
location, and identity of the epitope tag (see below). For an equal
quantity of injected cRNA, AQP4-expressing oocytes had the greatest
water permeability; however, these results cannot be interpreted in terms of intrinsic water permeability per aquaporin monomer because of
possible differences in expression among the various proteins.
Fig. 2.
Osmotic water permeability in Xenopus
oocytes expressing the aquaporin and MIP proteins. Oocytes
were microinjected with water or 5 ng of cRNAs encoding each of the
untagged aquaporins or MIP. Osmotic water permeability was measured at
10 °C after a 24-27-h incubation at 18 °C. A,
representative oocyte swelling curves showing the time course of
relative oocyte volume in response to a 5-fold dilution of the
extracellular solution with distilled water; B, summary of
osmotic water permeabilities (Pf) (mean ± S.E.), with the numbers of oocytes indicated in
parentheses.
[View Larger Version of this Image (14K GIF file)]
Fig. 3.
Glycerol permeability in oocytes expressing
AQP1-5 and MIP. The 10-min uptake of [3H]glycerol
was measured as described under "Materials and Methods." Data are
expressed as the percentage uptake, where 100% represents equilibrium
uptake.
[View Larger Version of this Image (21K GIF file)]
Fig. 4.
Immunofluorescence of oocytes expressing each
of the constructs tagged with c-Myc at the C terminus. Oocytes
were imaged using a Leitz epifluorescence microscope (10 × objective) and printed under identical conditions as described
previously (34). Scale bar = 50 µm.
[View Larger Version of this Image (59K GIF file)]
Fig. 5.
Immunoprecipitation analysis of proteins from
microdissected oocyte plasma membranes. Oocytes were microinjected
with water or 5 ng of cRNAs encoding each of the constructs tagged with
c-Myc or FLAG. Shown are autoradiograms of 35S-labeled
oocytes after membrane microdissection and immunoprecipitation for the
c-Myc and FLAG epitopes at the C and N termini as indicated. Pf values are given below each lane for the
same group of oocytes measured prior to immunoprecipitation.
[View Larger Version of this Image (59K GIF file)]
Fig. 6.
Linearity of the immunoprecipitation
method. Oocytes were microinjected with cRNA encoding AQP1 tagged
at its N terminus with c-Myc. A, immunoprecipitation of
oocytes using AQP1 antibody. The amount of microinjected cRNA is
indicated for each lane. B, relationship between oocyte
water permeability (Pf) versus relative
35S-labeled AQP1 protein by densitometric analysis of
autoradiograms. Data are shown for immunoprecipitations performed with
AQP1 antibody (Ab) (left) and c-Myc antibody
(right).
[View Larger Version of this Image (17K GIF file)]
14
cm3/s (27),
where
pf(AQPx)tag y
is the single channel water permeability (cm3/s) of
AQPx with tag y (y is N- or C-terminal
c-Myc or FLAG), Pf(AQPx)tag y
is the water permeability (cm/s) of oocytes expressing AQPx
with tag y, and
IBAQPxtag y(Ab z)
is the integrated band intensity (arbitrary units) of
immunoprecipitated proteins from oocytes expressing AQPx
with tag y using antibody z. The normalization is
done in two steps. The first bracketed term in Equation 1 compares
water permeabilities of untagged AQP1 to those of each of the four
tagged AQP1 constructs. (AQP1 antibody is used because untagged AQP1
cannot be immunoprecipitated with c-Myc or FLAG antibody.) The second
bracketed term compares water permeabilities of AQPx with
tag y to that of AQP1 with tag y. (Immunoprecipitations were done with antibody y).
(Eq. 1)
Fig. 7A shows an autoradiogram of the AQP1
proteins immunoprecipitated with AQP1 antibody along with corresponding
measured Pf values. Fig. 7B summarizes
the deduced pf values referenced to that for
untagged AQP1. The values did not differ significantly among the AQP1
constructs; the first bracketed term in Equation 1 will thus be taken
as unity.
Fig. 7. Determination of single channel water permeabilities (pf) for the untagged and tagged AQP1 proteins. A, tagged and untagged AQP1 proteins immunoprecipitated by AQP1 antibody. Oocytes were microinjected with water (control) or 5 ng of cRNA encoding each construct and incubated for 36 h. Measured oocyte water permeabilities (Pf) are given for each condition. B, computed (single channel) pf values referenced to the pf for untagged AQP1 of 6 × 10
14 cm3/s.
[View Larger Version of this Image (28K GIF file)]
Fig. 8A summarizes the single channel water
permeabilities of each of the four tagged constructs (N- or C- terminal
c-Myc or FLAG) of AQP1-5 and MIP. The pf values
were computed using Equation 1, in which the second bracketed term was
deduced from experiments as in Fig. 5. The results show a considerable variation in pf values among the aquaporins (see
"Discussion"). Notably, pf for each of the
proteins was relatively insensitive to the identity and location of the
epitope tag.
Fig. 8. Single channel water permeabilities (pf for epitope-tagged AQP1-5 and MIP. A, single channel water permeabilities (mean ± S.E., three sets of measurements) were computed from ratios of measured oocyte water permeabilities (Pf) to integrated band intensities of immunoprecipitated proteins per Equation 1 under "Results." B, shown are the effects of protein kinase activators on the water permeabilities of AQP1-5 and MIP. Oocytes were microinjected with cRNAs (0.5 ng) encoding each of the untagged proteins. Where indicated, oocytes were incubated in 10 µM forskolin or 100 nM phorbol 12-myristate 13-acetate (PMA) for 15-30 min at room temperature prior to water permeability assay. Pf values (mean ± S.E., n = 8-12, two separate batches of oocytes) are shown for swelling measurements done at 10 °C.
