JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, Q.
Right arrow Articles by Amster-Choder, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, Q.
Right arrow Articles by Amster-Choder, O.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 28, Issue of July 11, 1997 pp. 17263-17268
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

The Localization of the Phosphorylation Site of BglG, the Response Regulator of the Escherichia coli bgl Sensory System*

(Received for publication, February 12, 1997, and in revised form, April 22, 1997)

Qing Chen , Hanna Engelberg-Kulka and Orna Amster-Choder Dagger

From the Department of Molecular Biology, The Hebrew University-Hadassah Medical School, P. O. Box 12272, Jerusalem 91120, Israel

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENT
REFERENCES


ABSTRACT

BglG, the response regulator of the bgl sensory system, was recently shown to be phosphorylated on a histidine residue. We report here the localization of the phosphorylation site to histidine 208. Localization of the phosphorylated histidine was carried out in two steps. We first engineered BglG derivatives with a specific protease (factor Xa) cleavage site that allowed asymmetric splitting of each prephosphorylated protein to well defined peptides, of which only one was labeled by radioactive phosphate. This allowed the localization of the phosphorylation site to the last 111 residues. Subsequently, we identified the phosphorylated histidine by mutating each of the three histidines located in this region to an arginine and following the ability of the resulting mutants to be in vivo regulated and in vitro phosphorylated by BglF, the bgl system sensor. Histidine 208 was the only histidine which failed both tests. The use of simple techniques to map the phosphorylation site should make this protocol applicable for the localization of phosphorylation sites in other proteins. The bgl system represents a new family of sensory systems. Thus, the mapping reported here is an important step toward the definition of the functional domains involved in the transduction of a signal by the components that constitute systems of this novel family.


INTRODUCTION

The bgl operon in Escherichia coli, induced by environmental signal (beta -glucosides), is regulated by a novel sensory system which consists of a membrane-bound sensor, BglF, and a response regulator, BglG (1). The response regulator is an RNA-binding protein which controls operon expression by transcriptional antitermination (2). The sensor is a phosphotransferase system transport protein which controls the activity of the response regulator by reversible phosphorylation according to beta -glucoside availability (3-5). Reversible phosphorylation of the response regulator by the sensor was shown to modulate its dimeric state (6).The bgl system is not a member of the known family of two-component regulatory systems involved in signal transduction (reviewed in Refs. 7-10). The bgl proteins, BglF and BglG, share no homology with the sensors and regulators of the two-component systems, respectively. Moreover, it was recently shown that BglG, the response regulator of the bgl system, is phosphorylated on a histidine residue,1 unlike response regulators of the two-component systems which are phosphorylated on an aspartate. Hence, the bgl system represents a novel family of sensory systems. Other systems in different organisms were suggested to affiliate to this new family (11-19). To understand the rules of recognition and interaction between the components which constitute systems of the new family, it is important to define the functional domains involved in the transduction of a signal by these components. Localization and characterization of the dimerization and the phosphorylation sites on BglG is also important for the elucidation of the mechanism by which phosphorylation affects the dimeric state of a protein.

In this paper we report that identification of the phosphorylated residue on BglG, the response regulator of the bgl system, as histidine 208. Mapping of the phosphorylated histidine was carried out in two steps: the first step defined the protein region to which the phosphorylation site maps; the second step defined the specific histidine which is phosphorylated. In the first step we introduced factor Xa cleavage sites to BglG. Proteolysis after in vitro phosphorylation with radioactive phosphate allowed the localization of the phosphorylation site to the last 111 residues of the protein. In the second step we mutated the three histidines located in this region, each at a time, to arginines and followed the ability of the mutants to be in vivo regulated and in vitro phosphorylated by BglF. The ability of all the BglG mutant derivatives used in this study to fold correctly was deduced from various assays that monitored their ability to function as transcriptional antiterminators. Our protocol for the localization of the BglG phosphorylation site can be adopted and applied to localize phosphorylation sites of other proteins.


EXPERIMENTAL PROCEDURES

Strains

The following E. coli K12 strains were used: K38 (HfrC thi lambda +); AE304-7 and AE304-9, both carry a defective bglG gene and an activating mutation in bglR (20); MA152 and MA200, both carry a bgl'-lacZ fusion on their chromosome (lambda  bglR7 bglG' lacZ+ lacY+), but while the first is Delta bgl, the second is bgl+ (20). Salmonella typhimurium strain LJ144 (cpd-401, cysA1150/F'198), contains the pts operon on an E. coli plasmid, F'198, and thus produces increased levels of Enzyme I, HPr, and Enzyme IIAglc (21).

Plasmids

Plasmids pT712 and pT713, containing the phage T7 late promoter, and plasmid pGP1-2, carrying the T7 RNA polymerase gene under control of the lambda CI857 repressor, were obtained from Life Technologies, Inc. Plasmid pT7OAC-F carries the entire bglF gene cloned downstream of the T7 promoter in pT712; plasmid pT7FH-G carries the entire bglG gene cloned downstream of the T7 promoter in pT713 (3). Plasmid pMN25 carries the entire bglG gene cloned in pBR322 (20).

The following plasmids were constructed by introducing insertion or base substitution mutations (see the details of the mutagenesis below) into the bglG gene in plasmid pT7FH-G. pCQ-G1 and pCQ-G2 encode for BglG with an insertion of factor Xa cleavage site, Ile-Glu-Gly-Arg, between amino acids 113 and 114 and amino acids 167 and 168, respectively. pCQ-G4, pCQ-G5 and pCQ-G6 encode for BglG with His-208, His-219, and His-278 mutated to Arg, respectively.

Media

Enriched media, M9 salts, and M63 salts minimal media were prepared essentially as described by Miller (22). The minimal medium used for [35S]methionine labeling was the same as that used by Tabor and Richardson (23) with 0.4% succinate as the carbon source. The minimal medium used for [3H]tryptophan labeling was the same as that used for [35S]methionine labeling, except that it lacked tryptophan rather than lacking methionine and cysteine. Ampicillin (200 µg/ml) and kanamycin (30 µg/ml) were included in the media when growing strains which contain plasmids that confer resistance to either one of these antibiotics. MacConkey arbutin plates were prepared as described previously (24). MacConkey lactose plates were prepared from lactose MacConkey agar (Difco).

Chemicals

Factor Xa was obtained from New England Biolabs. [gamma -32P]ATP (3000 Ci/mmol) was obtained from Rotem Industries Ltd. (Beer-Sheva, Israel). [35S]Methionine (1200 Ci/mmol) was obtained from DuPont. [3H]Tryptophan (33 Ci/mmol) was obtained from American Radiolabeled Chemicals Inc. PEP,2 pyruvic acid, and pyruvate kinase were obtained from Sigma. [32P]PEP was prepared and separated from [32P]ATP as described before (3).

Molecular Cloning

All manipulations with recombinant DNA were carried out by standard procedures (25). Restriction enzymes and other enzymes used in recombinant DNA experiments were purchased commercially and were used according to the specifications of the manufacturers.

Site-directed Mutagenesis

Site-directed mutagenesis was carried out by overlap extension with polymerase chain reaction as described by Ho et al. (26). To mutate the bglG gene in plasmid pT7FH-G to its alleles that encode for BglG derivatives containing the factor Xa cleavage site insertion (Ile-Glu-Gly-Arg), the following primers were used: 5'ATTGAAGGGCGCCTGCTGCCCAACCC3' and 5'GGCGCCCTTCAATCACGTTTTGCTGAAAG3' to create pCQ-G1 with the insertion introduced between codons 113 and 114 of the bglG gene; 5'ATAGAGGGCCGGGGAAATATGGAGGATG3' and 5'CCGGCCCTCTATGCTCATTTGGGCACT3' to create pCQ-G2 with the insertion introduced between codons 167 and 168 of the bglG gene.

To mutate the bglG gene in plasmid pT7FH-G to its alleles that encode for BglG derivatives containing an arginine instead of a certain histidine, the following primers were used: 5'GACTGGTTACGCGTCTGAAG3' and its complement to create pCQ-G4 encoding BglG whose His-208 is replaced by Arg; 5'CGTATTCTTGAACGGGCCTCA3' and its complement to create pCQ-G5 encoding BglG whose His-219 is replaced by Arg; 5'CAAAGAACGTTAACACCTGCAG3' and its complement to create pCQ-G6 encoding BglG whose His-278 is replaced by Arg.

The mutations introduced new sites for restriction enzymes which were useful during the screening for the mutant plasmids. The mutations were confirmed by DNA sequence determinations.

Measurements of beta -Galactosidase Activity

Assays for beta -galactosidase activity were carried out as described by Miller (22). Cells were grown in minimal medium which was supplied with 0.4% succinate as a carbon source.

Preparation of Cell Extracts and Membrane Fractions

Cell extracts enriched for various BglG and membrane fractions enriched for BglF were prepared as described before (3). The proteins were expressed from their respective genes cloned under T7 promoter control in plasmids pT7FH-G, pCQ-G1, pCQ-G2, pCQ-G4, pCQ-G5, pCQ-G6, and pT7OAC-F. Expression of T7 RNA polymerase, specified by plasmid pGP1-2 which is compatible with the above plasmids, was induced thermally. The E. coli K38 strain was used as a host. A soluble fraction from S. typhimurium LJ144, which overproduces Enzyme I and HPr, was prepared as described by Begley et al. (27).

In Vitro Phosphorylation of BglG and Its Mutant Derivatives

Phosphorylation of BglF, present in membrane fractions, in the presence of [32P]PEP and an S. typhimurium LJ144 cytoplasmic fraction (used as the source of Enzyme I and HPr), was carried out as described by Amster-Choder et al. (3). Phosphorylation of the various BglG derivatives was carried out by incubating cellular extracts enriched for these proteins with mixtures containing prephosphorylated BglF, as described by Amster-Choder et al. (3).

[35S]Methionine- or [3H]Tryptophan Labeling of BglG Derivatives

Cells containing plasmids carrying different bglG alleles (encoding the various BglG derivatives) under the control of the phage T7 promoter were induced and labeled with either [35S]methionine or [3H]tryptophan in the presence of rifampicin as described by Tabor and Richardson (23). Labeling times were 2 min or 60 min when labeling with [35S]methionine or [3H]tryptophan, respectively.

Purification of Isotope-labeled BglG Derivatives and Their Proteolysis with Factor Xa

[32P]BglG was separated from [32P]BglF, a membrane protein, by centrifugation at 150,000 × g for 1 h at 4 °C. The supernatant was fractionated on 12.5% SDS-polyacrylamide gel. After electrophoresis, the wet gel was exposed to an x-ray film at 4 °C. A gel slice containing the 32P-labeled BglG band was excised, and the protein was extracted from it by incubation in factor Xa buffer (20 mM Tris-HCl, 100 mM NaCl, and 2 mM CaCl2) for 2 h at 37 °C. Purified [35S]BglG was obtained by the same procedure. To purify [3H]BglG, [35S]BglG was used as a marker for the [3H]BglG position on gel, due to the inability to detect 3H-labeled proteins after autoradiography without prior enhancement. This procedure was applied for the purification of all isotope-labeled BglG derivatives. Proteolysis with factor Xa was carried out by incubating 50-100 µg of the purified radioactively labeled proteins with 15 µg/ml factor Xa and 1.5 mg/ml bovine serum albumin in factor Xa buffer at 23 °C for 6 h. Reactions were terminated by 1% EDTA.

Electrophoresis and Autoradiography

Proteins were incubated for 30 min at 30 °C in electrophoresis sample buffer containing 62.5 mM Tris-HCl (pH 6.8), 2% SDS, 5% beta -mercaptoethanol, 10% glycerol, and 0.01% bromphenol blue. Electrophoresis of proteins was carried out on 10% SDS-polyacrylamide gels as described by Laemmli (28). Alternatively, Tricine-SDS-polyacrylamide gels with 4% stacking gel, 10% spacer gel, and 16.5% separating gel, prepared as described by Schagger and von Jagow (29), were used when indicated. Samples were fractionated alongside prestained low or mid-range protein molecular weight markers (Amersham). After electrophoresis, gels with 3H-labeled proteins were fixed by 50% methanol and 10% acetic acid for 30 min, followed by H2O wash for 30 min, and then enhanced with 0.5 M salicylic acid, 0.5 M NaOH, and 1% glycerol for 30 min (30). All gels were dried and exposed to Kodak XAR-5 x-ray film at -70 °C.


RESULTS

Localization of the Region on BglG which Contains the Phosphorylation Site

Previous studies have demonstrated the existence of two forms of BglG in vivo, phosphorylated and non-phosphorylated, implying that there is a single phosphorylated species of BglG (4). The phosphorylated residue on BglG was identified as a histidine.1 As a first step toward the localization of the phosphorylated histidine on BglG, we attempted to identify the region on BglG that contains this histidine. To do that, we took advantage of the idea that a cleavage site for a specific protease can be inserted into proteins by in vitro manipulations (31). Our plan was to engineer BglG mutants, each containing a factor Xa site located asymmetrically in the protein, to enable cleavage of the mutant proteins to two fragments of different sizes. Cleavage of these mutant BglG derivatives following their in vitro phosphorylation is expected to give only one 32P-labeled fragment in each case, due to the phosphorylation of BglG on a single residue. The ability of the engineered BglG derivatives to fold correctly, dimerize, bind RNA, and antiterminate bgl transcription can be verified by testing their ability to complement a chromosomal mutation in the bglG gene and enable beta -glucoside utilization by the mutant strains, when expressed from a plasmid.

We first introduced a factor Xa site between amino acids 113 and 114 of BglG by site-directed mutagenesis (see "Experimental Procedures") to generate MG1. As shown in the experimental design scheme, presented in Fig. 1, the site was introduced asymmetrically to enable cleavage of the mutant protein to two polypeptides, "a" and "b," consisting of 117 amino acids and 165 amino acids, respectively. Indeed, incubation of 35S-labeled MG1 with factor Xa resulted in the appearance of two labeled protein fragments with molecular masses corresponding to those expected for peptides a and b, respectively (Fig. 2, lane 2). The stronger intensity of b relative to a is due to the higher methionine content in the former. The two fragments did not appear when wild-type BglG was incubated with factor Xa (Fig. 2, lane 1). In addition, incubation of both wild-type BglG and MG1 with factor Xa resulted in nonspecific cleavage that generated slightly shortened derivatives of these proteins (Fig. 2, lanes 1 and 2). However, this did not interfere with the identification of the specific cleavage products, a and b. In vitro phosphorylation of MG1 prior to proteolysis with factor Xa resulted in the appearance of one 32P-labeled fragment, the b fragment (Fig. 2, lane 3). To indisputably identify the slower migrating fragment as polypeptide b, the C-terminal fragment, we took advantage of the fact that all tryptophans in BglG are clustered in fragment b. Thus, cleavage of BglG, which was labeled with [3H]tryptophan, by factor Xa is expected to generate only one labeled fragment, the b fragment. The results presented in Fig. 3 demonstrate that indeed [3H]tryptophan-labeled MG1 generates only one labeled fragment, the slower migrating fragment, after incubation with factor Xa (Fig. 3, lane 2). This is in contrast to the two labeled fragments produced by factor Xa proteolysis of [35S]MG1 (Fig. 3, lane 1). Thus, this experiment verifies the identification of the slower migrating fragment as polypeptide b. The results obtained with MG1 indicate that the phosphorylation site resides in the last 165 amino acids of BglG. The possibility that MG1 is misfolded and thus phosphorylated differently from wild type was ruled out by the demonstrated ability of MG1 to complement bglG strains the same as wild type (Table I).


Fig. 1. Experimental design for the definition of the region on BglG that contains the phosphorylation site. G, BglG; MG1 and MG2, BglG mutants with an internal insertion of factor Xa cleavage site; filled boxes represent the factor Xa cleavage sites; the three asterisks represent the three histidines located in the carboxyl-terminal 111 amino acids.
[View Larger Version of this Image (14K GIF file)]


Fig. 2. BglG phosphorylation site resides in its last 111 residues. The different BglG derivatives (wild type, MG1, and MG2), labeled in vivo with [35S]methionine or phosphorylated in vitro by [32P]BglF, were purified from an SDS-polyacrylamide gel and treated with factor Xa as described under "Experimental Procedures." The resulting polypeptides and the untreated purified proteins were separated on a Tricine-SDS-polyacrylamide gel. An autoradiogram of the gel is shown. The untreated [35S]MG2 and [32P]MG2 in lanes 6 and 7 are shown as representatives for the purity of all gel-purified BglG derivatives. Arrowheads indicate the positions of BglG and its mutants MG1 and MG2, as well as the proteolysis products of MG1 (a and b fragments) and MG2 (c and d fragments). Molecular masses of protein standards are given in kilodaltons.
[View Larger Version of this Image (45K GIF file)]


Fig. 3. The identification of the a and b polypeptides produced by factor Xa proteolysis of the BglG mutant MG1, as the N- and C-terminal fragments, respectively. [35S]Methionine-labeled or [3H]tryptophan-labeled MG1 were purified from an SDS-polyacrylamide gel and treated with factor Xa as described under "Experimental Procedures." The resulting peptides and untreated purified proteins were separated on a Tricine-SDS-polyacrylamide gel. An autoradiogram of the enhanced gel is shown. Lanes 1 and 2, [35S]MG1 and [3H]MG1 treated with factor Xa, respectively; lanes 3 and 4, [3H]MG1 after and before gel purification, respectively. Arrowheads indicate the positions of MG1 and its proteolysis products, fragments a and b. Molecular masses of protein standards are given in kilodaltons.
[View Larger Version of this Image (52K GIF file)]

Table I. Complementation analysis of bglG strains with plasmid-encoded BglG derivatives

Complementation was indicated by colony color on MacConkey salicin plates: +, strong complementation (bright red colonies); -, no complementation (white colonies).
Plasmida Plasmid-encoded BglG derivative Complementation of strains
AE304-7 AE304-9

pT713  -  -
pT7FH-G BglG (wild type) + +
pCQ-G1 MG1 (insertion mutant) + +
pCQ-G2 MG2 (insertion mutant) + +
pCQ-G4 MG4 (H208R) + +
pCQ-G5 MG5 (H219R) + +
pCQ-G6 MG6 (H278R) + +

a The results presented in this table are all with plasmids derived from pT713. Similar results were obtained with pBR322 plasmids containing the different derivatives of the bglG genes (wild type and the five mutants).

We next constructed MG2 that contains a factor Xa site in a position different from MG1. This was accomplished by introducing a factor Xa site between amino acids 167 and 168. Cleavage of MG2 with factor Xa is expected to generate two fragments, "c" and "d," consisting of 171 amino acids and 111 amino acids, respectively (see Fig. 1). Incubation of 35S-labeled MG2 with factor Xa resulted indeed in the appearance of two labeled fragments with molecular masses corresponding to those expected for peptides c and d (Fig. 2, lane 4). Proteolysis of in vitro phosphorylated MG2 with factor Xa yielded one 32P-labeled fragment, the d fragment (Fig. 2, lane 5). MG2, like MG1, strongly complemented bglG strains (Table I). Based on the results with MG1 and MG2, we could conclude that the phosphorylation site resides in the last 111 amino acids of BglG.

Mapping the Phosphorylated Amino Acid on BglG

We subsequently constructed three mutants of BglG, each with one of the three C-terminal histidines of BglG (His-208, His-219, and His-278, marked as asterisks in Fig. 1) mutated to an arginine, to generate MG4 (H208R), MG5 (H219R), and MG6 (H278R). These mutants were checked for their ability to complement bglG strains (Table I). The plasmid-encoded MG4, MG5, and MG6 mutants strongly complemented the chromosomal mutation in the bglG gene (the same as wild-type BglG) and enabled growth of the mutant strains on beta -glucosides. The results of this analysis suggest that these mutants can form dimers, bind to BglG target site on the RNA, and lead to antitermination of bgl transcription.

To directly demonstrate the ability of the three His to Arg mutants to antiterminate transcription, we made use of strain MA152 which is deleted for the bgl operon and carries a chromosomal bgl'-lacZ fusion (20). The lacZ gene is not expressed in this strain, because transcription terminates at the bgl terminator, located upstream of the lacZ gene. Expression of plasmid-encoded BglG renders the lacZ expression in this strain constitutive, due to this protein's ability to prevent transcription termination. The ability of plasmid-encoded MG4, MG5, and MG6 to antiterminate transcription and enable lacZ expression in MA152 was tested by observing the color of the colonies containing these plasmids on MacConkey lactose plates and by measuring the beta -galactosidase levels produced by the cells expressing them. As shown in Table II, all three mutants behaved like wild type in their ability to enable lacZ expression. These results indicate that all three mutants perform like wild type and antiterminate transcription at the bgl-lacZ fusion.

Table II. Ability of BglG mutated in either one of its last histidines to antiterminate transcription of a chromosomal bgl-lacZ fusion

The experiment was carried out in MA152 which is Delta bgl and carries a bgl-lacZ transcription fusion. The ability of the plasmid-encoded BglG derivatives to enable lacZ expression was assayed.
Plasmid Plasmid-encoded BglG derivative Phenotype on MacConkey-lactose mediuma  beta -Galactosidase activityb

units
pT713c  - 2
pMN25 BglG (wild type) + 87
pCQ-G4 MG4 (H208R) + 85
pCQ-G5 MG5 (H219R) + 153
pCQ-G6 MG6 (H278R) + 247

a Expression of the bgl-lacZ fusion was partly determined by colony color on MacConkey-lactose plates: +, red colonies; -, white colonies.
b The values represent the average of four independent measurements.
c pBR322 behaved as pT713 (not shown).

After verifying that the three His to Arg mutant proteins do not differ from wild-type BglG in their activity, we aimed at studying their ability to be phosphorylated by BglF. Phosphorylation of BglG by BglF was shown before to be the reason for the negative effect that BglF exerts on BglG activity (3). Thus, as one approach to determine which histidine on BglG is phosphorylated by BglF, we tested the effect of the three missense mutations in BglG on its ability to be negatively regulated by BglF in vivo. To address this question we made use of strain MA200 which carries the same chromosomal bgl'-lacZ fusion as MA152, but is also Bgl+ (20). Expression of lacZ in this strain is inducible, i.e. beta -galactosidase is produced only upon the relief of BglF inhibition by the addition of beta -glucosides to the growth medium. Expression of a plasmid-encoded BglG mutant that cannot be phosphorylated by BglF renders lacZ expression in this strain constitutive, i.e. independent of beta -glucoside addition. We tested the effect of plasmid-encoded MG4, MG5, and MG6 on lacZ expression in MA200 by the same methods employed to study their effect in MA152, i.e. colonies color on MacConkey lactose plates and beta -galactosidase activity measurements. The results of these tests are summarized in Table III. MG6 behaved like wild-type BglG and did not enable lacZ expression in the absence of beta -glucosides, while MG4 and MG5 led to constitutive expression of lacZ, independent of beta -glucoside addition to the medium. Hence, MG4 and MG5 are not subjected to negative regulation by BglF in vivo. This observation suggested to us that the phosphorylated residue on BglG is either His-208 (mutated in MG4) or His-219 (mutated in MG5) . 

Table III. The effect of BglF on the antitermination activity of BglG mutants

The experiment was carried out in MA200 which is Bgl+ and carries a bgl-lacZ transcriptional fusion. The effect of the chromosome-encoded BglF on the transcription antitermination activity of the plasmid-encoded BglG derivatives was assayed.
Plasmid Plasmid-encoded BglG derivative Phenotype on MacConkey-lactose mediuma
 beta -Galactosidase activityb
 -Inducer +Inducerc  -Inducer +Inducer

units
pT713d  - + 5 90
pMN25 BglG (wild type)  - + 9 80
pCQ-G4 MG4 (H208) + + 79 49
pCQ-G5 MG5 (H219R) + + 88 80
pCQ-G6 MG6 (H278R)  - + 8 66

a Phenotypes on the MacConkey-lactose plates are represented as in Table II.
b The values represent the average of four independent measurements.
c beta -Methylglucoside (10 mM) was used as the inducer.
d pBR322 behaved as pT713 (not shown).

Another approach we applied to determine which of the histidines in BglG is phosphorylated by BglF, was to test the ability of the His to Arg mutants to be phosphorylated by BglF in vitro. We have shown before that BglF, phosphorylated in vitro in the presence of [32P]PEP, Enzyme I, and HPr, can transfer a phosphoryl group to BglG (3). We added extracts of cells overproducing the different BglG derivatives, wild type and mutants, to mixtures containing prephosphorylated BglF, and further incubated them. Aliquots removed after 1, 5, and 15 min were analyzed by SDS-polyacrylamide gel electrophoresis followed by autoradiography, and the results are presented in Fig. 4. MG6, mutated in histidine 278, was phosphorylated in vitro at the same pattern as wild-type BglG (compare lanes 3-5 with lanes 12-14 in Fig. 4). No phosphorylation occurred in the case of MG4, which is mutated in histidine 208 (Fig. 4, lanes 6-8). MG5, mutated in histidine 219, was phosphorylated by BglF, albeit, at a slightly reduced rate than the wild-type protein (Fig. 4, lanes 9-11). A control with BglG incubated in a phosphorylation system lacking BglF (lanes 1 and 2) rules out the possibility of a direct phosphorylation of BglG by the phosphotransferase system general proteins. Hence, MG4 is the only His to Arg mutant that fails to be both in vivo regulated and in vitro phosphorylated by BglF. These results indicate that histidine 208 is the amino acid which is phosphorylated on BglG.


Fig. 4. Histidine 208 is the phosphorylated residue on BglG. BglF-containing membranes were labeled by incubation with [32P]PEP and a soluble fraction enriched for the phosphotransferase system general proteins for 10 min (lane 15). Extracts containing wild-type BglG (lanes 3-5) or its mutants MG4 (H208R, lanes 6-8), MG5 (H219R, lanes 9-11), and MG6 (H278R, lanes 12-14) were added, and incubation was continued for the times indicated. Lanes 1 and 2, membranes of cells not producing BglF which were labeled by incubation as above and further incubated with a wild-type BglG-containing extract. The labeled products were analyzed by SDS-polyacrylamide gel electrophoresis followed by autoradiography. Arrowheads indicate the position of BglF, Enzyme I, and the BglG derivatives (designated BglG). Molecular masses of protein standards are given in kilodaltons.
[View Larger Version of this Image (47K GIF file)]


DISCUSSION

The phosphorylated amino acid on the response regulator of the bgl system, BglG, was recently identified as a histidine residue.1 In this study we used a combination of biochemical and genetic approaches to map the phosphorylated histidine on BglG. We first defined the protein region to which the phosphorylation site maps by introducing a protease cleavage site to two locations in the protein, enabling its proteolysis to well defined fragments. Phosphorylation of a protein containing an engineered cleavage site with radioactive phosphate followed by its proteolysis results in the appearance of one radioactively labeled fragment, the one on which the phosphorylated residue resides. Hence, by constructing two mutant BglG proteins (MG1 and MG2), each containing a factor Xa cleavage site at a different location, we could locate the phosphorylated histidine to last 111 residues. This part of the protein contains three histidines, which we mutated, each at a time, to arginine, the residue which is most similar to histidine. To determine which histidine is the phosphorylated one, we followed the mutants' ability to be negatively regulated by BglF in vivo on one hand and to be phosphorylated by BglF in vitro on the other hand. A mutation in histidine 208 prevented both in vivo regulation and in vitro phosphorylation of the mutant protein by BglF. We therefore concluded that histidine 208 constitutes the phosphorylation site on BglG. A mutation in histidine 219, located near the phosphorylation site, enabled phosphorylation of the mutant protein in vitro but affected its ability to be negatively regulated in vivo. The close proximity of this mutation to the phosphorylation site seems to provide a satisfying explanation for this effect.

Ample precautions were taken to ensure that the histidine to arginine mutants are otherwise identical to the wild-type protein. These proteins were shown to strongly complement a mutation in the bglG gene and enable beta -glucoside utilization. Their transcriptional antitermination activity was also demonstrated directly by their ability to express a lacZ gene fused downstream to the bgl transcriptional terminator. As part of the precautions, this ability was assayed in two different ways. Passing all these hurdles requires that the mutant proteins fold, dimerize, bind RNA, and antiterminate transcription the same as the wild-type protein. These strict demands for the performance of the mutant proteins validate the conclusions regarding the phosphorylation behavior of these mutants.

The method used by us for the localization of the phosphorylated residue on BglG can be applied to map phosphorylation sites on other proteins. Insertion mutagenesis, to introduce a protease cleavage site, or base substitutions, to change residues which are candidates for phosphorylation sites, can be accomplished quickly and efficiently by polymerase chain reaction nowadays. In case the protein of interest is available as a purified polypeptide, mutagenesis of individual suspected residues is not required. Rather, the introduction of a proteolytic site into the protein, which enables sequencing by Edman degradation from internal positions (31), should enable the identification of the phosphorylated residue.

The bgl system represents a new family of bacterial regulatory systems involved in signal transduction (1). Transduction of a signal by this system involves reversible phosphorylation of the BglG response regulator on a histidine residue by the BglF membrane-bound sensor (3, 4).1 Other systems in various organisms were suggested to affiliate to this new family (11-19). The phosphorylation events involved in signal transmission by these systems are not well defined yet. Mapping of the phosphorylation site in BglG is an important step toward the definition and the characterization of the functional domains involved in the communication between sensors and regulators of this novel family of sensory systems. Comparison of the sequence around the BglG phosphorylation site with the respective sequences of its known homologues, e.g. SacY, SacT, and LicT in Bacillus subtilis and BglR in Lactobacillus lactis, reveals that the phosphorylated histidine in BglG, His-208, and the residues flanking it are conserved in all these proteins. It is worth mentioning that the other two histidines that we mutated in BglG, His-219 and His-278, are not conserved in these homologues.

The bgl system was the first example of a reversible phosphorylation modulating a specific and well characterized conformational change in a transcription factor, in this case a change in the oligomeric state of BglG which controls its activity. Whereas non-phosphorylated BglG is a dimer that can bind RNA and antiterminate transcription, phosphorylated BglG is an inactive monomer (6). Mapping and characterizing the nature of both the dimerization and the phosphorylation sites on BglG is important for the elucidation of the mechanism by which phosphorylation affects the dimeric state of a protein. Studies of the BglG dimerization domain are underway.

Mutant derivatives of BglG have been described that do not respond to negative regulation by BglF. These mutants, BglG33 and BglG4, led to constitutive expression of the bgl operon in vivo (20, 32) and showed little or no phosphorylation by BglF in vitro (3). The mutations have been shown to map to Asp-100 and His-160, respectively.3 The identification of histidine 208 as BglG phosphorylation site suggests that these mutations are in other sites involved in BglG-negative regulation and phosphorylation. Whether they are part of the site which is recognized by the kinase and interacts with it or they are part of a phosphorylation module composed of residues remote from each other in the primary sequence but brought to close vicinity during folding awaits future structural studies.


FOOTNOTES

*   This research was supported by the Israel Science Foundation administered by the Israel Academy of Sciences and Humanities and the Scheuer Research Foundation (to O. A.-C) and by Grant 91-00125 from the United States-Israel Binational Science Foundation (BSF), Jerusalem, Israel (to O. A.-C.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Dagger    To whom correspondence should be addressed. Tel.: 972-2-675-8460; Fax: 972-2-678-4010; E-mail: amster{at}cc.huji.ac.il.
1   O. Amster-Choder and A. Wright, submitted for publication.
2   The abbreviations used are: PEP, phosphoenolpyruvate; Tricine, N-tris(hydroxymethyl)methylglycine.
3   J. Lopilato, M. R. Diaz-Torres and A. Wright, personal communication.

ACKNOWLEDGEMENT

We thank A. Wright for the gift of AE304-7 and AE304-9 strains.


REFERENCES

  1. Amster-Choder, O., and Wright, A. (1993) J. Cell. Biochem. 51, 83-90 [CrossRef][Medline] [Order article via Infotrieve]
  2. Houman, F., Diaz-Torres, M. R., and Wright, A. (1990) Cell 62, 1153-1163 [CrossRef][Medline] [Order article via Infotrieve]
  3. Amster-Choder, O., Houman, H., and Wright, A. (1989) Cell 58, 847-855 [CrossRef][Medline] [Order article via Infotrieve]
  4. Amster-Choder, O., and Wright, A. (1990) Science 249, 540-542 [Abstract/Free Full Text]
  5. Schnetz, K., and Rak, B. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 5074-5078 [Abstract/Free Full Text]
  6. Amster-Choder, O., and Wright, A. (1992) Science 257, 1395-1398 [Abstract/Free Full Text]
  7. Bourret, R. B., Hess, J. F., Borkovich, K. A., Pakula, A. A., and Simon, M. I. (1989) J. Biol. Chem. 264, 7085-7088 [Abstract/Free Full Text]
  8. Stock, J. B., Stock, A. M., and Mottonen, J. M. (1990) Nature 334, 395-400
  9. Parkinson, J. S. (1993) Cell 73, 857-871 [CrossRef][Medline] [Order article via Infotrieve]
  10. Russo, F. D., and Silhavy, T. J. (1993) Trends Microbiol. 1, 306-310 [CrossRef][Medline] [Order article via Infotrieve]
  11. Aymerich, S., and Steinmetz, M. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 10410-10414 [Abstract/Free Full Text]
  12. Arnaud, M., Vary, P., Zagorec, M., Klier, A., Debarbouille, M., Postma, P., and Rapoport, G. (1992) J. Bacteriol. 174, 3161-3170 [Abstract/Free Full Text]
  13. Martin-Verstraete, I., Debarbouille, M., Klier, A., and Rapoport, G. (1990) J. Mol. Biol. 214, 657-671 [CrossRef][Medline] [Order article via Infotrieve]
  14. Debarbouille, M., Martin-Verstraete, I., Klier, A., and Rapoport, G. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 2212-2216 [Abstract/Free Full Text]
  15. Kruger, S., and Hecker, M. (1995) J. Bacteriol. 177, 5590-5597 [Abstract/Free Full Text]
  16. Le Coq, D., Lindner, C., Kruger, S., Steinmetz, M., and Stulke, J. (1995) J. Bacteriol. 177, 1527-1535 [Abstract/Free Full Text]
  17. Schnetz, K., Stülke, J., Gertz, S., Krüger, S., Krieg, M., Hecker, M., and Rak, B. (1996) J. Bacteriol. 178, 1971-1979 [Abstract/Free Full Text]
  18. El Hassouni, M., Henrissat, B., Chippaux, M., and Barras, F. (1992) J. Bacteriol. 174, 765-777 [Abstract/Free Full Text]
  19. Bardowski, J., S. D., Ehrlich, S. D., and Chopin, A. (1994) J. Bacteriol. 176, 5681-5685 [Abstract/Free Full Text]
  20. Mahadevan, S., Reynolds, A. E., and Wright, A. (1987) J. Bacteriol. 169, 2570-2578 [Abstract/Free Full Text]
  21. Saier, M. H., Jr., and Feucht, B. U. (1975) J. Biol. Chem. 250, 7078-7080 [Abstract/Free Full Text]
  22. Miller, J. (1972) Experiments in Molecular Genetics, Cold Spring Harbor Laboratry, Cold Spring Harbor, NY
  23. Tabor, S., and Richardson, C. C. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 1074-1078 [Abstract/Free Full Text]
  24. Schaefler, S. (1967) J. Bacteriol. 93, 254-263 [Abstract/Free Full Text]
  25. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  26. Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K., and Pease, L. R. (1989) Gene 77, 51-59 [CrossRef][Medline] [Order article via Infotrieve]
  27. Begley, G. S., Hansen, D. E., Jacobson, G. R., and Knowles, J. R. (1982) Biochemistry 21, 5552-5556 [CrossRef][Medline] [Order article via Infotrieve]
  28. Laemmli, U. K. (1970) Nature 227, 680-685 [CrossRef][Medline] [Order article via Infotrieve]
  29. Schagger, H., and von Jagow, G. (1987) Anal. Biochem. 166, 368-379 [CrossRef][Medline] [Order article via Infotrieve]
  30. Chamberlain, J. P. (1979) Anal. Biochem. 98, 132-135 [CrossRef][Medline] [Order article via Infotrieve]
  31. Benhar, I., and Engelberg-Kulka, H. (1991) Gene 103, 79-82 [CrossRef][Medline] [Order article via Infotrieve]
  32. Prasad, I., and Schaefler, S. (1974) J. Bacteriol. 120, 638-650 [Abstract/Free Full Text]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Bacteriol.Home page
G. Monderer-Rothkoff and O. Amster-Choder
Genetic Dissection of the Divergent Activities of the Multifunctional Membrane Sensor BglF
J. Bacteriol., December 1, 2007; 189(23): 8601 - 8615.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
J. Deutscher, C. Francke, and P. W. Postma
How Phosphotransferase System-Related Protein Phosphorylation Regulates Carbohydrate Metabolism in Bacteria
Microbiol. Mol. Biol. Rev., December 1, 2006; 70(4): 939 - 1031.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
L. Fux, A. Nussbaum-Shochat, L. Lopian, and O. Amster-Choder
Modulation of Monomer Conformation of the BglG Transcriptional Antiterminator from Escherichia coli
J. Bacteriol., October 15, 2004; 186(20): 6775 - 6781.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Fux, A. Nussbaum-Shochat, and O. Amster-Choder
A Fraction of the BglG Transcriptional Antiterminator from Escherichia coli Exists as a Compact Monomer
J. Biol. Chem., December 19, 2003; 278(51): 50978 - 50984.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Fux, A. Nussbaum-Shochat, and O. Amster-Choder
Interactions between the PTS Regulation domains of the BglG Transcriptional Antiterminator from Escherichia coli
J. Biol. Chem., November 21, 2003; 278(47): 46203 - 46209.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Gorke
Regulation of the Escherichia coli Antiterminator Protein BglG by Phosphorylation at Multiple Sites and Evidence for Transfer of Phosphoryl Groups between Monomers
J. Biol. Chem., November 21, 2003; 278(47): 46219 - 46229.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. Lopian, A. Nussbaum-Shochat, K. O'Day-Kerstein, A. Wright, and O. Amster-Choder
The BglF sensor recruits the BglG transcription regulator to the membrane and releases it on stimulation
PNAS, June 10, 2003; 100(12): 7099 - 7104.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
M. J. Gosalbes, C. D. Esteban, and G. Perez-Martinez
In vivo effect of mutations in the antiterminator LacT in Lactobacillus casei
Microbiology, March 1, 2002; 148(3): 695 - 702.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
Q. Chen, P. W. Postma, and O. Amster-Choder
Dephosphorylation of the Escherichia coli Transcriptional Antiterminator BglG by the Sugar Sensor BglF Is the Reversal of Its Phosphorylation
J. Bacteriol., April 1, 2000; 182(7): 2033 - 2036.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
S. A. Henstra, R. H. Duurkens, and G. T. Robillard
Multiple Phosphorylation Events Regulate the Activity of the Mannitol Transcriptional Regulator MtlR of the Bacillus stearothermophilus Phosphoenolpyruvate-dependent Mannitol Phosphotransferase System
J. Biol. Chem., March 15, 2000; 275(10): 7037 - 7044.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
C. Yanofsky
Transcription Attenuation: Once Viewed as a Novel Regulatory Strategy
J. Bacteriol., January 1, 2000; 182(1): 1 - 8.
[Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Nussbaum-Shochat and O. Amster-Choder
BglG, the transcriptional antiterminator of the bgl system, interacts with the beta ' subunit of the Escherichia coli RNA polymerase
PNAS, April 13, 1999; 96(8): 4336 - 4341.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
A. Boss, A. Nussbaum-Shochat, and O. Amster-Choder
Characterization of the Dimerization Domain in BglG, an RNA-Binding Transcriptional Antiterminator from Escherichia coli
J. Bacteriol., March 15, 1999; 181(6): 1755 - 1766.
[Abstract] [Full Text]


Home page
J. Bacteriol.Home page
S. Bachem and J. Stülke
Regulation of the Bacillus subtilis GlcT Antiterminator Protein by Components of the Phosphotransferase System
J. Bacteriol., October 15, 1998; 180(20): 5319 - 5326.
[Abstract] [Full Text]


Home page
J. Bacteriol.Home page
M. D. Manson, J. P. Armitage, J. A. Hoch, and R. M. Macnab
Bacterial Locomotion and Signal Transduction
J. Bacteriol., March 1, 1998; 180(5): 1009 - 1022.
[Full Text]


Home page
J. Bacteriol.Home page
M. Idelson and O. Amster-Choder
SacY, a Transcriptional Antiterminator from Bacillus subtilis, Is Regulated by Phosphorylation In Vivo
J. Bacteriol., February 1, 1998; 180(3): 660 - 666.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available