Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Eitinger, T.
Right arrow Articles by Anthon, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Eitinger, T.
Right arrow Articles by Anthon, C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 27, Issue of July 4, 1997 pp. 17139-17144
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

A Ni2+ Binding Motif Is the Basis of High Affinity Transport of the Alcaligenes eutrophus Nickel Permease*

(Received for publication, October 29, 1996, and in revised form, April 1, 1997)

Thomas Eitinger Dagger §, Lutz Wolfram Dagger , Olaf Degen Dagger and Carolin Anthon

From the Dagger  Humboldt-Universität zu Berlin, Institut für Biologie/Mikrobiologie, Chausseestraße 117, D-10115 Berlin and  Freie Universität Berlin, Institut für Pflanzenphysiologie und Mikrobiologie, D-14195 Berlin, Germany

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

Amino acid exchanges in the Alcaligenes eutrophus nickel permease (HoxN) were constructed by site-directed mutagenesis, and their effects on nickel ion uptake were investigated. Mutant hoxN alleles were expressed in Escherichia coli, and activity of the altered permeases was examined via a recently described physiological assay (Wolfram, L., Friedrich, B., and Eitinger, T. (1995) J. Bacteriol. 177, 1840-1843). Replacement of Cys-37, Cys-256, or Cys-318 by alanine did not severely affect nickel ion uptake. This activity of a C331A mutant was diminished by 60%, and a similar phenotype was obtained with a cysteine-less mutant harboring four Cys to Ala exchanges. Alterations in a histidine-containing sequence motif (His-62, Asp-67, His-68), which is conserved in microbial nickel transport proteins, strongly affected or completely abolished transport activity in the E. coli system. The analysis of HoxN alkaline phosphatase fusion proteins implied that His-62, Asp-67, and His-68 exchanges did not interfere with overall membrane topology or stability of the nickel permease. These mutations were reintroduced into the A. eutrophus wild-type strain. Analyses of the resulting HoxN mutants indicated that exchanges in the histidine motif led to a clearly decreased affinity of the permease for nickel ion.


INTRODUCTION

Alcaligenes eutrophus H16, a member of the beta  division of the proteobacteria, can utilize various organic compounds or molecular hydrogen as energy sources. Hydrogen oxidation is catalyzed by two metalloenzymes: a cytoplasmic NAD+-reducing hydrogenase and a membrane-bound, electron transport-coupled hydrogenase. Both enzymes belong to the family of [NiFe] hydrogenases (reviewed in Ref. 1). A nickel-dependent urease allows the organism to grow on urea as a nitrogen source.

Uptake of nickel ion in sufficient amounts is a prerequisite for the synthesis of nickel-containing enzymes. Microbial nickel uptake is mediated by nonspecific transport systems for divalent cations and by specific systems with a high affinity for Ni2+. In natural environments the concentration of Ni2+ is generally very low compared with other divalent cations like Mg2+. Since nonspecific nickel transport is competitively inhibited by a number of divalent cations, this mode of uptake is not suited for meeting the cellular nickel requirements (reviewed in Refs. 2 and 3). Molecular analyses of Ni2+-specific transport systems of a few bacteria containing [NiFe] hydrogenases and/or ureases showed that two different types of membrane transporters are responsible for high affinity uptake of the transition metal (reviewed in Ref. 3). The best studied Ni2+ transporters, the Nik system of Escherichia coli (4) and the HoxN permease of A. eutrophus (5, 6), are the prototype of these two classes. Nik belongs to the ATP binding cassette family of transporters. It consists of five subunits: a periplasmic binding protein (NikA), two integral membrane subunits (NikB, NikC), and two components containing ATP binding motifs (NikD, NikE). There is no evidence that HoxN requires additional proteins for its function as a permease. This suggests that the two types of transporters employ different uptake mechanisms. HoxN is an integral membrane protein and was until recently thought to contain seven transmembrane segments (6, 7). The topological model was based on the construction and analysis of a number of fusions to alkaline phosphatase and beta -galactosidase (6). Due to an error in the originally published hoxN nucleotide sequence (5), the C-terminal part of the protein was neglected in the topological study. Additional fusions favor the eight-helix model presented in Fig. 1.