[View Larger Version of this Image (36K GIF file)]
To investigate whether the intrinsic water permeabilities of AQP1-5 and MIP are regulated by phosphorylation, effects of activators of protein kinases A and C were studied (Fig. 8). Utilizing activators and incubation conditions that have been established to effectively phosphorylate proteins in oocytes (35), the protein kinase activators did not affect Pf for any of the proteins. Incubation of oocytes with the cell-permeable protein kinase A inhibitor (Rp)-cAMP-S (0.1 mM, 15 min) also did not affect Pf values (data not shown). These results indicate that the single channel water permeabilities reported in Fig. 8A are insensitive to the action of the major cellular protein kinases.
DISCUSSION
The goal of this study was to compare single channel water and glycerol permeabilities of the six principal mammalian aquaporin homologs. Because purified functional aquaporins have not been available except for AQP1, our strategy was to engineer epitope tags so that expression of the various aquaporins could be quantified with approximately equal efficiencies. Two different tags were used at each of two different locations, as well as the untagged molecule, to ensure that the results would be independent of tag identity and location. It was found that the epitope tags had little effect on aquaporin expression and function in Xenopus oocytes. After correction of permeability data for plasma membrane expression, it was found that AQP4 had remarkably higher intrinsic water permeability than AQP1 and AQP5, with lower water permeabilities for AQP2 and AQP3. MIP had little intrinsic water permeability. Only AQP3 expression conferred increased glycerol permeability. These findings have important implications for aquaporin structure and physiology as discussed below.
There was a very small but measurable single channel water permeability
for rat MIP of 2.5 × 1015 cm3/s, in
agreement with the small (<4 × 1015
cm3/s) water permeability for bovine lens MIP in
reconstituted proteoliposomes measured by stopped-flow light scattering
(24). The relative water permeability for MIP versus AQP1 of
0.042 found here is comparable to that of 0.023 for bovine MIP, in
which MIP density was estimated by electron microscopy of oocyte
membranes (26). If the MIP pf of 2.5 × 1015 cm3/s measured here is the same as that
in the lens cell membrane in vivo, then a significant
increase in membrane water permeability (Pf = 0.01 cm/s) would require a density of ~10,000 MIP monomers/µm2 of membrane. Assuming that MIP forms
tetramers in membranes, this density is equivalent to a 10-nm spacing
between MIP particles. Electron microscopy of lens shows an ~6-nm
spacing between MIP particles. Thus, if MIP-mediated water permeability
is important in lens, the high MIP density may be necessary because of
the low intrinsic MIP water permeability. It should be noted, however, that the non-zero intrinsic water permeability of MIP in
Xenopus oocytes may be related to its role as a transporter
of other substances; similar small increases in water permeability have
been found for oocytes expressing cRNAs encoding the sodium-independent
(36) and -dependent (37) glucose transporters and the CFTR
chloride channel (35).
AQP3 was found to have significant water and glycerol permeabilities in
this study. In our initial report on AQP3 cloning (5), we found high
glycerol permeability, but little water permeability, similar to the
finding for the homologous protein GlpF (38), the bacterial glycerol
facilitator protein. The story about the water and substrate
specificities of AQP3 is probably incomplete and is under
investigation. Recent measurements of AQP3-mediated water and glycerol
permeabilities using inhibitors have suggested distinct water and
solute pathways (39). In our laboratory, closely related AQP3 cDNAs
have recently been isolated from cDNA libraries and by polymerase
chain reaction; all of the cDNAs have high glycerol permeability,
whereas a subfraction of cDNAs (used in this study) give
substantial water permeability. (For comparison, the "low
Pf" AQP3 cDNAs have the same intrinsic
glycerol permeability as the cDNA used here, but have a low
intrinsic pf of (0.037 ± 0.022) × 1014 cm3/s. Studies are needed to measure
AQP3-mediated water versus glycerol permeability in native
tissues. We note that AQP3 is coexpressed with the efficient water
transporter AQP4 in various fluid-transporting tissues in kidney,
airways, and intestine (7) and by itself in tissues that are not
involved in fluid transport, including conjunctiva, urinary bladder,
and epidermis (40). Transgenic knockout mice should be useful to
resolve the function and physiological significance of AQP3, as was
done recently for AQP4 (41).
The pf of 3.3 × 1014
cm3/s determined for AQP2 provides estimates of the density
of AQP2 protein at the apical membrane of the vasopressin-stimulated
collecting duct and the number of AQP2-containing vesicles that fuse
with the apical membrane. Using a Pf of ~0.02 cm/s
for the collecting duct apical membrane after vasopressin stimulation
(42) and the single channel pf found here, a
predicted density of ~6000 AQP2 monomers/µm2 of apical
plasma membrane is computed. Kishore et al. (43) have
estimated an AQP2 density of 4.3 × 1010
molecules/cm2 of cortical collecting duct in dehydrated rats.
