JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yan, C.
Right arrow Articles by Whitsett, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yan, C.
Right arrow Articles by Whitsett, J. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 28, Issue of July 11, 1997 pp. 17327-17332
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Protein Kinase A Activation of the Surfactant Protein B Gene Is Mediated by Phosphorylation of Thyroid Transcription Factor 1*

(Received for publication, December 2, 1996, and in revised form, April 24, 1997)

Cong Yan and Jeffrey A. Whitsett Dagger

From the Children's Hospital Medical Center, Divisions of Neonatology and Pulmonary Biology, The Children's Hospital Research Foundations, Cincinnati, Ohio 45229-3039

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

Thyroid transcription factor 1 (TTF-1) is a homeodomain-containing nuclear transcription factor expressed in epithelial cells of the lung and thyroid. TTF-1 binds to and activates the transcription of genes expressed selectively in the respiratory epithelium including pulmonary surfactant A, B, C and Clara cell secretory protein. Transfection with a plasmid encoding the cyclic AMP-dependent protein kinase (protein kinase A; PKA) catalytic subunit, Cat-beta , stimulated the phosphorylation of a TTF-1-flag fusion protein 6-7-fold in H441 pulmonary adenocarcinoma cells. Recombinant TTF-1 was phosphorylated by purified PKA catalytic subunit in the presence of [gamma -32P]ATP. PKA catalytic subunit family members, Cat-alpha and Cat-beta , markedly enhanced the transcriptional activation of surfactant B gene promoters by TTF-1 in vitro. Peptide mapping was used to identify a PKA phosphorylation site at the NH2 terminus of TTF-1. A 17-amino acid synthetic peptide comprising this site completely inhibited the PKA-dependent phosphorylation of TTF-1 in vitro. A substitution mutation of TTF-1 (Thr9 right-arrow Ala) abolished phosphorylation by PKA and reduced transactivation of the surfactant B gene promoter. Transfection with a plasmid encoding the cAMP regulatory element binding factor inhibited transcriptional activity of the surfactant protein B gene promoter. Phosphorylation of TTF-1 mediates PKA-dependent activation of surfactant protein B gene transcription.


INTRODUCTION

Pulmonary morphogenesis begins with the evagination of the foregut endoderm into the splanchnic mesenchyme. Thereafter, branching morphogenesis and differentiation of respiratory epithelial cells result in the generation of the conducting airways and alveolar gas exchange areas critical to perinatal adaptation to air breathing. Respiratory function depends upon surfactant lipids and proteins that are secreted into the alveolus by type II epithelial cells, reducing surface tension at the air/liquid interface and keeping the lung from collapsing at end-expiration. Various humoral factors influence the differentiation of respiratory epithelial cells and the production of surfactant proteins and lipids. Surfactant proteins A, B, and C (SP-A, SP-B, and SP-C, respectively)1 play critical roles in the organization and function of surfactant phospholipids and are expressed in a highly tissue-specific manner, their expression increasing markedly during the latter part of gestation (for review, see Ref. 1). SP-B, a 79-amino acid amphipathic peptide, plays an important role in the formation of lamellar bodies and tubular myelin and is critical to lung function after birth (2). Mice and humans with genetic defects in the SP-B gene succumb from respiratory failure in the immediate postnatal period (3, 4). In the fetal lung, SP-B synthesis increases markedly during late gestation and is induced by glucocorticoids and cAMP (5, 6).

The specificity of surfactant protein gene expression in respiratory epithelial cells is mediated at least in part by the binding of thyroid transcription factor 1 (TTF-1) to cis-acting elements in the 5'-flanking region of its target genes (7, 9). Transcription of SP-A (8), SP-B (7, 9), SP-C (10), and Clara cell secretory protein (CCSP; 7) is markedly activated by TTF-1. TTF-1 is a homeodomain-containing phosphoprotein of the Nkx family and is expressed in the developing brain, thyroid, and lung (11). TTF-1 also plays a critical role in pulmonary morphogenesis. Gene-targeted deletion of the mouse TTF-1 gene (titf1) caused severe pulmonary hypoplasia (12). TTF-1 also plays a role in gene expression in the thyroid gland, activating thyroperoxidase and thyroglobulin gene transcription (23, 24, 32). Because of the role of TTF-1 in surfactant protein gene expression and previous studies supporting the role of cyclic AMP in lung epithelial differentiation and function, the present study was designed to assess the potential interactions between cAMP-dependent pathways and the activity of TTF-1.

The action of cAMP is initiated by binding of hormones or other signaling molecules to cell surface receptors stimulating the activity of adenylyl cyclase in the plasma membrane, activating protein kinases that phosphorylate regulatory proteins, including nuclear transcription factors (13-15). A number of intracellular signaling pathways have been elucidated including protein kinase A (PKA), protein kinase C (PKC), and Ras/Raf/MEK/ERK, Rac/MEKK/SEK/JNK, JAK/STAT (for review, see Ref. 16). The potential role of these intracellular regulatory cascades in respiratory epithelial cell gene expression has not been discerned at present.

The actions of PKA on gene transcription are mediated by phosphorylation of various transcription factors including CREBs, CREM, and other CRE binding proteins (ATFs) that influence gene transcription (for review, see Refs. 14 and 17). Although cAMP is known to stimulate respiratory epithelial cell differentiation and surfactant protein expression (6), the intracellular pathways mediating the effects of cAMP or gene transcription in the lung are unknown. In the present work, the PKA catalytic subunits Cat-alpha and Cat-beta , but not CREB, strongly stimulated the human SP-B promoter in lung epithelial cells. Cat-beta phosphorylated TTF-1 and synergistically stimulated human SP-B promoter when cotransfected with TTF-1, into H441 pulmonary adenocarcinoma and HeLa cells.


MATERIALS AND METHODS

Plasmids

Human SP-B gene promoter-luciferase reporter constructs SP-B-218 and SP-B-500 were generated as described previously (18). PKA catalytic subunit expression vector Cat-alpha , Cat-beta and inactive form Cat-beta m were obtained from Dr. R. A. Maurer, Oregon Health Sciences Institute (19, 20). Rc-TTF-1 expression vector was obtained from Dr. R. Di Lauro, Stazione Zoologica Anton Dohrn, Italy. CREB expression vector was obtained from Dr. M. R. Montminy, Salk Institute, La Jolla, CA. pCR3 vector was purchased from Invitrogen (San Diego). Rc-HNF-3alpha , Rc-HNF-3beta and Rc-HFH-8 expression vectors were obtained from Dr. R. H. Costa from University of Illinois at Chicago.

The wild type TTF-1-flag expression construct (TTF-1 wt) was made as follows. Two primers were synthesized and used for polymerase chain reaction amplification using TTF-1 expression plasmid from Dr. R. Di Lauro as a template. The upstream primer (5'-GCCACCATGTCGATGAGTCCAAAGCACACGACT-3') contains a Kozak sequence for efficient translation and 21-mer matching the 5' end of TTF-1 cDNA sequence. The downstream primer (3'AACGAAATACCAGCCTGGACCCTGATGTTCCTGCTGCTACTGTTCACTATT5') contains a 21-mer matching the 3' end of TTF-1 cDNA sequence and a in-frame flag sequence (underlined sequence) before two stop codons. A mutant TTF-1-flag construct consists of a Thr9 right-arrow Ala substitution; TTF-1 Thr9 right-arrow Ala was made essentially the same except the upstream primer has the sequence 5'-GCCACCATGTCGATGAGTCCAAAGCACACGGCTCCGTTCTCAGTGTCTGAC-3' (the underlined G changes Thr to Ala). The polymerase chain reaction product of TTF-1 with the Kozak and flag sequences was subcloned directly into the pCR3 TA cloning vector (Invitrogen) to generate pCR3/TTF-1-flag expression construct. The orientation and DNA sequence of the constructs were confirmed by DNA sequencing.

TTF-1-his-tag fusion protein construct for bacterial expression was made previously (21). The TTF-1 cDNA was directionally cloned into the pET 21b bacterial expression vector (pET System, Novagen Inc., Madison, WI). BL21(DE3) Escherichia coli was transformed, and expression of recombinant TTF-1 was induced by the addition of isopropyl-1-thio-beta -D-galactopyranoside to a final concentration of 2 mM. Nickel-nitrilotriacetic acid affinity purification was performed under denaturing conditions.

Cell Culture, Transfection, and Reporter Gene Assays

H441 cell culture, DNA transfection, and luciferase assay were performed as described previously (18). Mean values and S.D. are presented except where described. Statistical differences were assessed using analysis of variance or paired t test where appropriate.

H441 Cell Radiolabeling, Immunoprecipitation, and Western Blot

H441 cells were seeded in a 25-mm flask at a density of 1 × 106 cells/flask. The next day, 2 µg of pCR3/TTF-1-flag and 2 µg of PKA catalytic subunit plasmid DNA (Cat-beta ) were added with Lipofectin and cultured overnight. The medium was then changed to RPMI with 10% fetal calf serum and the cells cultured for 2 days at 37 °C. Cells were washed once and incubated with serum-free, phosphate-free medium for 45 min. Two ml of phosphate-free medium containing 10% dialyzed calf serum (Life Technologies, Inc.) with 0.3 mCi of 32PO4/flask was then added. After a 3-h incubation, the radioactive medium was removed. Cells were rinsed and incubated for 5 min with 1 ml of cell lysis buffer (100 mM NaCl, 50 mM Tris buffer, pH 7.4, 1% Triton X-100, 0.1% sodium dodecyl sulfate, and 0.5% sodium deoxycholate) containing the phosphatase inhibitors (10 mM sodium orthovanadate and 10 mM NaF) and protease inhibitors (10 µg/ml aprotinin, 10 µg/ml leupeptin, 10 µg/ml pepstatin, and 5 mM phenylmethylsulfonyl fluoride). Lysed cells were disrupted further by aspiration through a 21-gauge needle. Supernatants were first incubated with 10 µl of mouse serum (Sigma) and 5 µl of 0.5 mg/µl of DNase I (Boehringer Mannheim) overnight at 4 °C. The next day, 30 µl of protein A/G plus-agarose (Santa Cruz Biotechnology) was added and the incubation continued for 90 min at 4 °C. Samples were centrifuged and the supernatants incubated overnight with 10 µl of flag M2 monoclonal antibody (Kodak) or 5 µl of TTF-1 monoclonal antibody at 4 °C on a rotator. The next day, 20 µl of protein A/G plus-agarose was added and the incubation continued for 90 min. The supernatant was discarded and agarose complex centrifuged, washed three times with cell lysis buffer, and washed once with buffer containing 150 mM NaCl, 50 mM Tris, pH 7.5, and 5 mM EDTA. Samples were boiled in sample loading buffer, centrifuged, and the supernatant proteins separated by sodium dodecyl sulfate-gel electrophoresis as described by Laemmli (22). The intensity of protein phosphorylation was visualized after exposure of the dried gels to x-ray film and quantitated by PhosphorImaging.

Western blot analysis of nuclear protein extracts from TTF-1 wt and TTF-1 (Thr9 right-arrow Ala) transfected H441 cells was performed using the Phast Gel system (Pharmacia Biotech Inc.).

Protein and Peptide Phosphorylation in Vitro

TTF-1-his-tag protein (1 µg), TTF-1 homeodomain polypeptide (1 µg) obtained from Dr. Di Lauro, or synthetic TTF-1 peptides (30 µg) made by Genemed Inc. (San Francisco), were incubated with 1 µl (22 units) of purified PKA catalytic subunit (Calbiochem) in the presence of 40 µCi of [gamma -32P]ATP and reaction buffer (20 µM ATP, 1 mM CaCl2, 20 mM MgCl2, 4 mM Tris, pH 7.5). After incubation at 37 °C for 30-60 min, the phosphorylated products were either separated on a 10% polyacrylamide gel (protein) followed by autoradiography or spotted on a phosphocellular disc and counted by liquid scintillation.


RESULTS

The Catalytic Subunit of PKA Activated the Human SP-B Promoter

Transcription of the human SP-B gene is conferred by cis-acting elements located -500 to +41 from the start of transcription and is dependent upon the binding of TTF-1 to distinct sites within this region (7, 9). To assess the role of cAMP-dependent protein kinases on SP-B gene transcription, plasmid expression vectors expressing two forms of PKA catalytic subunit, Cat-alpha and Cat-beta , were cotransfected into H441 cells with the SP-B promoter fragment, SP-B-500-luciferase. Cat-alpha and Cat-beta stimulated SP-B gene transcription (Fig. 1A). Activation of SP-B-500-luciferase was dose-dependent, and the inactive form of PKA catalytic subunit, Cat-beta m, had no effect on the activity of SP-B-500-luciferase. Cat-beta was consistently more active than Cat-alpha . The Cat-beta construct was therefore utilized for subsequent studies.


Fig. 1. Effects of PKA Cat-alpha , Cat-beta , and Cat-beta m on the human SP-B promoter. Panel A, transcriptional activity of SP-B-500-luciferase reporter vector was stimulated by cotransfection with PKA Cat-alpha and Cat-beta subunits but not by Cat-beta m. H441 cells (4 × 105) were transfected with plasmid DNA containing 1.6 µg of SP-B-500-luciferase reporter vector, various amounts of PKA Cat-alpha or Cat-beta or Cat-beta m expression vectors (0, 0.5, 1.6, 3.3, 5.0, and 6.6, respectively) as indicated, and varying amounts of carrier DNA to maintain constant DNA concentration. The activity of SP-B-500-luciferase in the absence of PKA catalytic subunit was defined as 1. Values are mean ± S.D., n = 3. Panel B, the SP-B-218-luciferase reporter vector, not mutant SP-B-218 TT-luciferase, was stimulated by cotransfection with active PKA catalytic subunit but not mutant form of PKA catalytic subunit. Cat-beta (PKA Cat) and Cat-beta m (PKA Cat m) were cotransfected into H441 cells as described in panel A. The activity of SP-B-218-luciferase or SP-B-218 TT-luciferase in the presence of Cat-beta m (PKA Cat m) was defined as 1. Values are mean ± S.D., n = 3.
[View Larger Version of this Image (18K GIF file)]

To define further the region of the SP-B promoter which was responsive to PKA, SP-B-218-luciferase (containing -218 to +41) was also tested. Activity of SP-B-218-luciferase was markedly stimulated by PKA Cat-beta (Fig. 1B), supporting the concept that DNA elements responding to Cat-beta resided within -218 to +41 of the human SP-B gene, a region containing cis-acting elements activated by TTF-1 (7). When the mutant SP-B-218 promoter (SP-B-218 TT; Ref. 7) lacking TTF-1 binding activity was used, no stimulation was observed by PKA Cat-beta (Fig. 1B). DNA homology search revealed no CRE consensus elements within this region of the SP-B promoter, suggesting that the stimulatory effects of PKA Cat-beta on SP-B-218-luciferase were not mediated by direct activation of CRE elements in the SP-B gene. Importantly, direct cotransfection of H441 cells with the expression plasmid RSV-CREB inhibited transcription of SP-B-500-luciferase in H441 cells (data not shown).

TTF-1 and HNF-3 Transactivated the Human SP-B Promoter

To further identify transcription factors regulating the activity of the SP-B promoter, the effects of TTF-1, HNF-3alpha , HNF-3beta , and HFH-8 expression vectors on the activity of SP-B-218-luciferase were assessed in H441 cells (Fig. 2). Cotransfection with a vector expressing TTF-1 consistently activated SP-B-218-luciferase (6-7-fold), whereas HNF-3 family members were less active in H441 cells. Stimulation of SP-B-218-luciferase by TTF-1 (~6 fold) was similar to that observed after transfection with Cat-beta (5-fold) in H441 cells. Addition of 8-bromo-cAMP to H441 cells increased SP-B-500-luciferase activity approximately 2-fold, 24 h after treatment (data not shown).


Fig. 2. Effects of TTF-1 and HNF family members on the activity of SP-B gene transcription. Activity of SP-B-218-luciferase was assessed after transfection of H441 cells with TTF-1, HNF-3alpha , HNF-3beta , and HFH-8 expression vectors. Cells were cotransfected with plasmid DNA containing 2.5 µg of SP-B-218-luciferase, various amounts of Rc-TTF-1, Rc-HNF-3alpha , Rc-HNF-3beta , or Rc-HFH-8 expression vector, and varying amounts of carrier plasmid DNA to maintain constant DNA concentration. Concentrations of plasmid DNA are presented as log scale. The activity of SP-B-218-luciferase without other activating plasmid DNA (0 µg) was defined as 1 and is not shown on a log scale. Values are the mean of two independent assays.
[View Larger Version of this Image (18K GIF file)]

PKA Catalytic Subunit-stimulated Phosphorylation of TTF-1 in H441 cells

To assess whether TTF-1 was phosphorylated by PKA catalytic subunit, a TTF-1-flag construct (pCR3/TTF-1-flag) was generated. A flag sequence (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) was inserted into the COOH terminus of the rat TTF-1 polypeptide producing a TTF-1 fusion peptide that was used to immunoprecipitate and distinguish endogenous TTF-1 from the flag-TTF-1 produced by the pCR3/TTF-1-flag construct. pCR3/TTF-1-flag transactivated SP-B-500-luciferase in H441 cells, demonstrating that the TTF-1-flag fusion peptide retained its biological activity (data not shown).