Fig. 1. Revised topological model of the A. eutrophus nickel permease. Residues that were subjected to site-directed mutagenesis are shown in solid boxes. See text for details.
[View Larger Version of this Image (20K GIF file)]

HoxN homologs have been found in Bradyrhizobium japonicum (8), a hydrogenase-producing soil bacterium; in the thermophilic Bacillus strain TB-90 (9), which contains a urease; and in Helicobacter pylori (10), a human pathogen that is dependent on a highly active urease for initial colonization of the gastric mucosa. It is still not known how these transporters discriminate among divalent cations. Biochemical analyses of the HoxN-type permeases are difficult because these systems have a high affinity for Ni2+ (KT of 10-20 nM) but a very low capacity (reviewed in Ref. 3). Therefore, we developed a physiological assay for HoxN-mediated Ni2+ uptake (7) to carry out a detailed analysis of the structure-function relationship. In the present report we describe the consequences of amino acid replacements in HoxN. We chose the cysteine residues because of their hypothetical role in metal binding. The main focus of this study, however, is on a conserved histidine motif (His-Xaa4-Asp-His) found in HoxN-type permeases as well as in NikC, an integral membrane component of the E. coli nickel transport system (7).


EXPERIMENTAL PROCEDURES

Materials

Analytical grade chemicals were obtained from Merck, Sigma, and Fluka. 63NiCl2 (30 TBq/mol) and [35S]dATPalpha S1 were from Amersham. Zinsser Aquasafe 300 Plus was used as the mixture for liquid scintillation analyses in a Packard 1600 TR counter. Biochemicals were obtained from Boehringer Mannheim, New England Biolabs, Amersham, and Life Technologies. PhoA hybrid proteins were detected in Western immunoblots using a rabbit anti-PhoA antibody (5 Prime right-arrow 3 Prime, Inc., Boulder, CO) and an alkaline phosphatase-coupled goat anti-rabbit antibody (Jackson ImmunoResearch). Nitrocellulose blotting membranes were from Schleicher & Schüll. For direct sequencing of PCR-amplified DNA, samples were purified on Qiagen spin columns.

Bacterial Strains and Plasmids

E. coli CC118 (11) was used as the host for recombinant plasmids. Plasmids pCH231-Sm harboring the A. eutrophus gene hoxN, pCH231-P47, which contains an insertion of the transposon TnphoA in the 48th codon of hoxN, and pCH231-P291 encoding a fusion of E. coli alkaline phosphatase (PhoA) to HoxN residue 291 were described recently (6, 7). Plasmid pKAU17 (12) containing the urease operon of Klebsiella aerogenes was a gift from R. P. Hausinger (Michigan State University, East Lansing). hoxN mutations were transferred to A. eutrophus H16 (DSM 428, ATCC 17699) by conjugation using the donor E. coli S17-1 (13) and the counterselectable suicide vector pLO2 as described by Lenz et al. (14).

Site-directed Mutagenesis and Gene Replacement

Mutagenesis was carried out by the PCR-based method of Chen and Przybyla (15), which in most cases requires two rounds of PCR but only a single mutagenic oligonucleotide primer. The mutagenic oligonucleotides used in this study are listed in Table I. Taq DNA polymerase was used for DNA amplification. To avoid unwanted mutations generated by Taq-catalyzed untemplated addition of nucleotides, fragments of the first PCR round were treated with T4 DNA polymerase, which removes 3' overhangs. The products of the second PCR round were digested with appropriate restriction endonucleases, purified on agarose gels, and used to replace the respective fragments of plasmid pCH231-Sm. The complete sequences of synthetic DNAs were verified by the dideoxy chain termination method of Sanger et al. (16). Modified hoxN segments were introduced into a derivative of the A. eutrophus wild-type strain H16,2 which harbors a large in-frame deletion in hoxN covering 768 bp. The allelic exchange procedure took advantage of the conditionally lethal sacB gene on vector pLO2 (14). Sucrose-resistant colonies were screened for full-length hoxN by PCR amplification. As described by Bernhard et al. (17), 1 ml of a fresh overnight culture grown in nutrient broth was concentrated 2-fold in distilled water and boiled for 5 min. 10 µl of this crude lysate was used for PCR. hoxN point mutations in A. eutrophus were confirmed by sequence determination of the amplified fragments. Genomic rearrangements adjacent to the recombination sites were excluded by PCR amplification of a segment spanning hoxN and the 5' and 3' neighboring regions.