If every AQP2 molecule is at the apical plasma membrane and functional,
then apical membrane Pf would be ~0.1 cm/s. In
AQP2-containing endosomes from collecting duct of ~150-nm diameter, a
Pf of 0.03 cm/s has been measured (44). If all AQP2
molecules are active as water transporters, then it is estimated that
there are ~650 AQP2 monomers/endosome and that ~1000 endosomes fuse with the apical plasma membrane of each principal cell upon vasopressin stimulation.
The considerable heterogeneity in the single channel water permeabilities of the aquaporins was an unexpected finding. Although it is likely that structural differences account for the heterogeneity, the possibility of different "open probabilities" cannot be discounted. It is difficult to test whether water channel gating occurs because there is no electrical signature for the movement of water. The most information about structure is available for AQP1. AQP1 monomers assemble into tetramers in membranes (45) in which each monomer functions independently as a water channel (34). Structure analysis by electron crystallography suggests that each monomer of human AQP1 consists of six membrane-spanning helical domains arranged around a central cavity (46, 47); however, resolution is inadequate to define details about the water transport pathway. Although the other aquaporins probably also contain six membrane-spanning domains, no information is available about their assembly in membranes or the structure of their putative water pores. High resolution x-ray diffraction of three-dimensional crystals will be required to establish whether the heterogeneity in single channel water permeability of the aquaporins is due to differences in water pore length, diameter, and/or shape. There may be additional factors that influence aquaporin water permeability, such as enhanced osmotic flow for AQP4 resulting from the assembly of AQP4 into large, closely packed orthogonal arrays (22) and the physical state of membrane lipids. Finally, the data available do not rule out the possibility that in some aquaporins, the potential space between or around aquaporin monomers might permit water flow.
It has been thought that AQP1, AQP2, AQP4, and AQP5 function as water-selective channels that exclude the small solutes urea and glycerol as well as monovalent ions and protons (10-12). It was argued that significant permeability of aquaporins to solutes other than water would be deleterious to cell function because of the high density of aquaporins required for increased water permeability (18). For example, a high proton permeability for AQP2 would produce profound intracellular acidification of principal cells of kidney collecting duct because the AQP2-containing luminal membrane is bathed in acidic urine. Abrami et al. (29) reported that AQP1 has significant permeability to glycerol and several small polar non-electrolytes. Their results were based primarily on measurements of volume changes in oocytes expressing AQP1 in response to solute gradients. The experiments here do not show measurable glycerol transport by oocytes expressing AQP1, AQP2, AQP4, AQP5, and MIP. The reason for the substantial AQP1-mediated solute permeability found by Abrami et al. (29) is unclear. One possibility is that under certain conditions, possibly in the presence of osmotic gradients in oocytes, solutes may pass through or around AQP1 monomers. For example, mercurial inhibition of AQP1 was associated with increased urea transport via a pathway probably distinct from the AQP1 water pore (24). Further work is needed to identify conditions in which various aquaporins might transport substances other than water.
Water channel phosphorylation in oocytes by protein kinases A and C did
not affect water permeability. Recently, it was reported that exposure
of oocytes expressing AQP1 to forskolin was associated with increased
water permeability and the appearance of an ion conductance (48). These
results have been controversial and have not been repeatable by several
laboratories. Under conditions in which ion channel phosphorylation in
oocytes is strongly stimulated, we did not find an effect of protein
kinase A activation on Pf in oocytes expressing
AQP1, and in related studies, we did not find an effect of
phosphorylation agonists on AQP1-mediated water permeability and cation
leak in human erythrocyte membranes (49). It is noted that the AQP1
sequence does not contain a classical consensus site for
phosphorylation by protein kinase A, although AQP2 does contain such a
site at its C terminus. A small, 20-30% increase in water
permeability has been reported in oocytes expressing AQP2 (50). This
result has also been controversial in oocyte studies (51) as well as in
an in vitro phosphorylation study using AQP2-containing
endosomes from kidney collecting duct (52). The data here, with 5-10%
S.E. in Pf determination, do not confirm the
increase in Pf in AQP2-expressing oocytes. Recent
data suggest that a more likely role for the phosphorylation consensus
site in AQP2 is in the regulation of trafficking in mammalian cells
(53, 54). Effects of protein kinase A phosphorylation on AQP3-5 and
MIP have not been studied previously, nor have effects of protein
kinase C phosphorylation on any of the proteins. Interestingly, protein
kinase A activation increases water permeability by 2-fold in oocytes
expressing the plant water channel -TIP (55). Taken together, the
results here do not support a role for phosphorylation in regulating
the intrinsic water permeabilities of rat AQP1-5 and MIP.
In summary, the aquaporins and MIP have heterogeneous intrinsic water permeabilities. Measurable glycerol permeability was found only for AQP3. Mechanistic evaluation of the heterogeneous transport properties of the aquaporins will require high resolution structure studies. The biological reason(s) for the existence of a family of related but functionally distinct proteins remains to be resolved.
FOOTNOTES
To whom correspondence should be addressed: Cardiovascular
Research Inst., 1246 Health Sciences East Tower, University of California, San Francisco, CA 94143-0521. Tel.: 415-476-8530; Fax:
415-665-3847.
1 The abbreviations used are: AQP, aquaporin; (Rp)-cAMP-S, (Rp)-adenosine cyclic 3
:5-phosphorothioate.