To test whether PKA increased the phosphorylation of TTF-1, pCR3/TTF-1-flag was cotransfected with either Cat-beta or Cat-beta m into H441 cells (Fig. 3). After radiolabeling with 32Pi, TTF-1 from the cell lysates was immunoprecipitated with the flag antibody. Cat-beta markedly increased the phosphorylation of TTF-1-flag, the protein migrating in approximately the same position as endogenous phosphorylated TTF-1. Cat-beta enhanced TTF-1-flag phosphorylation approximately 6-7-fold compared with Cat-beta m in H441 cells. Phospho-TTF-1-flag consisted of two bands (Mr = 40,000-43,000), supporting the concept that TTF-1 was phosphorylated at multiple sites or that multiple forms of TTF-1 were present.


Fig. 3. Phosphorylation of TTF-1-flag protein by PKA Cat-beta in cells. H441 cells were cotransfected with 2 µg of pCR3 (lanes a and b) or pCR3/TTF-1-flag (lanes c and d), and 2 µg of PKA Cat-beta (lanes a and c) or Cat-beta m (lanes b and d). After 2 days, cells were radiolabeled by 32Pi for 3 h. The cell lysates were immunoprecipitated with M2 flag monoclonal antibody (lanes a-d) or TTF-1 monoclonal antibody (positive control, lane e, see "Materials and Methods") and separated on a 15% polyacrylamide gel. The arrow indicates the phosphorylated TTF-1 bands.
[View Larger Version of this Image (33K GIF file)]

PKA Catalytic Subunit-phosphorylated TTF-1-his-tag in Vitro

Bacterial expressed TTF-1-his-tag protein was purified by Ni-column chromatography. Purified TTF-1-his-tag fusion protein and TTF-1 homeodomain polypeptide were incubated with the purified PKA catalytic subunit in the presence of [gamma -32P]ATP and separated on a 10% polyacrylamide gel. As shown in Fig. 4, PKA catalytic subunit directly phosphorylated the TTF-1 fusion protein (Fig. 4, lane c), but not the TTF-1 homeodomain polypeptide, indicating that the PKA phosphorylation site resided outside the homeodomain of TTF-1. To identify the site of PKA phosphorylation, a set of synthetic peptides comprising TTF-1 phosphorylation sites was generated.


Fig. 4. Phosphorylation of TTF-1-his-tag protein. Recombinant TTF-1-his-tag protein was purified by Ni-column chromatography. Purified TTF-1-his-tag fusion protein (1 µg, lanes a and c) and TTF-1 homeodomain (HD) polypeptide (1 µg, lanes d and f) were incubated with (lanes b, c, e, and f) or without (lanes a and d) the purified PKA catalytic subunit and [gamma -32P]ATP for 1 h at 30 °C and separated on a 10% polyacrylamide gel. The arrow indicates the phosphorylated TTF-1.
[View Larger Version of this Image (36K GIF file)]

Identification of TTF-1 Peptide Containing the PKA Phosphorylation Site

Di Lauro and colleagues identified several phosphorylation sites on TTF-1 (23). Four peptides were synthesized covering these phosphorylation sites. The peptides were incubated with the purified PKA catalytic subunit in the presence of [gamma -32P]ATP. Only peptide 1 (residues 1-17) was phosphorylated by the PKA catalytic subunit (Fig. 5A). In competition experiments, peptide 1 abolished TTF-1-his-tag protein phosphorylation by PKA (Fig. 5B, lane d). These results demonstrated that the PKA phosphorylation site was located near the NH2 terminus of TTF-1 in a region associated with transactivation activity (24).


Fig. 5. Identification of the PKA phosphorylation site on TTF-1. Panel A, peptide mapping of the PKA phosphorylation site on TTF-1. Four synthetic peptides (30 µg), comprising TTF-1 phosphorylation sites previously identified (23), and TTF-1-his-tag (positive control) were incubated with the purified PKA catalytic subunit and [gamma -32P]ATP for 45 min at 30 °C. The reaction mixtures were spotted onto the phosphocellular disc, washed, and counted by scintillation counter. Peptide 1 and TTF-1-his-tag were phosphorylated by PKA catalytic subunit. For each peptide or protein, radioactivity of phosphorylation in the absence of PKA catalytic subunit is set as 1. Values are the mean of two independent assays. Peptide 1 comprises the amino acid sequence from 1 to 17 of TTF-1; peptide 2, from 13 to 29; peptide 3, from 322 to 342; peptide 4, from 248 to 260. Panel B, inhibition of TTF-1-his-tag phosphorylation by TTF-1 synthetic peptides. Purified TTF-1-his-tag protein (1 µg) was incubated with the purified PKA catalytic subunit and gamma -32P in the absence (lane c) or presence of synthetic peptides (lanes d, e, f, and g, respectively) for 45 min at 30 °C and separated on a 10% polyacrylamide gel. Peptide 1 (lane d) inhibited the phosphorylation of TTF-1-his-tag. Lane a contains the negative control for TTF-1-his-tag fusion protein, lane b contains a control lacking the PKA catalytic subunit. The arrow indicates the phosphorylated TTF-1.
[View Larger Version of this Image (23K GIF file)]

TTF-1 (Thr9 right-arrow Ala) Mutation Blocks Phosphorylation by PKA but Not PKC

Peptide 1 contains the sequence Arg-His-Thr-Thr-Pro consistent with a consensus sequence for phosphorylation by PKA (14). A PKC consensus sequence Ser-Pro-Arg-His that shares Arg-His with the PKA site, is located immediately proximal to the NH2 terminus of the putative PKA site (Fig. 6A). A mutant peptide 1 (peptide 1m1), in which Thr9 was changed to Ala (Arg-His-Thr-Thr-Pro right-arrow Arg-His-Thr-Ala-Pro), was synthesized and tested as substrate for PKA and PKC in vitro. As shown in Fig. 6B, the phosphorylation of mutant peptide 1m1 by PKA was completely abolished, indicating that TTF-1 Thr9 is phosphorylated by PKA. Phosphorylation of the mutant peptide 1m1 by PKC was fully retained.


Fig. 6. Mutation of Thr9 to Ala inhibits phosphorylation of TTF-1. Panel A, PKA and PKC phosphorylation sites within peptide 1. Panel B, mutation (Thr9 right-arrow Ala) in peptide 1 blocked phosphorylation by PKA but not by PKC. 30 µg of peptide 1 and mutant peptide 1 (Thr9 right-arrow Ala) were incubated with purified PKA catalytic subunit or PKC and [gamma -32P]ATP for 45 min at 30 °C. The reaction mixtures were spotted on phosphocellular discs, washed, and counted. Peptide 1 was phosphorylated by both PKA catalytic subunit and PKC. On the other hand, mutant peptide 1 (peptide 1m1) was phosphorylated by PKC but not by PKA. For both peptides, phosphorylation in the absence of PKA catalytic subunit is set as 1. Values are the mean of two independent assays.
[View Larger Version of this Image (17K GIF file)]

TTF-1(Thr9 right-arrow Ala) Reduced Transactivation of the SP-B Gene Promoter

A mutant form of TTF-1 (Thr9 right-arrow Ala) was generated by mutation of the TTF-1 cDNA (see "Materials and Methods"). Whereas TTF-1 wt stimulated the activation of the SP-B promoter (SP-B-218), TTF-1 (Thr9 right-arrow Ala) was considerably less active in stimulating transcription of SP-B-218-luciferase (Fig. 7). Differences in the activity of TTF-1 wt and TTF-1 (Thr9 right-arrow Ala) were not related to differences in the level of TTF-1 peptides produced by the constructs. Western blot analysis of TTF-1 wt and TTF-1 (Thr9 right-arrow Ala)-transfected H441 cells demonstrated equal amounts of TTF-1 fusion proteins (data not shown). Immunofluorescent staining by anti-flag monoclonal antibody showed that TTF-1 wt and TTF-1 (Thr9 right-arrow Ala) were nuclear localized and strongly expressed in the transfected cells (data not shown).


Fig. 7. TTF-1 (Thr9 right-arrow Ala) inhibits the activity of the SP-B-218-luciferase reporter. H441 cells (4 × 105) were transfected with plasmid DNA containing 3.3 µg of SP-B-218-luciferase reporter vector, varying amounts of TTF-1 wt or TTF-1 (Thr9 right-arrow Ala) expression vectors (0, 1.6, 3.3, and 5.0 µg, respectively), and varying amounts of carrier DNA to maintain constant DNA concentration. The activity of SP-B-218-luciferase in the absence of the TTF-1 expression vector was defined as 1. Values are mean ± S.D., n = 3.
[View Larger Version of this Image (14K GIF file)]

TTF-1(Thr9 right-arrow Ala) Mutation Reduced PKA Catbeta -dependent Activation of the SP-B Promoter

To assess the role of phosphorylation of TTF-1 Thr9 on PKA-dependent activation of SP-B-218 promoter, the phosphorylation mutant TTF-1 (Thr9 right-arrow Ala) was transfected into H441 cells and failed to mediate Cat-beta -dependent stimulation of SP-B-218-luciferase in H441 cells (Table I).

Table I. Activity of TTF-1 (Thr9 right-arrow Ala) on PKA Cat right-arrow beta -dependent activation of the SP-B-218-luciferase reporter vector

H441 cells were transfected with plasmid DNA containing 1.6 µg of SP-B-218-luciferase reporter vector, 1.6 µg of TTF-1, and/or 1.6 µg of PKA Catbeta . n = 3. Activity is measured in light units/OD of beta -galactosidase.
Plasmids Luciferase activity ± S.D.

TTF-1 wt + PKA Cat-beta m 4,880  ± 316
TTF-1 wt + PKA Cat-beta 12,040  ± 1,550
TTF-1 (Thr9 right-arrow Ala) + PKA Cat-beta m 2,320  ± 351
TTF-1 (Thr9 right-arrow Ala) + PKA Cat-beta 3,100  ± 178


DISCUSSION

Respiratory adaptation at birth depends upon the regulated synthesis and secretion of surfactant lipids and proteins into the alveolar spaces, reducing surface tension at the air/liquid interface. The synthesis of surfactant lipids and proteins is developmentally regulated, increasing during advancing gestation and stimulated by a variety of humoral factors including glucocorticoids and cAMP. The present findings demonstrate that PKA activated both TTF-1 phosphorylation and TTF-1-dependent SP-B gene transcription, suggesting that the effects of cAMP on surfactant protein B gene expression may be mediated, at least in part, by the modulation of the activity of TTF-1 on the SP-B transcription, rather than by binding and activating CRE.

TTF-1 is expressed throughout the conducting and peripheral respiratory tract during lung development (11, 25). In human lung, after birth, TTF-1 is detected in nuclei of subsets of epithelial cells, both in the conducting airway and in type II epithelial cells (25, 26). In the lung, TTF-1 expression overlaps with that of SP-A, SP-B, SP-C, and CCSP, but its distribution is more extensive than that of the surfactant proteins or CCSP (27-29). Although TTF-1 strongly influences the transcription of each of these genes, each has a distinct temporal and spatial pattern of expression, supporting the concept the activity of TTF-1 may be further modified to confer the distinct regulatory features typical of each gene. The marked increase in surfactant protein synthesis occurring in late gestation is not directly related to changes in the level of TTF-1 mRNA (30), providing a strong inference that the activity of TTF-1 on its target genes may be further modulated. The present work supports the hypothesis that the stimulatory effects of cyclic AMP on surfactant homeostasis may be influenced, at least in part, by phosphorylation of TTF-1, which, in turn, enhances its activity on SP-B gene transcription.

Effects of cAMP on gene transcription are mediated by the activation of PKAs; subsequent protein phosphorylation may alter the activity of regulatory proteins including nuclear transcription proteins. A variety of nuclear transcription proteins are targets of PKA. Some bind to CREs that are present in target genes. Many genes that are regulated by PKA contain the CRE consensus sequence TGACGTCA (17). We were unable to identify CRE sequences fitting this consensus sequence in the 5'-flanking regions of mouse SP-A and human or mouse SP-B and SP-C genes. Likewise, expression of recombinant CREB failed to activate SP-B gene transcription from the SP-B-500-luciferase construct in H441 cells. SP-A gene expression is also enhanced by cAMP and is not mediated by CREB/ATF family members (31). In the present work, SP-B transcription was markedly stimulated by cotransfection with TTF-1, and this activity was further induced by cotransfection with Cat-alpha and -beta , suggesting that the activation by the catalytic subunit of PKA may be mediated by enhancing the activity of TTF-1 on the SP-B promoter.

TTF-1 phosphorylation was markedly stimulated by cotransfection with Cat-beta , but not by the inactive form, Cat-beta m. These findings are consistent with observations in thyroid carcinoma cells in which cAMP stimulated TTF-1 phosphorylation (32). In those studies, the binding activity of TTF-1 to the thyroglobulin promoter was enhanced by phosphorylation of TTF-1. Although a number of phosphorylation sites were identified in the TTF-1 polypeptide sequence, the phosphorylation sites involved in activation of gene transcription have not been identified, although phosphorylation of TTF-1 is not required for binding to DNA (23). In this report, peptide mapping and site-specific mutagenesis demonstrated that PKA-dependent phosphorylation of TTF-1 near the NH2 terminus (Thr9) mediates the activation of SP-B gene transcription in pulmonary adenocarcinoma cells.

cAMP influences a variety of cellular functions in the developing lung, stimulating surfactant synthesis and secretion, surfactant protein gene expression, and fluid secretion from respiratory epithelial cells. The numbers of beta -adrenergic receptors and the activity of adenylate cyclase in the lung increase dramatically during late gestation (33, 34) and are further influenced by hormonal factors that stimulate lung cell differentiation (35). In late gestation, the numbers of beta -adrenergic receptors in the lung increase in association with the increased surfactant production and secretion required for perinatal respiratory adaptation. The present findings support the concept that the effects of cAMP on distal respiratory epithelial function may be mediated, at least in part, by the activity of TTF-1, which modulates surfactant protein gene transcription. Whether other effects of cAMP on respiratory epithelial cell function in the perinatal lung are mediated by cAMP-dependent activation of TTF-1 remains to be clarified.


FOOTNOTES

*   This work was supported by American Lung Association Grant HL38859 (to C. Y.) and Center for Gene Therapy for Cystic Fibrosis and Other Lung Diseases Grant HL51832 (to J. A. W.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Dagger    To whom correspondence should be addressed: Children's Hospital Medical Center, Divisions of Neonatology and Pulmonary Biology, TCHRF, 3333 Burnet Ave., Cincinnati, OH 45229-3039. Tel.: 513-559-4830; Fax: 513-559-7868; E-mail: jeff.whitsett{at}chmcc.org.
1   The abbreviations used are: SP-A, SP-B, and SP-C, surfactant proteins A, B, and C, respectively; TTF-1, thyroid transcription factor 1; CCSP, Clara cell secretory protein; PKA, protein kinase A; PKC, protein kinase C; CRE, cAMP-responsive element; CREB, CRE-binding factor; CREM, CRE modulator; CBP, CREB-binding protein; ATF, activation transcription factor; Cat, catalytic subunit of PKA; HNF-3, hepatocyte nuclear factor 3; wt, wild type.

ACKNOWLEDGEMENTS

We thank Dr. Richard A. Maurer for PKA catalytic subunit expression vectors; Dr. Marc R. Montminy for CREB expression vectors; Dr. Roberto Di Lauro for TTF-1 expression vector; and Dr. Robert H. Costa for HNF-3alpha , HNF-3beta , and HFH-8 expression vectors. We thank Dr. Hong Du for helping with Western blot analysis, Dr. Sui Lin for helping with phosphoprotein immunoprecipitation, and Manely Ghaffari for technical support.


REFERENCES

  1. Whitsett, J. A. (1996) in The Lung: Scientific Foundations (Crystal, R. G., West, J. B., Weibel, E. R., and Barnes, P. J., eds), 2nd Ed., pp. 2167-2177, Raven Press, New York
  2. Whitsett, J. A., Nogee, L. M., Weaver, T. E., and Horowitz, A. D. (1995) Physiol. Rev. 75, 749-757 [Abstract/Free Full Text]
  3. Clark, J. C., Wert, S. E., Bachurski, C. J., Stahlman, M. T., Stripp, B. R., Weaver, T. E., and Whitsett, J. A. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 7794-7798 [Abstract/Free Full Text]
  4. Nogee, L. M., Garnier, G., Dietz, H. C., Singer, L., Murphy, A. M., DeMello, D. E., and Colten, H. R. (1994) J. Clin. Invest. 93, 1860-1863
  5. Farrell, P. M., Bourbon, J. R., Notter, R. H., Marin, L., Nogee, L. M., and Whitsett, J. A. (1990) Biochim. Biophys. Acta 1044, 84-90 [Medline] [Order article via Infotrieve]
  6. Whitsett, J. A., Weaver, T. E., Clark, J. C., Sawtell, N., Glasser, S. W., Korfhagen, T. R., and Hull, W. M. (1987) J. Biol. Chem. 262, 15618-15623 [Abstract/Free Full Text]
  7. Bohinski, R. J., Di Lauro, R., and Whitsett, J. A. (1994) Mol. Cell. Biol. 14, 5671-5681 [Abstract/Free Full Text]
  8. Bruno, M. D., Bohinski, R. J., Huelsman, K. M., Whitsett, J. A., and Korfhagen, T. R. (1995) J. Biol. Chem. 270, 6531-6536 [Abstract/Free Full Text]
  9. Yan, C., Sever, Z., and Whitsett, J. A. (1995) J. Biol. Chem. 270, 24852-24857 [Abstract/Free Full Text]
  10. Kelly, S. E., Bachurski, C. J., Burhans, M. S., and Glasser, S. W. (1996) J. Biol. Chem. 271, 6881-6888 [Abstract/Free Full Text]
  11. Lazzaro, D., Price, M., Felice, M. D., and Di Lauro, R. (1991) Development 113, 1093-1104 [Abstract]
  12. Kimura, S., Hara, Y., Pineau, T., Fernandez-Salguero, P., Fox, C. H., Ward, J. M., and Gonzalez, F. J. (1996) Genes Dev. 10, 60-69 [Abstract/Free Full Text]
  13. Taylor, S. S., Buechler, J. A., and Yonemoto, W. (1990) Annu. Rev. Biochem. 59, 971-1005 [CrossRef][Medline] [Order article via Infotrieve]
  14. Lalli, E., and Sassone-Corsi, P. (1994) J. Biol. Chem. 269, 17359-17362 [Free Full Text]
  15. Hoeffler, J. P., Meyer, T. E., Yun, Y., Jameson, J. L., and Habener, J. F. (1988) Science 242, 1430-1433 [Abstract/Free Full Text]
  16. Hill, C. S., and Treisman, R. (1995) Cell 80, 199-211 [CrossRef][Medline] [Order article via Infotrieve]
  17. Gonzalez, G. A., Yamamoto, K. K., Wolfgang, H. F., Karr, D., Menzel, P., Biggs, W., Vale, W. W., and Montminy, M. R. (1989) Nature 337, 749-752 [CrossRef][Medline] [Order article via Infotrieve]
  18. Yan, C., and Tamm, I. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 8859-8863 [Abstract/Free Full Text]
  19. Maurer, R. A. (1989) J. Biol. Chem. 264, 6870-6873 [Abstract/Free Full Text]
  20. Howard, P., Day, K. H., Kim, K. E., Richardson, J., Thomas, J., Abraham, I., Fleischmann, R. D., Gottesman, M. M., and Maurer, R. A. (1991) J. Biol. Chem. 266, 10189-10195 [Abstract/Free Full Text]
  21. Holzinger, A., Dingle, S., Bejarano, P. A., Miller, M.-A., Weaver, T. E., DiLauro, R., and Whitsett, J. A. (1996) Hybridoma 15, 49-53 [Medline] [Order article via Infotrieve]
  22. Laemmli, U. K. (1970) Nature 227, 680-685 [CrossRef][Medline] [Order article via Infotrieve]
  23. Zannini, M., Acebron, A., De Felice, M., Arnone, M. I., Martin-Perez, J., Santisteban, P., and Di Lauro, R. (1996) J. Biol. Chem. 271, 2249-2254 [Abstract/Free Full Text]
  24. De Felice, M., Damante, G., Zannini, M., Francis-Lang, H., and Di Lauro, R. (1995) J. Biol. Chem. 270, 26649-26656 [Abstract/Free Full Text]
  25. Ikeda, K., Clark, J. C., Shaw-White, J. R., Stahlman, M. T., Boutell, C. J., and Whitsett, J. A. (1995) J. Biol. Chem. 270, 8108-8114 [Abstract/Free Full Text]
  26. Stahlman, M. T., Gray, M. E., and Whitsett, J. A. (1996) J. Histochem. Cytochem. 44, 673-678 [Abstract]
  27. Khoor, A., Gray, M. E., Hull, W. M., Whitsett, J. A., and Stahlman, M. T. (1993) J. Histochem. Cytochem. 41, 1311-1319 [Abstract]
  28. Khoor, A., Stahlman, M. T., Gray, M. E., and Whitsett, J. A. (1994) J. Histochem. Cytochem. 42, 1187-1199 [Abstract]
  29. Singh, G., Singh, J., Katyal, S. J., Brown, W. E., MacPherson, J. A., and Squeglia, N. (1988) J. Histochem. Cytochem. 36, 73-78 [Abstract]
  30. Zhou, L., Lim, L., Costa, R. H., and Whitsett, J. A. (1996) J. Histochem. Cytochem. 44, 1183-1193 [Abstract]
  31. Michael, L. F., Alcorn, J. L., Gao, E., and Mendelson, C. R. (1996) Mol. Endocrinol. 10, 159-170 [Abstract]
  32. Francis-Lang, H., Zannini, M., Felice, M. D., Berlingieri, M. T., Fusco, A., and Di Lauro, R. (1992) Mol. Cell. Biol. 12, 5793-5800 [Abstract/Free Full Text]
  33. Whitsett, J. A., and Weaver, T. E. (1991) in Pulmonary Surfactant: Biochemical, Functional, Regulatory, and Clinical Concepts (Bourbon, J. R., ed), pp. 77-104, CRC Press, Inc., Boca Raton, FL
  34. Whitsett, J. A. (1991) in Basic Mechanisms of Pediatric Respiratory Disease: Cellular and Integrative (Chernick, V. C., and Mellins, R. B., eds), pp. 303-314, B. C. Decker, Inc., Philadelphia
  35. Whitsett, J. A., and Korfhagen, T. R. (1995) New Insights Cystic Fibrosis 3, 1-5

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Physiol. Rev.Home page
Y. Maeda, V. Dave, and J. A. Whitsett
Transcriptional Control of Lung Morphogenesis
Physiol Rev, January 1, 2007; 87(1): 219 - 244.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
A. Das and V. Boggaram
Proteasome dysfunction inhibits surfactant protein gene expression in lung epithelial cells: mechanism of inhibition of SP-B gene expression
Am J Physiol Lung Cell Mol Physiol, January 1, 2007; 292(1): L74 - L84.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Xu, J. Tian, S. M. Grumelli, K. J. Haley, and S. D. Shapiro
Stage-specific Effects of cAMP Signaling during Distal Lung Epithelial Development
J. Biol. Chem., December 15, 2006; 281(50): 38894 - 38904.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. N. Islam and C. R. Mendelson
Permissive Effects of Oxygen on Cyclic AMP and Interleukin-1 Stimulation of Surfactant Protein A Gene Expression Are Mediated by Epigenetic Mechanisms
Mol. Cell. Biol., April 15, 2006; 26(8): 2901 - 2912.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
L. Sparkman, H. Chandru, and V. Boggaram
Ceramide decreases surfactant protein B gene expression via downregulation of TTF-1 DNA binding activity
Am J Physiol Lung Cell Mol Physiol, February 1, 2006; 290(2): L351 - L358.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Dentice, C. Luongo, A. Elefante, R. Ambrosio, S. Salzano, M. Zannini, R. Nitsch, R. Di Lauro, G. Rossi, G. Fenzi, et al.
Pendrin Is a Novel In Vivo Downstream Target Gene of the TTF-1/Nkx-2.1 Homeodomain Transcription Factor in Differentiated Thyroid Cells
Mol. Cell. Biol., November 15, 2005; 25(22): 10171 - 10182.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Srisodsai, R. Kurotani, Y. Chiba, F. Sheikh, H. A. Young, R. P. Donnelly, and S. Kimura
Interleukin-10 Induces Uteroglobin-related Protein (UGRP) 1 Gene Expression in Lung Epithelial Cells through Homeodomain Transcription Factor T/EBP/NKX2.1
J. Biol. Chem., December 24, 2004; 279(52): 54358 - 54368.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K.-S. Park, J. A. Whitsett, T. Di Palma, J.-H. Hong, M. B. Yaffe, and M. Zannini
TAZ Interacts with TTF-1 and Regulates Expression of Surfactant Protein-C
J. Biol. Chem., April 23, 2004; 279(17): 17384 - 17390.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. L. Alcorn, K. N. Islam, P. P. Young, and C. R. Mendelson
Glucocorticoid inhibition of SP-A gene expression in lung type II cells is mediated via the TTF-1-binding element
Am J Physiol Lung Cell Mol Physiol, April 1, 2004; 286(4): L767 - L776.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. deFelice, D. Silberschmidt, R. DiLauro, Y. Xu, S. E. Wert, T. E. Weaver, C. J. Bachurski, J. C. Clark, and J. A. Whitsett
TTF-1 Phosphorylation Is Required for Peripheral Lung Morphogenesis, Perinatal Survival, and Tissue-specific Gene Expression
J. Biol. Chem., September 12, 2003; 278(37): 35574 - 35583.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
M-C.W. Yang, B. Wang, J.C. Weissler, L.R. Margraf, and Y-S. Yang
BR22, a 26 kDa thyroid transcription factor-1 associated protein (TAP26), is expressed in human lung cells
Eur. Respir. J., July 1, 2003; 22(1): 28 - 34.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Li, N.-L. Zhu, R. C. Tan, P. L. Ballard, R. Derynck, and P. Minoo
Transforming Growth Factor-beta Inhibits Pulmonary Surfactant Protein B Gene Transcription through SMAD3 Interactions with NKX2.1 and HNF-3 Transcription Factors
J. Biol. Chem., October 4, 2002; 277(41): 38399 - 38408.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. P. Gelmann, D. J. Steadman, J. Ma, N. Ahronovitz, H. J. Voeller, S. Swope, M. Abbaszadegan, K. M. Brown, K. Strand, R. B. Hayes, et al.
Occurrence of NKX3.1 C154T Polymorphism in Men with and without Prostate Cancer and Studies of Its Effect on Protein Function
Cancer Res., May 1, 2002; 62(9): 2654 - 2659.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Yan, A. Naltner, M. Martin, M. Naltner, J. M. Fangman, and O. Gurel
Transcriptional Stimulation of the Surfactant Protein B Gene by STAT3 in Respiratory Epithelial Cells
J. Biol. Chem., March 22, 2002; 277(13): 10967 - 10972.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Liu, S. W. Glasser, H. Wan, and J. A. Whitsett
GATA-6 and Thyroid Transcription Factor-1 Directly Interact and Regulate Surfactant Protein-C Gene Expression
J. Biol. Chem., February 1, 2002; 277(6): 4519 - 4525.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
Y.-S. Yang, M.-C. W. Yang, B. Wang, and J. C. Weissler
BR22, a Novel Protein, Interacts with Thyroid Transcription Factor-1 and Activates the Human Surfactant Protein B Promoter
Am. J. Respir. Cell Mol. Biol., January 1, 2001; 24(1): 30 - 37.
[Abstract] [Full Text]


Home page
Cell Growth Differ.Home page
A. Feliciello, G. Allevato, A. M. Musti, D. De Brasi, A. Gallo, V. E. Avvedimento, and M. E. Gottesman
Thyroid Transcription Factor 1 Phosphorylation Is Not Required for Protein Kinase A-dependent Transcription of the Thyroglobulin Promoter
Cell Growth Differ., December 1, 2000; 11(12): 649 - 654.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
K. Berhane, R. K. Margana, and V. Boggaram
Characterization of rabbit SP-B promoter region responsive to downregulation by tumor necrosis factor-alpha
Am J Physiol Lung Cell Mol Physiol, November 1, 2000; 279(5): L806 - L814.
[Abstract] [Full Text] [PDF]


Home page<