Table I. Mutagenic oligonucleotides used for amino acid replacements


Mutant Orientationa                  Oligonucleotide (5' right-arrow 3')b Codon change

H62A Antisense CGTCTACCGCNNHGCGCAACCCAAGGCC CAC right-arrow GCG
H62I Antisense CGTCTACCGCNNHGCGCAACCCAAGGCC CAC right-arrow ATC
H62S Antisense CGTCTACCGCNNHGCGCAACCCAAGGCC CAC right-arrow AGC
D67E Antisense TTGCCGCGAGATGCTCTGCGTCTACCGCGTGG GAT right-arrow GAG
D67N Antisense TTGCCGCGAGATGATTTGCGTCTACCGCGTGG GAT right-arrow AAT
H68I Antisense TTGCCGCGAGAATATCTGCGTCTACCGCGTGG CAT right-arrow ATT
H68S Antisense TTGCCGCGAGACTATCTGCGTCTACCGCGTGG CAT right-arrow AGT
C37A Sensea GGCTCGCCGCGCTCGCCGCG TGC right-arrow GCC
C256A Sense GACACCATCGATAGCATCCTGATGGCCGGCGCCTATGCGTGG TGT right-arrow GCC
C318A Sense GAATTTCGCCCAATTGGGCTTCGTC TGT right-arrow GCC
C331A Sense TACCGTGGCCTGGGTCGTGTCGATCG TGT right-arrow GCC

a Orientation of the oligonucleotide with respect to the orientation of the hoxN reading frame.
b N stands for a mixture of A, C, G, and T. A mixture of A, C, and T is indicated by H. Altered bases are shown in boldface italics.

Assays

Nickel accumulation of E. coli CC118 harboring plasmid pCH231-Sm or derivatives was tested as described recently (7). The cellular content of 63Ni is expressed as picomoles per milligram of protein. Urease (EC 3.5.1.5) activity of strain CC118 containing pKAU17 and pCH231-Sm or derivatives was determined upon growth in the presence of 500 nM NiCl2 by quantitating the rate of ammonium ion released from urea (7). Alkaline phosphatase (EC 3.1.3.1) activity was assayed colorimetrically using 4-nitrophenyl phosphate as the substrate (6). The A. eutrophus soluble hydrogenase (SH; EC 1.12.1.2) was measured with permeabilized cells by monitoring H2-dependent reduction of NAD+ as described by Friedrich et al. (18). Specific enzyme activities are given in units per milligram of protein. One unit of activity is defined as the amount of enzyme required to consume 1 µmol of substrate per min. Protein was estimated by the method of Lowry et al. (19).

Western Immunoblot Analysis

Cells were grown in Luria-Bertani broth, harvested, and resuspended in buffer containing 3% (w/v) SDS. 30 µg of protein was separated by SDS-PAGE (7.5% polyacrylamide) (20) and electroblotted onto nitrocellulose membranes. Immunoblots were developed as described recently (6).


RESULTS

Correction of the hoxN Sequence

In the course of site-directed mutagenesis we identified an error in hoxN. An additional G is present between bases 1,102 and 1,103 of the published sequence (5) giving an open reading frame of 1,053 bp. Thus, the deduced polypeptide consists of 351 rather than 301 amino acid residues and has a molecular mass of 38.9 kDa. Computer analyses of the corrected nucleotide sequence predicted a membrane-spanning segment in the new C-terminal part of the HoxN protein. The previous topological analysis, which was confined to the first 301 amino acids, identified seven transmembrane helices (6). Data for additional alkaline phosphatase and beta -galactosidase fusions to residues 300 and 351 of the permease, respectively (not shown), support the assumption of an eighth membrane-spanning helix in the C-terminal part of the protein. The revised topological model is shown in Fig. 1.

Construction of Amino Acid Exchange Mutants

Mutations in single cysteine codons of hoxN were generated by PCR using the mutagenic oligonucleotide primers listed in Table I and plasmid pCH231-Sm as template. This procedure led to the isolation of permease mutants with Cys-37, Cys-256, Cys-318, or Cys-331 replaced by Ala. Double and triple mutants and a quadruple mutant with two, three, and four Cys to Ala exchanges, respectively, were obtained as follows. C256A/C318A, C256A/C331A, and C318A/C331A mutants were generated via PCR using single mutation plasmids as templates. The C37A/C256A, C37A/C318A, and C37A/C331A derivatives were constructed by insertion of a 303-bp ClaI/Bsu36I fragment with the respective 3' mutation into a plasmid carrying the C37A mutation. Both strategies were used to generate the four triple mutants. Introduction of the 303-bp fragment corresponding to the C256A/C318A/C331A triple mutant into the C37A plasmid yielded the cysteine-less quadruple mutant. His-62 exchanges were produced via PCR using an oligonucleotide primer with a "three-base wobble" (Table I) at the relevant position. This method permitted the isolation of mutants with H62A, H62I, and H62S replacements. Additional His-62 mutants, obtained by this strategy, were not further analyzed since spontaneous second site mutations had occurred during PCR amplification. Asp-67 and His-68 mutants were constructed using the mutagenic primers listed in Table I. The H62I/H68I double mutant was obtained by introduction of a 96-bp AccI/MscI fragment containing the H68I mutation into a plasmid harboring the H62I mutation.