ACKNOWLEDGEMENTS
We thank Drs. Tonghui Ma for providing several of the aquaporin cDNAs and Dr. B. K. Tamarappoo for help in establishing immunoprecipitation conditions.
REFERENCES
-
Zampighi, G. A., Hall, J. E., Ehring, G. R., and Simon, S. A.
(1989)
J. Cell Biol.
108,
2255-2275
[Abstract/Free Full Text] -
Preston, G. M., and Agre, P.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
11110-11114
[Abstract/Free Full Text] - Fushimi, K., Uchida, S., Hara, Y., Hirata, Y., Marumo, F., and Sasaki, S. (1993) Nature 361, 549-552 [CrossRef][Medline] [Order article via Infotrieve]
-
Ishibashi, K., Sasaki, S., Fushimi, K., Uchida, S., Kuwahara, M., Saito, H., Furukawa, T., Nakajima, K., Yamaguchi, Y., Gojobori, T., and Marumo, F.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
6269-6273
[Abstract/Free Full Text] -
Ma, T., Frigeri, A., Hasegawa, H., and Verkman, A. S.
(1994)
J. Biol. Chem.
269,
21845-21849
[Abstract/Free Full Text] -
Echevarria, M., Windhager, E. E., Tate, S. S., and Frindt, G.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
10997-11001
[Abstract/Free Full Text] -
Frigeri, A., Gropper, M., Turck, C. W., and Verkman, A. S.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
4328-4331
[Abstract/Free Full Text] -
Hasegawa, H., Ma, T., Skach, W., Matthay, M., and Verkman, A. S.
(1994)
J. Biol. Chem.
269,
5497-5500
[Abstract/Free Full Text] -
Raina, S., Preston, G. M., Guggino, W. B., and Agre, P.
(1995)
J. Biol. Chem.
270,
1908-1912
[Abstract/Free Full Text] -
Verkman, A. S., Van Hoek, A. N., Ma, T., Frigeri, A., Skach, W. R., Mitra, A., Tamarappoo, B. K., and Farinas, J.
(1996)
Am. J. Physiol.
270,
C12-C30
[Abstract/Free Full Text] - Van Os, C. H., Deen, P. M. T., and Dempster, J. A. (1994) Biochim. Biophys. Acta 1197, 291-309 [Medline] [Order article via Infotrieve]
-
Knepper, M. A.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
6255-6258
[Free Full Text] - Agre, P., and Nielsen, S. (1995) Kidney Int. 24, 1057-1068
- Ma, T., Yang, B., Kuo, W. L., and Verkman, A. S. (1996) Genomics 35, 543-550 [CrossRef][Medline] [Order article via Infotrieve]
- Chrispeels, M. J., and Agre, P. (1994) Trends Biochem. Sci. 19, 421-425 [CrossRef][Medline] [Order article via Infotrieve]
- Abrami, L., Simon, M., Rousselet, G., Berthonaud, B., Buhler, J. M., and Ripoche, P. (1994) Biochim. Biophys. Acta 1192, 147-151 [Medline] [Order article via Infotrieve]
-
Ma, T., Yang, B., and Verkman, A. S.
(1996)
Am. J. Physiol.
271,
C1699-C1704
[Abstract/Free Full Text] -
Zhang, R., Skach, W., Hasegawa, H., Van Hoek, A. N., and Verkman, A. S.
(1993)
J. Cell Biol.
120,
359-369
[Abstract/Free Full Text] -
Jung, J. S., Bhat, R. V., Preston, G. M., Guggino, W. B., Baraban, J. M., and Agre, P.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
13052-13056
[Abstract/Free Full Text] -
Yang, B., Ma, T., and Verkman, A. S.
(1995)
J. Biol. Chem.
270,
22907-22913
[Abstract/Free Full Text] -
Ma, T., Frigeri, A., Tsai, S. T., Verbavatz, J. M., and Verkman, A. S.
(1993)
J. Biol. Chem.
268,
22756-22764
[Abstract/Free Full Text] -
Yang, B., Brown, D., and Verkman, A. S.
(1996)
J. Biol. Chem.
271,
4577-4580
[Abstract/Free Full Text] -
Katsura, T., Verbavatz, J. M., Farinas, J., Ma, T., Ausiello, D. A., Verkman, A. S., and Brown, D.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
7212-7216
[Abstract/Free Full Text] - Van Hoek, A. N., Wiener, M., Bicknese, S., Miercke, L., Biwersi, J., and Verkman, A. S. (1993) Biochemistry 32, 11847-11856 [CrossRef][Medline] [Order article via Infotrieve]
-
Mulders, S. M., Preston, G. M., Deen, P. M. T., Guggino, W. B., Van Os, C. H., and Agre, P.
(1995)
J. Biol. Chem.
270,
9010-9016
[Abstract/Free Full Text] - Zampighi, G. A., Kreman, M., Boorer, K. J., Loo, D. D. F., Bezanilla, F., Chandy, G., Hall, J. E., and Wright, E. M. (1995) J. Membr. Biol. 148, 65-68 [Medline] [Order article via Infotrieve]
-
Van Hoek, A. N., and Verkman, A. S.
(1992)
J. Biol. Chem.
267,
18267-18269
[Abstract/Free Full Text] - Zeidel, M. L., Ambudkar, S. V., Smith, B. L., and Agre, P. (1992) Biochemistry 31, 7436-7440 [CrossRef][Medline] [Order article via Infotrieve]
- Abrami, L., Tacnet, R., and Ripoche, P. (1995) Pfluegers Arch. Eur. J. Physiol. 430, 447-458 [CrossRef][Medline] [Order article via Infotrieve]
-
Evan, G. I., Lewis, G. K., Ramsay, G., and Bishop, J. M.
(1985)
Mol. Cell. Biol.
5,
3610-3616
[Abstract/Free Full Text] - Chubet, R. G., and Brizzard, B. L. (1996) BioTechniques 20, 136-141 [Medline] [Order article via Infotrieve]
-
Skach, W., Shi, L.-B., Calayag, M. C., Frigeri, A., Lingappa, V. R., and Verkman, A. S.
(1994)
J. Cell Biol.
125,
803-816
[Abstract/Free Full Text] -
Zhang, R., Logee, K., and Verkman, A. S.
(1990)
J. Biol. Chem.
265,
15375-15378
[Abstract/Free Full Text] -
Shi, L., Skach, W., and Verkman, A. S.
(1994)
J. Biol. Chem.
269,
10417-10422
[Abstract/Free Full Text] -
Hasegawa, H., Skach, W., Baker, O., Calayag, M. C., Lingappa, V., and Verkman, A. S.
(1992)
Science
258,
1477-1479
[Abstract/Free Full Text] -
Fischbarg, J., Kunyan, K., Vera, J. C., Arant, S., Silverstein, S., Loike, J., and Rosen, O. M.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
3244-3247
[Abstract/Free Full Text] -
Loo, D. D. F., Zeuthen, T., Chandy, G., and Wright, E. M.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
13367-13370
[Abstract/Free Full Text] -
Maurel, C., Reizer, J., Scroeder, J. I., Chrispeels, M. J., and Saier, M. H., Jr.
(1994)
J. Biol. Chem.
269,
11869-11872
[Abstract/Free Full Text] -
Echevarria, M., Windhager, E. E., and Frindt, G.
(1996)
J. Biol. Chem.
271,
25079-25082
[Abstract/Free Full Text] - Frigeri, A., Gropper, M., Umenishi, F., Kawashima, M., Brown, D., and Verkman, A. S. (1995) J. Cell Sci. 108, 2993-3002 [Abstract]
- Ma, T., Yang, B., Gillespie, A., Carlson, E. J., Epistein, C. J., and Verkman, A. S. (1997) J. Clin. Invest., in press
- Strange, K., and Spring, K. R. (1987) J. Membr. Biol. 96, 27-43 [CrossRef][Medline] [Order article via Infotrieve]
- Kishore, B. K., Terris, J. M., and Knepper, M. A. (1996) Am. J. Physiol. 40, F62-F70
- Verkman, A. S., Lencer, W., Brown, D., and Ausiello, D. A. (1988) Nature 333, 268-269 [CrossRef][Medline] [Order article via Infotrieve]
-
Verbavatz, J. M., Brown, D., Sabolic, I., Valenti, G., Ausiello, D. A., Van Hoek, A. N., Ma, T., and Verkman, A. S.
(1993)
J. Cell Biol.
123,
605-618
[Abstract/Free Full Text] - Cheng, A., Van Hoek, A. N., Yeager, M., Verkman, A. S., and Mitra, A. K. (1997) Nature, in press
- Walz, T., Typke, D., Smith, B. L., Agre, P., and Engel, A. (1995) Nat. Struct. Biol. 2, 730-732 [CrossRef][Medline] [Order article via Infotrieve]
- Yool, A. J., Stamer, W. D., and Regan, J. W. (1996) Science 273, 1216-1218 [Abstract]
- Verkman, A. S., and Yang, B. (1997) Science 275, 1491
-
Kuwahara, M., Fushimi, K., Terada, Y., Bai, L., Marumo, R., and Sasaki, S.
(1995)
J. Biol. Chem.
270,
10384-10387
[Abstract/Free Full Text] -
Ma, T., Hasegawa, H., Skach, W., Frigeri, A., and Verkman, A. S.
(1994)
Am. J. Physiol.
266,
C189-C197
[Abstract/Free Full Text] -
Lande, M. B., Jo, I., Zeidel, M. L., Somers, M., and Harris, H. W.
(1996)
J. Biol. Chem.
271,
5552-5557
[Abstract/Free Full Text] - Fushimi, K., Noda, Y., Yamaguchi, K., Sasaki, S., and Marumo, F. (1996) J. Am. Soc. Nephrol. 7, 1267 (abstr.)
- Katsura, T., Ausiello, D. A., and Brown, D. (1996) J. Am. Soc. Nephrol. 7, 1268 (abstr.)