Cysteine Residues Are Not Essential for Nickel Transport

To investigate the role of the residues Cys-37, Cys-256, Cys-318, and Cys-331 in Ni2+ uptake we assayed Ni2+ accumulation and urease activity of E. coli CC118 producing altered HoxN proteins with single or multiple Cys replacements. The results are shown in Table II. E. coli transformants producing the wild-type A. eutrophus nickel permease accumulated 34 pmol of Ni2+ per mg of protein and displayed a urease activity of 581 milliunits per mg of protein. In comparison, the control strain with an inactivated hoxN accumulated 1.7 pmol of Ni2+ per mg of protein and showed a urease activity of 27 milliunits per mg of protein. Both Ni2+ accumulation and urease activities were unaffected by the C37A exchange. The C256A mutant harboring a replacement within transmembrane helix VI (Fig. 1) showed 80% of the wild-type level of Ni2+ accumulation and 60% of the urease activity suggesting that Cys-256 is not essential for metal ion transport. A mutation resulting in the replacement of Cys-318 by Ala led to a slight but reproducible increase of Ni2+ uptake. Cys-318 is located within the fourth periplasmic loop connecting helices VII and VIII (Fig. 1). It is tempting to speculate that this residue has metal binding capacity but is not part of the substrate recognition domain, and thus, its replacement may increase Ni2+ transport across the membrane. Among the Cys single mutants, the C331A exchange gave the strongest response resulting in a 50-70% decrease in Ni2+ uptake. The analysis of Cys double and triple mutants (data not shown) did not add to the information obtained with the single replacements. None of the mutants harboring the C331A exchange had more than 50% of the Ni2+ uptake activity compared with the wild-type HoxN. This also applies to the cysteine-less quadruple mutant that shows only 30% of the normal Ni2+ accumulation and urease activities (Table II).

Table II. Effect of histidine and cysteine mutations in HoxN on Ni2+ accumulation and urease activity of recombinant E. coli

For 63Ni2+ accumulation assays E. coli CC118 harboring wild-type hoxN or derivatives was grown in Luria-Bertani broth in the presence of 500 nM 63NiCl2 (30 TBq/mol). The cellular Nickel content was determined by liquid scintillation counting. Urease assays were performed with E. coli CC118 containing mutated hoxN sequences on derivatives of plasmid pCH231-Sm and the K. aerogenes urease operon on plasmid pKAU17.

Mutant Ni2+ accumulationa Urease activityb

pmol/mg protein milliunits/mg protein
Parent 34.0 581
HoxN- (hoxN::TnphoA) <2 27
C37A 35.4 589
C256A 27.0 330
C318A 40.5 614
C331A 17.9 185
C37A/C256A/C318A/C331A 10.7 169
H62A 2.8 56
H62I 2.2 27
H62S 7.3 94
D67E <2 48
D67N <2 47
H68I <2 58
H68S <2 33
H62I/H68I <2 52

a Values represent the averages of at least three independent experiments.
b Activities are the means of double or triple independent assays.

His-62, Asp-67, and His-68 Are Critical for Activity of the Permease

In the course of recently reported sequence alignments of nickel transport proteins (7) we identified the conserved motif His-Xaa4-Asp-His that resembles the Ni(II)-binding site of human serum albumin and is located within the second transmembrane helix of the HoxN-type permeases (3) (Fig. 1). Since this was the first hint to a substrate-binding domain in these proteins we investigated the significance of this signature for the activity of the A. eutrophus HoxN. His-62 was replaced by Ala, Ile, and Ser; Asp-67 by Asn and Glu; and His-68 by Ile and Ser. The effect on Ni2+ accumulation and urease-enhancing activity was monitored in E. coli. The replacements had clear-cut effects. Exchanging His-62 to Ile abolished Ni2+ uptake almost completely, and the H62A mutant showed only marginal activity, while the H62S mutant contained residual activity of approximately 20% (Table II). These results are compatible with the notion that the nature of the amino acid side chain at position 62 of the permease is critical. On the other hand, all Asp-67 and His-68 mutants were totally devoid of activity (Table II).

Expression of Permeases with His-62, Asp-67, and His-68 Exchanges

To exclude the possibility that diminished transport activity of the mutants is due to altered gene expression, defective insertion of the permease into the membrane, or enhanced proteolysis, we studied the influence of the mutations on HoxN levels by Western immunoblot analysis. Since an antibody against HoxN is not available, we took advantage of a previously described fusion of E. coli PhoA to HoxN (6). In this construct (P291) PhoA is fused to amino acid 291 of HoxN and faces the periplasm (Fig. 2). P291 derivatives with exchanges at position 62, 67, and 68 were generated by introducing a 1.3-kilobase XhoI/MscI fragment containing the respective mutation into the parent P291 gene fusion. PhoA activities of P291 derivatives were measured, and the amount of the fusion proteins in the E. coli CC118 membrane was determined by immunoblotting using an anti-PhoA antibody. The results are shown in Fig. 2. Comparable quantities of P291 were detected irrespective of the His-62, Asp-67, and His-68 exchanges, and each fusion displayed PhoA activity. A remarkable decrease of this activity was observed for the D67N and H68I mutants. Nevertheless, these results indicate that the altered permeases are present in similar amounts and correctly oriented in the membrane.


Fig. 2. Immunological detection of HoxN-PhoA fusion proteins with His-62, Asp-67, and His-68 exchanges. A, the fusion site of alkaline phosphatase (PhoA) to HoxN residue 291 and the positions of His-62, Asp-67, and His-68 are indicated. B, detection of the fusion proteins by Western blotting. The respective gene fusions were expressed in E. coli CC118. Proteins were separated by SDS-PAGE and blotted onto a nitrocellulose membrane. PhoA activities of the fusions are given in the lower part of panel B.
[View Larger Version of this Image (46K GIF file)]

Influence of Replacements in the Histidine Motif on Hydrogenase Activity of A. eutrophus

To assay the mutant permeases in the homologous background we reintroduced the amino acid exchanges into the A. eutrophus wild-type strain. Ni2+ transport experiments assaying the activity of HoxN in A. eutrophus or in recombinant E. coli do not yield reliable results since nonspecific binding of Ni2+ to the cell envelope and interference by the Mg2+ transport systems hinder kinetic analyses. Therefore, we monitored the effect of the replacements on the activity of the SH, a nickel-containing enzyme of A. eutrophus. The results are summarized in Table III. Surprisingly, the His-62 mutants were not impaired in SH activity when the cells were grown in a mineral salts medium supplemented with 100 nM NiCl2. Under these conditions, however, SH activity of a strain with a deletion in hoxN was clearly reduced. These results indicate that His-62 exchanges have no effect on the apparent activity of the nickel permease under these circumstances. In an additional experiment, the SH activity of mutants grown in mineral medium that was not supplemented with NiCl2 was measured. Under Ni2+ starvation, only 10% of SH activity was detectable in the wild-type strain and in the H62A and H62S mutants. SH activity in the H62I strain was less than 3% and was almost undetectable in the hoxN deletion mutant. These results indicate that His-62 has a significant effect on the affinity of the permease for the Ni2+ ion. Experimental support for this conclusion was obtained by growing the cells in a medium containing 100 nM NiCl2 and 10 µM nitrilotriacetate (NTA), a well known Ni2+ chelator. In this case Ni2+ is present almost exclusively in the form of NTA complexes. Addition of the metal-complexing agent did not affect SH activity in the wild-type strain but completely abolished the SH activity in the strain lacking HoxN. SH activities of the H62A, H62I, and H62S mutants were 65, 40, and 75%, respectively, compared with the wild type. In the presence of 50 µM NTA, the SH activities of the mutants were reduced to background levels. The Asp-67 and His-68 mutations as well as the H62I/H68I double mutation in hoxN had a dramatic effect. SH activities of these strains were almost undetectable under any conditions of nickel limitation tested. These results confirm that wild-type HoxN mediates maximal Ni2+ uptake even at extremely low substrate concentrations. Amino acid exchanges at positions 67 and 68 apparently inactivate the permease whereas exchanges at position 62 interfere with the affinity of the transporter for Ni2+ ion.

Table III. Effect of His-62, Asp-67, and His-68 replacements in the nickel permease on soluble hydrogenase activity of A. eutrophus

Cells were grown for 40 h at 30 °C under hydrogenase-derepressing conditions on a mixture of fructose and glycerol (0.2% w/v each) as the energy source. NiCl2 was supplemented as indicated. The concentration of MgSO4 was 5 mM. NTA was added to the growth medium where indicated. SH activities were determined with permeabilized cells by quantitating the H2-dependent reduction of NAD+.

Mutant Soluble hydrogenase activitya
0 100 nM NiCl2 100 nM NiCl2 + 10 µM NTA 100 nM NiCl2 + 50 µM NTA

millunits/mg protein
A. eutrophus H16 (wild type) 100 1,300 1,350 1,000
HoxN- (hoxNDelta ) <50 100 (900)b 0 0
H62A 90 1,300 800 <50
H62I <50 1,200 500 <50
H62S 90 1,200 950 <50
D67E <50 120 NDc 0
D67N <50 80 ND <50
H68I <50 110 ND 0
H68S <50 <50 ND <50
H62I/H68I <50 60 ND <50

a Values represent the averages of duplicates.
b The Mg2+ concentration in this experiment was only 100 µM. These conditions allow Ni2+ uptake by nonspecific Mg2+ transport systems.
c ND, not determined.


DISCUSSION

Ni2+-specific transport systems have been shown to play a key role in the synthesis of bacterial NiFe hydrogenases and ureases that are involved in energy and nitrogen metabolism of the respective species (reviewed in Ref. 3). In H. pylori, a human pathogen that is dependent on a highly active urease, Ni2+ transport is essential for pathogenesis (10). So far two different types of high affinity Ni2+ transporters have been identified. The Nik system, a permease belonging to the ATP binding cassette family, is to date unique to E. coli (4). Homologous one-component nickel permeases have been found in A. eutrophus (HoxN (5-7)), B. japonicum (HupN (8)), and H. pylori (NixA (10)). These systems show a common topology with eight membrane-spanning segments (reviewed in Ref. 3). The UreH protein of thermophilic Bacillus strain TB-90 (9), implicated in Ni2+ transport and clearly related to the one-component systems, probably contains less than eight transmembrane helices. An important feature of these Ni2+ transport systems is their ion selectivity allowing sufficient Ni2+ uptake even in environments where only traces of the transition metal ion are available. In a very recent study (23), a novel transporter (NhlF) mediating Co2+ uptake in the Gram-positive bacterium Rhodococcus rhodochrous J1 was described. This organism produces two types of cobalt-containing nitrile hydratases. Interestingly, NhlF is homologous to the one-component nickel permeases. Alignments revealed more than 35% amino acid sequence identity between NhlF and HoxN, HupN, and NixA (23). Nevertheless, NhlF does not catalyze Ni2+ transport. Co2+ transport, however, was inhibited by a 500-fold excess of Ni2+ ion, while other divalent cations had no effect (23). Thus, learning how these systems discriminate among divalent cations is essential for an understanding of the transport mechanism. In the E. coli Nik system, ion selectivity may be inherent to the periplasmic binding protein. In the case of the one-component permeases, specificity is an intrinsic property of the membrane proteins.

The present study represents a first attempt to gain insight into the structure-function relationship of the nickel permease (HoxN) of A. eutrophus. Using site-directed mutagenesis we introduced amino acid replacements in a putative nickel binding motif and at the positions occupied by Cys residues. These Cys residues are not conserved in the one-component Ni2+ transport systems, but nevertheless thiol groups are candidates for metal recognition. Evidence obtained with the Cys single, double, triple, and quadruple mutants suggests that Cys-331, located within transmembrane helix VIII, is the only Cys residue that could be directly involved in substrate recognition. Although not leading to a detailed insight into the transport mechanism, the availability of the Cys-less quadruple mutant is helpful for further studies such as cysteine-scanning mutagenesis. The latter technique in connection with excimer fluorescence labeling or permease probing with impermeant SH-reactive agents was successfully applied in studies on the three-dimensional structure of the lactose permease (21) and the mechanism of the glucose 6-phosphate/phosphate antiporter of E. coli (22). Cys-free variants are a prerequisite for this approach.

Replacements of His-62, Asp-67, and His-68, which are conserved in bacterial nickel permeases (3, 7), had clear-cut effects in the physiological assay system. Mutant permeases were dramatically impaired in Ni2+ uptake when cells were grown in complex medium containing 1% tryptically digested protein and 0.5% yeast extract. This medium has a strong metal-chelating capacity. Under these conditions, altered permeases harboring hydrophobic residues at position 62 were almost completely unable to mediate Ni2+ uptake. A hydrophilic Ser residue at this position, however, correlated with a residual activity. All Asp-67 and His-68 exchanges inactivated the permease. These results suggest that all three residues of the conserved motif participate in substrate recognition. Introduction of the mutations into A. eutrophus and measurement of the effects on Ni2+ uptake confirmed this assumption. In the presence of free Ni2+ in a mineral medium, the permeases altered at position 62 were capable of metal ion uptake. At an extremely low Ni2+ concentration or in the presence of Ni2+ complexed with nitrilotriacetate, however, transport activity was clearly reduced indicating that the nature of the side chain at position 62 is important for affinity.

Of particular importance for further investigations is the finding published by Komeda et al. (23) that the Co2+ transporter of R. rhodochrous reveals significant sequence similarity with the A. eutrophus HoxN and contains the His-Xaa4-Asp-His motif. The presence of this putative Ni2+ binding motif could explain the inhibition of Co2+ uptake by Ni2+ ion. On the other hand, previous uptake experiments (24) and the analysis of Ni2+ accumulation in the present study (data not shown) indicated that HoxN-mediated Ni2+ transport is only slightly affected in the presence of Co2+ ion. This suggests that HoxN lacks a Co2+-binding site. Although much more work remains to be done, the results presented in this report are a basis for elucidating the principles of ion recognition of metal-specific permeases.


FOOTNOTES

*   The work was supported by a grant from the Deutsche Forschungsgemeinschaft (to T. E.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§   To whom correspondence should be addressed. Tel.: 49-30-2093-8103; Fax: 49-30-2093-8102; E-mail: thomas=eitinger{at}rz.hu-berlin.de.
1   The abbreviations used are: dATPalpha S, deoxyadenosine 5'-[alpha -35S]thiotriphosphate (Sp isomer); PCR, polymerase chain reaction; bp, base pair(s); PAGE, polyacrylamide gel electrophoresis; SH, soluble hydrogenase; NTA, nitrilotriacetate.
2   O. Lenz and B. Friedrich, unpublished results.

ACKNOWLEDGEMENTS

We thank Bärbel Friedrich for generous support, Edward Schwartz and B. Friedrich for critical comments on the manuscript, and Werner Schröder for the synthesis of oligonucleotide primers. We are also indebted to Robert P. Hausinger for stimulating suggestions and to Marion Müller for skillful technical assistance.


REFERENCES

  1. Friedrich, B., and Schwartz, E. (1993) Annu. Rev. Microbiol. 47, 351-383 [CrossRef][Medline] [Order article via Infotrieve]
  2. Hausinger, R. P. (1993) Biochemistry of Nickel, pp. 181-202, Plenum Publishing Corp., New York
  3. Eitinger, T., and Friedrich, B. (1997) in Transition Metals in Microbial Metabolism (Winkelmann, G., and Carrano, C., eds), pp. 235-256, Harwood Academic Publishers, London , in press
  4. Navarro, C., Wu, L. F., and Mandrand-Berthelot, M.-A. (1993) Mol. Microbiol. 9, 1181-1191 [Medline] [Order article via Infotrieve]
  5. Eitinger, T., and Friedrich, B. (1991) J. Biol. Chem. 266, 3222-3227 [Abstract/Free Full Text]
  6. Eitinger, T., and Friedrich, B. (1994) Mol. Microbiol. 12, 1025-1032 [CrossRef][Medline] [Order article via Infotrieve]
  7. Wolfram, L., Friedrich, B., and Eitinger, T. (1995) J. Bacteriol. 177, 1840-1843 [Abstract/Free Full Text]
  8. Fu, C., Javedan, S., Moshiri, F., and Maier, R. J. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 5099-5103 [Abstract/Free Full Text]
  9. Maeda, M., Hidaka, M., Nakamura, H., Masaki, H., and Uozumi, T. (1994) J. Bacteriol. 176, 432-442 [Abstract/Free Full Text]
  10. Mobley, H. L. T., Garner, R. M., and Bauerfeind, P. (1995) Mol. Microbiol. 16, 97-109 [Medline] [Order article via Infotrieve]
  11. Manoil, C., and Beckwith, J. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 8129-8132 [Abstract/Free Full Text]
  12. Mulrooney, S. B., Pankratz, H. S., and Hausinger, R. P. (1989) J. Gen. Microbiol. 135, 1769-1776 [Medline] [Order article via Infotrieve]
  13. Simon, R., Priefer, U., and Pühler, A. (1983) Bio/Technology 1, 784-791 [CrossRef]
  14. Lenz, O., Schwartz, E., Dernedde, J., Eitinger, M., and Friedrich, B. (1994) J. Bacteriol. 176, 4385-4393 [Abstract/Free Full Text]
  15. Chen, B., and Przybyla, A. E. (1994) BioTechniques 17, 657-659 [Medline] [Order article via Infotrieve]
  16. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 551-559
  17. Bernhard, M., Schwartz, E., Rietdorf, J., and Friedrich, B. (1996) J. Bacteriol. 178, 4522-4529 [Abstract/Free Full Text]
  18. Friedrich, B., Heine, E., Finck, A., and Friedrich, C. G. (1981) J. Bacteriol. 145, 1144-1149 [Abstract/Free Full Text]
  19. Lowry, O. H., Rosebrough, N. J., Farr, A. L., and Randall, R. J. (1951) J. Biol. Chem. 193, 265-275 [Free Full Text]
  20. Laemmli, U. K. (1972) Nature 227, 680-685
  21. Jung, K., Jung, H., Wu, J., Privé, G. G., and Kaback, H. R. (1993) Biochemistry 32, 12272-12278
  22. Yan, R.-T., and Maloney, P. C. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 5973-5976 [Abstract/Free Full Text]
  23. Komeda, H., Kobayashi, M., and Shimizu, S. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 36-41 [Abstract/Free Full Text]
  24. Lohmeyer, M., and Friedrich, C. G. (1987) Arch. Microbiol. 149, 130-135 [CrossRef]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Bacteriol.Home page
D. A. Rodionov, P. Hebbeln, M. S. Gelfand, and T. Eitinger
Comparative and Functional Genomic Analysis of Prokaryotic Nickel and Cobalt Uptake Transporters: Evidence for a Novel Group of ATP-Binding Cassette Transporters
J. Bacteriol., January 1, 2006; 188(1): 317 - 327.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. K. Mandal, Y. Yang, T. M. Kertesz, and J. M. Arguello
Identification of the Transmembrane Metal Binding Site in Cu+-transporting PIB-type ATPases
J. Biol. Chem., December 24, 2004; 279(52): 54802 - 54807.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Heddle, D. J. Scott, S. Unzai, S.-Y. Park, and J. R. H. Tame
Crystal Structures of the Liganded and Unliganded Nickel-binding Protein NikA from Escherichia coli
J. Biol. Chem., December 12, 2003; 278(50): 50322 - 50329.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
Y.-Y. M. Chen and R. A. Burne
Identification and Characterization of the Nickel Uptake System for Urease Biogenesis in Streptococcus salivarius 57.I
J. Bacteriol., December 1, 2003; 185(23): 6773 - 6779.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
F. Sebbane, M.-A. Mandrand-Berthelot, and M. Simonet
Genes Encoding Specific Nickel Transport Systems Flank the Chromosomal Urease Locus of Pathogenic Yersiniae
J. Bacteriol., October 15, 2002; 184(20): 5706 - 5713.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
O. Degen and T. Eitinger
Substrate Specificity of Nickel/Cobalt Permeases: Insights from Mutants Altered in Transmembrane Domains I and II
J. Bacteriol., July 1, 2002; 184(13): 3569 - 3577.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
L. Wolfram and P. Bauerfeind
Conserved Low-Affinity Nickel-Binding Amino Acids Are Essential for the Function of the Nickel Permease NixA of Helicobacter pylori
J. Bacteriol., March 1, 2002; 184(5): 1438 - 1443.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
M. García-Domínguez, L. Lopez-Maury, F. J. Florencio, and J. C. Reyes
A Gene Cluster Involved in Metal Homeostasis in the Cyanobacterium Synechocystis sp. Strain PCC 6803
J. Bacteriol., March 15, 2000; 182(6): 1507 - 1514.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
O. Lenz and B. Friedrich
A novel multicomponent regulatory system mediates H2 sensing in Alcaligenes eutrophus
PNAS, October 13, 1998; 95(21): 12474 - 12479.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. F. Fulkerson Jr., R. M. Garner, and H. L. T. Mobley
Conserved Residues and Motifs in the NixA Protein of Helicobacter pylori Are Critical for the High Affinity Transport of Nickel Ions
J. Biol. Chem., January 2, 1998; 273(1): 235 - 241.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Eitinger, O. Degen, U. Bohnke, and M. Muller
Nic1p, a Relative of Bacterial Transition Metal Permeases in Schizosaccharomyces pombe, Provides Nickel Ion for Urease Biosynthesis
J. Biol. Chem., June 9, 2000; 275(24): 18029 - 18033.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Eitinger, T.
Right arrow Articles by Anthon, C.
Right arrow