- Maurel, C., Kado, R. T., Guern, J., and Chrispeels, M. J. (1994) EMBO J. 14, 3028-3035 [Medline] [Order article via Infotrieve]
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  S. Watanabe, T. Hirano, E. G. Grau, and T. Kaneko Osmosensitivity of prolactin cells is enhanced by the water channel aquaporin-3 in a euryhaline Mozambique tilapia (Oreochromis mossambicus) Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2009; 296(2): R446 - R453. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. C. Larocca, L. R. Soria, M. V. Espelt, G. L. Lehmann, and R. A. Marinelli Knockdown of hepatocyte aquaporin-8 by RNA interference induces defective bile canalicular water transport Am J Physiol Gastrointest Liver Physiol, January 1, 2009; 296(1): G93 - G100. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Gumbart and K. Schulten The Roles of Pore Ring and Plug in the SecY Protein-conducting Channel J. Gen. Physiol., December 1, 2008; 132(6): 709 - 719. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Suga, H. Nagasaki, T.-a. Kondo, Y. Okajima, C. Suzuki, N. Ozaki, H. Arima, T. Yamamoto, N. Ozaki, M. Akai, et al. Novel Treatment for Lithium-Induced Nephrogenic Diabetes Insipidus Rat Model Using the Sendai-Virus Vector Carrying Aquaporin 2 Gene Endocrinology, November 1, 2008; 149(11): 5803 - 5810. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. O. Jensen, R. O. Dror, H. Xu, D. W. Borhani, I. T. Arkin, M. P. Eastwood, and D. E. Shaw Dynamic control of slow water transport by aquaporin 0: Implications for hydration and junction stability in the eye lens PNAS, September 23, 2008; 105(38): 14430 - 14435. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. D. Sorani, Z. Zador, E. Hurowitz, D. Yan, K. M. Giacomini, and G. T. Manley Novel variants in human Aquaporin-4 reduce cellular water permeability Hum. Mol. Genet., August 1, 2008; 17(15): 2379 - 2389. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. K. Kang, Y. K. Chae, J. Woo, M. S. Kim, J. C. Park, J. Lee, J. C. Soria, S. J. Jang, D. Sidransky, and C. Moon Role of Human Aquaporin 5 In Colorectal Carcinogenesis Am. J. Pathol., August 1, 2008; 173(2): 518 - 525. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Yang, Z. Zador, and A. S. Verkman Glial Cell Aquaporin-4 Overexpression in Transgenic Mice Accelerates Cytotoxic Brain Swelling J. Biol. Chem., May 30, 2008; 283(22): 15280 - 15286. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Uehlein, B. Otto, D. T. Hanson, M. Fischer, N. McDowell, and R. Kaldenhoff Function of Nicotiana tabacum Aquaporins as Chloroplast Gas Pores Challenges the Concept of Membrane CO2 Permeability PLANT CELL, March 1, 2008; 20(3): 648 - 657. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. S. Hub and B. L. de Groot Mechanism of selectivity in aquaporins and aquaglyceroporins PNAS, January 29, 2008; 105(4): 1198 - 1203. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. R Thiagarajah, D. Zhao, and A S Verkman Impaired enterocyte proliferation in aquaporin-3 deficiency in mouse models of colitis Gut, November 1, 2007; 56(11): 1529 - 1535. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. A. Fenton and M. A. Knepper Mouse Models and the Urinary Concentrating Mechanism in the New Millennium Physiol Rev, October 1, 2007; 87(4): 1083 - 1112. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Ruiz-Ederra and A. S. Verkman Accelerated cataract formation and reduced lens epithelial water permeability in aquaporin-1-deficient mice. Invest. Ophthalmol. Vis. Sci., September 1, 2006; 47(9): 3960 - 3967. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. L. Butler, C. G. Au, B. Yang, J. R. Egan, Y. M. Tan, E. C. Hardeman, K. N. North, A. S. Verkman, and D. S. Winlaw Cardiac aquaporin expression in humans, rats, and mice Am J Physiol Heart Circ Physiol, August 1, 2006; 291(2): H705 - H713. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Saadoun, M. C. Papadopoulos, H. Watanabe, D. Yan, G. T. Manley, and A. S. Verkman Involvement of aquaporin-4 in astroglial cell migration and glial scar formation J. Cell Sci., December 15, 2005; 118(24): 5691 - 5698. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Baum and R. Quigley Proximal tubule water transport-lessons from aquaporin knockout mice Am J Physiol Renal Physiol, December 1, 2005; 289(6): F1193 - F1194. [Full Text] [PDF]
|
|
|
|
 |
|
 N. Kaufmann, J. C. Mathai, W. G. Hill, J. A. T. Dow, M. L. Zeidel, and J. L. Brodsky Developmental expression and biophysical characterization of a Drosophila melanogaster aquaporin Am J Physiol Cell Physiol, August 1, 2005; 289(2): C397 - C407. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Watanabe, T. Kaneko, and K. Aida Aquaporin-3 expressed in the basolateral membrane of gill chloride cells in Mozambique tilapia Oreochromis mossambicus adapted to freshwater and seawater J. Exp. Biol., July 15, 2005; 208(14): 2673 - 2682. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. G. Hill, N. M. Southern, B. MacIver, E. Potter, G. Apodaca, C. P. Smith, and M. L. Zeidel Isolation and characterization of the Xenopus oocyte plasma membrane: a new method for studying activity of water and solute transporters Am J Physiol Renal Physiol, July 1, 2005; 289(1): F217 - F224. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Hara-Chikuma, B. Yang, N. D. Sonawane, S. Sasaki, S. Uchida, and A. S. Verkman ClC-3 Chloride Channels Facilitate Endosomal Acidification and Chloride Accumulation J. Biol. Chem., January 14, 2005; 280(2): 1241 - 1247. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. E. C. Harries, D. Akhavan, L. J. W. Miercke, S. Khademi, and R. M. Stroud The channel architecture of aquaporin 0 at a 2.2-A resolution PNAS, September 28, 2004; 101(39): 14045 - 14050. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H.-L. Lian, X. Yu, Q. Ye, X.-S. Ding, Y. Kitagawa, S.-S. Kwak, W.-A. Su, and Z.-C. Tang The Role of Aquaporin RWC3 in Drought Avoidance in Rice Plant Cell Physiol., April 15, 2004; 45(4): 481 - 489. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Saparov and P. Pohl Beyond the diffusion limit: Water flow through the empty bacterial potassium channel PNAS, April 6, 2004; 101(14): 4805 - 4809. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. E. Ball, M. Little, M. W. Nowak, D. L. Garland, R. K. Crouch, and K. L. Schey Water Permeability of C-Terminally Truncated Aquaporin 0 (AQP0 1-243) Observed in the Aging Human Lens Invest. Ophthalmol. Vis. Sci., November 1, 2003; 44(11): 4820 - 4828. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. P. Cutler and G. Cramb Branchial expression of an aquaporin 3 (AQP-3) homologue is downregulated in the European eel Anguilla anguilla following seawater acclimation J. Exp. Biol., September 1, 2002; 205(17): 2643 - 2651. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Hagedorn, S.L. Lance, D.M. Fonseca, F.W. Kleinhans, D. Artimov, R. Fleischer, A.T.M.S. Hoque, M.B. Hamilton, and B.S. Pukazhenthi Altering Fish Embryos with Aquaporin-3: An Essential Step Toward Successful Cryopreservation Biol Reprod, September 1, 2002; 67(3): 961 - 966. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. MacAulay, U. Gether, D. A Klaerke, and T. Zeuthen Passive water and urea permeability of a human Na+-glutamate cotransporter expressed in Xenopus oocytes J. Physiol., August 1, 2002; 542(3): 817 - 828. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Ma, M. Hara, R. Sougrat, J.-M. Verbavatz, and A. S. Verkman Impaired Stratum Corneum Hydration in Mice Lacking Epidermal Water Channel Aquaporin-3 J. Biol. Chem., May 3, 2002; 277(19): 17147 - 17153. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Moshelion, D. Becker, A. Biela, N. Uehlein, R. Hedrich, B. Otto, H. Levi, N. Moran, and R. Kaldenhoff Plasma Membrane Aquaporins in the Motor Cells of Samanea saman: Diurnal and Circadian Regulation PLANT CELL, March 1, 2002; 14(3): 727 - 739. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. V. Virkki, G. J. Cooper, and W. F. Boron Cloning and functional expression of an MIP (AQP0) homolog from killifish (Fundulus heteroclitus) lens Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2001; 281(6): R1994 - R2003. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Pastor-Soler, C. Bagnis, I. Sabolic, R. Tyszkowski, M. McKee, A. Van Hoek, S. Breton, and D. Brown Aquaporin 9 Expression along the Male Reproductive Tract Biol Reprod, August 1, 2001; 65(2): 384 - 393. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Pohl, S. M. Saparov, M. J. Borgnia, and P. Agre Highly selective water channel activity measured by voltage clamp: Analysis of planar lipid bilayers reconstituted with purified AqpZ PNAS, August 1, 2001; (2001) 161299398. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Matsuzaki, T. Suzuki, and K. Takata Hypertonicity-induced expression of aquaporin 3 in MDCK cells Am J Physiol Cell Physiol, July 1, 2001; 281(1): C55 - C63. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Niermann, M. Amiry-Moghaddam, K. Holthoff, O. W. Witte, and O. P. Ottersen A Novel Role of Vasopressin in the Brain: Modulation of Activity-Dependent Water Flux in the Neocortex J. Neurosci., May 1, 2001; 21(9): 3045 - 3051. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Huang, R. Tracy, G. E. Walsberg, A. Makkinje, P. Fang, D. Brown, and A. N. Van Hoek Absence of aquaporin-4 water channels from kidneys of the desert rodent Dipodomys merriami merriami Am J Physiol Renal Physiol, May 1, 2001; 280(5): F794 - F802. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E.J. Kamsteeg, I. Heijnen, C.H. van Os, and P.M.T. Deen The Subcellular Localization of an Aquaporin-2 Tetramer Depends on the Stoichiometry of Phosphorylated and Nonphosphorylated Monomers J. Cell Biol., November 13, 2000; 151(4): 919 - 930. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. J. Kamsteeg and P. M. T. Deen Importance of aquaporin-2 expression levels in genotype -phenotype studies in nephrogenic diabetes insipidus Am J Physiol Renal Physiol, October 1, 2000; 279(4): F778 - F784. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. S. Wang, A. R. Komar, T. Ma, F. Filiz, J. McLeroy, K. Hoda, A. S. Verkman, and J. A. Bastidas Gastric acid secretion in aquaporin-4 knockout mice Am J Physiol Gastrointest Liver Physiol, August 1, 2000; 279(2): G448 - G453. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. S. Verkman, M. A. Matthay, and Y. Song Aquaporin water channels and lung physiology Am J Physiol Lung Cell Mol Physiol, May 1, 2000; 278(5): L867 - L879. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. L. Nemeth-Cahalan and J. E. Hall pH and Calcium Regulate the Water Permeability of Aquaporin 0 J. Biol. Chem., March 15, 2000; 275(10): 6777 - 6782. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Yamashita, K. Hirai, Y. Katayama, K. Fushimi, S. Sasaki, and F. Marumo Mutations in sixth transmembrane domain of AQP2 inhibit its translocation induced by vasopression Am J Physiol Renal Physiol, March 1, 2000; 278(3): F395 - F405. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Yang, N. Fukuda, A. van Hoek, M. A. Matthay, T. Ma, and A. S. Verkman Carbon Dioxide Permeability of Aquaporin-1 Measured in Erythrocytes and Lung of Aquaporin-1 Null Mice and in Reconstituted Proteoliposomes J. Biol. Chem., January 28, 2000; 275(4): 2686 - 2692. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. S. Verkman and A. K. Mitra Structure and function of aquaporin water channels Am J Physiol Renal Physiol, January 1, 2000; 278(1): F13 - F28. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Bissonnette, J. Noel, M. J Coady, and J.-Y. Lapointe Functional expression of tagged human Na+--glucose cotransporter in Xenopus laevis oocytes J. Physiol., October 15, 1999; 520(2): 359 - 371. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. B. Heymann and A. Engel Aquaporins: Phylogeny, Structure, and Physiology of Water Channels Physiology, October 1, 1999; 14(5): 187 - 193. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Ma, Y. Song, A. Gillespie, E. J. Carlson, C. J. Epstein, and A. S. Verkman Defective Secretion of Saliva in Transgenic Mice Lacking Aquaporin-5 Water Channels J. Biol. Chem., July 16, 1999; 274(29): 20071 - 20074. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Yang, H. G. Folkesson, J. Yang, M. A. Matthay, T. Ma, and A. S. Verkman Reduced osmotic water permeability of the peritoneal barrier in aquaporin-1 knockout mice Am J Physiol Cell Physiol, January 1, 1999; 276(1): C76 - C81. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-K. Meinild, D. A. Klaerke, and T. Zeuthen Bidirectional Water Fluxes and Specificity for Small Hydrophilic Molecules in Aquaporins 0-5 J. Biol. Chem., December 4, 1998; 273(49): 32446 - 32451. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Ma, B. Yang, M. A. Matthay, and A. S. Verkman Evidence against a Role of Mouse, Rat, and Two Cloned Human T1alpha Isoforms as a Water Channel or a Regulator of Aquaporin-type Water Channels Am. J. Respir. Cell Mol. Biol., July 1, 1998; 19(1): 143 - 149. [Abstract] [Full Text]
|
|
|
|
|
|
B. Yang and A. S. Verkman Urea Transporter UT3 Functions as an Efficient Water Channel. DIRECT EVIDENCE FOR A COMMON WATER/UREA PATHWAY J. Biol. Chem., April 17, 1998; 273(16): 9369 - 9372. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. G. Dobbs, R. Gonzalez, M. A. Matthay, E. P. Carter, L. Allen, and A. S. Verkman Highly water-permeable type I alveolar epithelial cells confer high water permeability between the airspace and vasculature in rat lung PNAS, March 17, 1998; 95(6): 2991 - 2996. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Han, M. B. Wax, and R. V. Patil Regulation of Aquaporin-4 Water Channels by Phorbol Ester-dependent Protein Phosphorylation J. Biol. Chem., March 13, 1998; 273(11): 6001 - 6004. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. L. Chou, T. Ma, B. Yang, M. A. Knepper, and A. S. Verkman Fourfold reduction of water permeability in inner medullary collecting duct of aquaporin-4 knockout mice Am J Physiol Cell Physiol, February 1, 1998; 274(2): C549 - C554. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Verbavatz, T Ma, R Gobin, and A. Verkman Absence of orthogonal arrays in kidney, brain and muscle from transgenic knockout mice lacking water channel aquaporin-4 J. Cell Sci., January 11, 1997; 110(22): 2855 - 2860. [Abstract] [PDF]
|
|
|
|
|
|
W. Foster, A. Helm, I. Turnbull, H. Gulati, B. Yang, A. S. Verkman, and W. R. Skach Identification of Sequence Determinants That Direct Different Intracellular Folding Pathways for Aquaporin-1 and Aquaporin-4 J. Biol. Chem., October 27, 2000; 275(44): 34157 - 34165. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Saparov, D. Kozono, U. Rothe, P. Agre, and P. Pohl Water and Ion Permeation of Aquaporin-1 in Planar Lipid Bilayers. MAJOR DIFFERENCES IN STRUCTURAL DETERMINANTS AND STOICHIOMETRY J. Biol. Chem., August 17, 2001; 276(34): 31515 - 31520. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Li and A. S. Verkman Impaired Hearing in Mice Lacking Aquaporin-4 Water Channels J. Biol. Chem., August 10, 2001; 276(33): 31233 - 31237. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Song and A. S. Verkman Aquaporin-5 Dependent Fluid Secretion in Airway Submucosal Glands J. Biol. Chem., October 26, 2001; 276(44): 41288 - 41292. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Ma, Y. Song, B. Yang, A. Gillespie, E. J. Carlson, C. J. Epstein, and A. S. Verkman Nephrogenic diabetes insipidus in mice lacking aquaporin-3 water channels PNAS, April 11, 2000; 97(8): 4386 - 4391. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Pohl, S. M. Saparov, M. J. Borgnia, and P. Agre Highly selective water channel activity measured by voltage clamp: Analysis of planar lipid bilayers reconstituted with purified AqpZ PNAS, August 14, 2001; 98(17): 9624 - 9629. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |