Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsuguchi, T.
Right arrow Articles by Kraft, A. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsuguchi, T.
Right arrow Articles by Kraft, A. S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 28, Issue of July 11, 1997 pp. 17450-17459
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

The Cytoplasmic Domain of Granulocyte-Macrophage Colony-stimulating Factor (GM-CSF) Receptor alpha  Subunit Is Essential for Both GM-CSF-mediated Growth and Differentiation*

(Received for publication, January 28, 1997, and in revised form, May 19, 1997)

Tetsuya Matsuguchi Dagger §, Yanming Zhao , Michael B. Lilly par and Andrew S. Kraft Dagger **

From the Dagger  Division of Medical Oncology, University of Colorado Health Science Center, Denver, Colorado 80262, the  Department of Biochemistry, University of Kentucky, Lexington, Kentucky 40536-0084, and the par  Division of Medical Oncology, University of Washington and Veterans Administration Medical Center, Seattle, Washington 98108

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES


ABSTRACT

Granulocyte-macrophage colony-stimulating factor (GM-CSF) regulates differentiation, survival, and proliferation of colony-forming unit-granulocyte-macrophage progenitor cells. The biologic actions of GM-CSF are mediated by binding to a specific receptor consisting of two chains designated as alpha  and beta  subunits. We have demonstrated that the murine FDC-P1-derived cell line WT-19 transfected with the human GM-CSF receptor alpha  and beta  subunits (GM-CSFRalpha and beta ) can be induced to differentiate by the addition of human GM-CSF (hGM-CSF). By expressing a series of GM-CSFRalpha mutants in WT19 cells, we have determined the amino acid domains of the GM-CSFRalpha cytoplasmic domain that regulate cell differentiation, proliferation, and survival. We found that the membrane proximal proline-rich domain and adjacent 16 residues are essential for both hGM-CSF-dependent cell proliferation and differentiation. In contrast, the C-terminal region of the GM-CSFRalpha cytoplasmic domain was not necessary for cell differentiation mediated by hGM-CSF, but the removal of this region severely impaired the ability of hGM-CSF to support cell survival. While the activation of JAK2, Shc, Erk, and STAT5 proteins correlated with hGM-CSF-mediated cell growth, cellular differentiation occurred in the absence of activation of these signal transduction pathways.


INTRODUCTION

Granulocyte-macrophage colony-stimulating factor (GM-CSF)1 is a 22-kDa glycoprotein, which is secreted by activated T cells, endothelial cells, fibroblasts, mast cells, B cells, and macrophages (1-4). GM-CSF plays an important role in promoting differentiation, survival, and proliferation of colony-forming unit-granulocyte-macrophage progenitor cells as well as enhancing the function of mature neutrophils, monocytes, and eosinophils (5, 6) and stimulating burst promoting activity for burst-forming units, erythroid (7, 8). GM-CSF causes a major cytoskeletal reorganization in plasma cells and hairy cells, resulting in the inhibition of motility and loss of adhesion to cellular and matrix ligands (9).

The biologic actions of GM-CSF are mediated by binding to a specific receptor consisting of alpha  and beta  subunits, both of which are members of the type-I cytokine receptor family (10, 11). The alpha  subunit binds GM-CSF with low affinity (10). A soluble form of human GM-CSF receptor alpha  subunit (GM-CSFRalpha ) has also been identified, whose function in vivo is unclear (12, 13). While the beta  subunit does not bind GM-CSF by itself, it forms a high affinity receptor in combination with the alpha  subunit (11). The beta  chain is called the common beta  chain (beta c) because it is shared by interleukin 3 (IL3) and interleukin 5 (IL5) receptors (14, 15). Although the cytoplasmic domain of GM-CSFRalpha is only 54 amino acids, we and others have demonstrated that the GM-CSFRalpha cytoplasmic domain is necessary for GM-CSF-induced cell proliferation (16-18). Several studies showed that the cytoplasmic domain of the human GM-CSF receptor beta  chain (GM-CSFRbeta ) is also essential for the mitogenic signal (18, 19). However, because of the lack of adequate biologic model cell systems, the role of GM-CSFR alpha  and beta  subunits in GM-CSF-induced cell differentiation has not been clearly demonstrated.

The present study defines the role of GM-CSFRalpha in GM-CSF-mediated differentiation by studying WT19 cells, an FDC-P1-derived cell line that uniformly differentiates toward the monocytic lineage in response to murine GM-CSF (mGM-CSF), but grows and does not differentiate in the presence of murine IL3 (mIL3) (20, 21). We find that when the wild type human GM-CSFR alpha  and beta  subunits are both transfected into WT19 cells, these cells respond to the addition of human GM-CSF (hGM-CSF) by undergoing differentiation. To identify the residues of GM-CSFRalpha cytoplasmic domain necessary for the induction of cell differentiation, WT19 cell lines were established which express mutated cytoplasmic domains of the alpha subunit along with the wild type beta  subunit. The ability of GM-CSF to support cell survival of WT19 correlated with the tyrosine phosphorylation of Jak2, STAT5, Shc, and extracellular signal-regulated kinases (ERKs). However, the induction of differentiation in the cells containing the 18-amino acid deletion of the C-terminal region occurred without the detectable tyrosine phosphorylation of these four signaling molecules. Our results suggest that cell survival and differentiation are controlled by different signal transduction pathways regulated by varying portions of the GM-CSFRalpha .


EXPERIMENTAL PROCEDURES

Cells and Cell Culture

WT19 is a cell line established from a mouse factor-dependent myeloid cell line, FDC-P1 (a generous gift from Dr. Larry Rohrschneider, Fred Hutchinson Cancer Research Center, Seattle, WA). The cell line was cultured in RPMI 1640 medium (Life Technologies, Inc.) supplemented with 10% fetal bovine serum (FBS), and 10% WEHI-3B conditioned medium containing mIL3.

Reagents

Recombinant hGM-CSF was purchased from Immunex Corp. (Seattle, WA). Recombinant mGM-CSF and mIL3 were obtained from Genzyme (Cambridge, MA).

Site-directed Mutagenesis and Construction of Expression Plasmids

The human GM-CSFRbeta cDNA was removed from the plasmid pKH97 (a gift from Dr. A. Miyajima, DNAX Research Institute, Palo Alto, CA), and the 2.9-kilobase pair fragment was ligated into pCEP4 (Invitrogen), which contains a hygromycin selection marker giving the plasmid pCEP4-GM-CSFRbeta .

The 1.3-kilobase pair human GM-CSF receptor alpha  chain cDNA was removed from pCDM8 vector (12) and ligated into the pcDNA3 vector (Invitrogen) giving the plasmid pCMV-GM-CSFRalpha .

To construct GM-CSFRalpha mutants, GM-CSFRalpha cDNA was cloned into M13 mp19. Site-directed mutagenesis was carried out using a kit from Amersham, using oligonucleotides: GGGAACAGCCGTCATCACCTAAGGAAC (ter1), CTTTCCCTTCTCATCAGGTGAATTCCTC (ter3), CCTCATGGTTATCCCTAAGGAACCTT (del1), TCCCTTCCTCTGGATTCAGTTTGTCT (del2), GTCTTTGATCTGTATCCTAAGGAACC (del3), TGGAACTGGACCGAACAGC (P357G), TCTGTTCGTCAGTGTGAAGATCAGAGC (P358G), CTTTGATCTGACCAACTGGCGG (P360G). The mutated cDNAs were isolated and ligated into pcDNA3 vector. The structure of the constructs was confirmed by restriction enzyme mapping and DNA sequence analysis.

Isolations of WT19 Transfectants

pCEP4-GM-CSFRbeta was introduced into WT19 cells by electroporation at 260 V, 975 microfarads using a Bio-Rad Gene Pulser, and transfectants isolated using hygromycin (0.4 mg/ml). A clone termed WT19 beta 1 expressing GM-CSFRbeta was used for the transfection of pCMV-GM-CSFRalpha wild-type or mutant subunits. Resistant clones containing the alpha  subunit were then isolated using G418 selection (0.4 mg/ml). Resulting clones were screened by flow cytometry using anti-human GM-CSFRalpha monoclonal antibody, and three to five positive clones from each construct were expanded for further studies.

MTS Cell Proliferation Assay

5,000 cells were incubated in 100 µl of RPMI 1640 containing 10% FBS and various concentrations of hGM-CSF for 14 h at 37 °C in a humidified 5% CO2 atmosphere. 20 µl of freshly prepared combined 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt/phenazine methosulfate (MTS/PMS) solution (Promega, Madison, WI) was added to each sample. After an additional 4 h of incubation at 37 °C, the conversion of MTS into the aqueous soluble formazan was measured at an absorbance of 490 nm.

Antibodies

Polyclonal anti-human GM-CSFRbeta anti-sera were prepared using a glutathione S-transferase fusion protein containing amino acids 47-93 of GM-CSFRbeta (16). The anti-phosphotyrosine monoclonal antibody (4G10) was purchased from Upstate Biotechnology Inc. (Lake Placid, NY). The anti-Shc polyclonal antibody and the anti-STAT1 polyclonal antibody were obtained from Signal Transduction Laboratories (Lexington, KY). The anti-STAT3 and STAT5 polyclonal antibodies were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). The STAT5 antibody (sc-835) is specific for both STAT5a and STAT5b. The anti-human GM-CSFRalpha monoclonal antibody was a generous gift from Dr. A. F. Lopez (Instiute of Medical and Veterinary Science, Adelaide, Australia). The anti-Mac1 and Mac3 rat monoclonal antibodies were purchased from PharMingen (San Diego, CA). The anti-F4/80 rat monoclonal antibody was purified from the culture supernatant of HB198 rat hybridoma cell line obtained from ATCC.

Immunoblotting

Cells were lysed in PLC buffer (50 mM HEPES, pH 7.0, 150 mM NaCl, 10% glycerol, 1% Triton X-100, 1.5 mM MgCl2, 1 mM EGTA, 100 mM NaF, 10 mM NaPPi, 1 mM Na3VO4, 1 mM phenylmethanesulfonyl fluoride, 10 mg/ml aprotinin, 10 mg/ml leupeptin) at 108 cells/ml. The lysates were separated on SDS-polyacrylamide gels, electrotransferred to Immobilon polyvinylidene difluoride membranes (Millipore). The membranes were blocked for 2 h in 2% bovine serum albumin-TBST (20 mM Tris-HCl, pH 7.6, 0.15 M sodium chloride, 0.1% Tween 20), incubated with primary antibodies in TBST for 1 h, washed three times with TBST, and incubated for 1 h with horseradish peroxidase-conjugated anti-mouse or rabbit immunoglobulin (Amersham) diluted 1:10,000 in TBST. After three washes in TBST, the blot was developed with the enhanced chemiluminescence system (Amersham) according to the manufacturer's instructions.

Immunoprecipitation

The cell lysates were incubated with the indicated antibody for 2 h at 4 °C, followed by protein A-Sepharose beads (Pharmacia Biotech Inc.) for an additional 1 h. The beads were washed three times in PLC lysis buffer, and then suspended in SDS-sample buffer, heated at 95 °C for 5 min. The eluted proteins were applied to an SDS-polyacrylamide gel and proteins detected by Western blotting.

Northern Blot Analysis

Total cellular RNAs were extracted using Trizol reagent (Life Technologies, Inc.) according to the manufacturer's instructions. 15-µg aliquots of the total RNAs were fractioned on 1% agarose gel containing 20 mM MOPS, 5 mM sodium acetate, 1 mM EDTA, pH 7.0, and 6% (v/v) formaldehyde, and transferred to a nylon membrane. After UV-cross-linking, membranes were soaked in prehybridization solution (6 × SSC, 5 × Denhardt's reagent, 0.5% SDS, 100 mg/ml denatured salmon sperm DNA, and 50% formamide) for 3 h at 42 °C followed by incubation with 32P-labeled probe in hybridization solution (6 × SSC, 0.5% SDS, 100 mg/ml denatured salmon sperm DNA, and 50% formamide) for 14 h at 42 °C. The membranes were washed in 2 × SSC, 0.1% SDS for 10 min twice at room temperature; in 0.1 × SSC, 0.1% SDS for 10 min twice at 50 °C; and then exposed to Kodak XAR films.

hGM-CSF Binding Assay

hGM-CSF binding assay was performed as described previously (22). Briefly, cells were incubated in RPMI 1640, 10% FCS, 20 mM Hepes for 4 h at 37 °C, and incubated in binding buffer (RPMI 1640 + 2% bovine serum albumin, 20 mM Hepes) containing varying concentrations of 125I-hGM-CSF (NEN Life Science Products) for 30 min at 37 °C. To measure nonspecific binding, 100-fold excess of cold hGM-CSF was added. The cells were centrifuged through a phthalate oil layer (3:2, dioctyl phthalate/di-n-butyl phthalate). The radioactivity of the cell pellet was counted in a gamma  counter. The binding data were subjected to Scatchard analysis.

DNA Fragmentation Analysis

Before lysis, cells were incubated for the indicated time periods in medium supplemented with hGM-CSF (10 ng/ml) followed by a wash in PBS. The cells were then incubated in cell lysis buffer (10 mM EDTA, 50 mM Tris-HCl, pH 8, 0.5% SDS, 0.5 mg/ml Proteinase K) for 14 h at 50 °C. After an additional 3-h incubation with the addition of 0.25 mg/ml RNase, the genomic DNA was extracted with phenol-chloroform and precipitated with ethanol. DNA fragments were visualized after 1.8% agarose gel electrophoresis by ethidium bromide staining.


RESULTS

mGM-CSF Induces Rapid Monocytic Differentiation of WT19 Cells Which Is Reversible after Removal of the Factor

WT19 cells (20) growing in mIL-3 demonstrated a myeloblastic morphology including rounded nuclei, fine chromatin, and thin and basophilic cytoplasm. In response to mGM-CSF, the cells demonstrated monocytic characteristics: an indented nucleus with fine-stranded appearance, increased cytoplasm containing a variable number of vacuoles, and larger total cell size. Cells treated with mGM-CSF also became positive for nonspecific esterase and acid phosphatase (Table I). To quantitate the number of cells undergoing differentiation after the addition of mGM-CSF or mIL3, surface marker changes were evaluated by FACS analysis. WT19 cells growing in mIL3 showed weak surface expression of F4/80 and Mac3 (Fig. 1A), both of which are monocytic specific markers (23-25). When the WT19 cells were incubated with mGM-CSF, the expression of both these markers was significantly increased, suggesting that the cells differentiated toward monocytic lineage (Fig. 1A). As demonstrated by FACS analysis, cell size and granularity also increased as evidenced by an increase in both forward scattergram (FSC) and side scattergram (SSC) (Fig. 1A). These characteristics were stable for at least 14 days (Fig. 1A). Differentiated cells continued to divide, and the cell number increased. Increases in both F4/80 expression and cell granularity were evident within 1-2 days after the addition of mGM-CSF (Fig. 1B). Washing out the mGM-CSF and replacing it with mIL3 caused the F4/80 expression to decrease to background levels within 3 days (Fig. 1C), suggesting that mGM-CSF-induced monocyte/macrophage differentiation of WT19 cells is a reversible phenomenon. In addition, mGM-CSF induced cell differentiation of WT19 in the presence of mIL3, suggesting mGM-CSF-mediated differentiation signal is dominant over mIL3 (data not shown).

Table I. Differentiation markers of WT19 cells after mIL3 and mGM-CSF stimulation


Morphology
Surface markers
Staining
Cell size Granularity F4/80 Mac1 Mac3 Nonspecific esterase Specific esterase Acid phosphatase

IL3 + + +  - +  -  -  -
GM-CSF ++ +++ +++  - +++ +  - +


Fig. 1. mGM-CSF induced rapid, reversible monocytic differentiation of WT19 cells. A and B, WT19 cells were washed with factor-free medium and then were placed in medium containing either 10 ng/ml mIL3 or mGM-CSF. Forward (FSC) and side scatter (SSC) parameters of the cells were examined by flow cytometry. The cell surface expression of monocyte specific F4/80 and Mac3 was examined by flow cytometry after staining with the appropriate monoclonal and fluorescein isothiocyanate (FITC)-labeled secondary antibodies. The control WT19 cells were stained with the secondary antibody alone. C, WT19 cells maintained in medium containing 10 ng/ml mGM-CSF were washed in factor-free medium and switched to medium containing mIL3 for the indicated number of days. F4/80 expression was analyzed by FACS analysis.
[View Larger Version of this Image (23K GIF file)]

hGM-CSF-induced Differentiation of WT19 Cells Transfected with Human GM-CSF Receptors

To examine the ability of hGM-CSF to mediate the differentiation of WT19 cells, cells were transfected with an expression plasmid encoding human GM-CSFR beta  subunit containing a hygromycin resistance selectable marker. A clone expressing high levels of GM-CSFR beta , WT19 beta  clone 1, was then transfected with the G418-selectable expression plasmid encoding GM-CSFRalpha wild type subunit, and the cells were further selected in G418. Treatment of these doubly transfected cells with hGM-CSF induced differentiation of WT19 cells as measured by changes in F4/80 and Mac3 surface markers (Fig. 2). This hGM-CSF-induce differentiation was also found to be reversible upon removal of human hGM-CSF (data not shown).


Fig. 2. Surface expression of monocyte-specific antigens in WT19 clones treated with hGM-CSF. WT19 clones were maintained in mIL3 alone or mIL3 + 10 ng/ml hGM-CSF for 3 days. The cell surface expression of monocytic-specific F4/80 (A) and Mac3 (B) were analyzed by flow cytometry after staining with the respective monoclonal antibodies and FITC-labeled secondary antibodies.
[View Larger Version of this Image (36K GIF file)]

Expression of Human GM-CSFRalpha Mutants in WT19 Cells

We have demonstrated that the cytoplasmic domain of the alpha  subunit regulates growth of factor-dependent hematopoietic cells (16, 17). Specific residues of the alpha  subunit are highly conserved among growth factor receptors (Fig. 3B). As hGM-CSF is capable of inducing the differentiation of WT19 cells, it is possible to evaluate the role of the cytoplasmic domain in GM-CSF-mediated cell growth, survival, and differentiation. A series of expression plasmids encoding deletion and substitution mutants of GM-CSFRalpha (Fig. 3A) were created; ter1 mutant lacks the entire cytoplasmic domain except for the membrane-proximal 5 amino acids; del1 has an internal deletion of 15 amino acid residues corresponding to the proline-rich box 1 region, which is well conserved among the type I cytokine receptor family; del2 has an internal 16-amino acid deletion adjacent to the box 1 region; del3 has an 8-amino acid deletion within the box 1 region removing the proline-rich domain (PPVP) (Fig. 3B); ter3 has a deletion of the C-terminal 18 amino acid residues; and three individual amino acid substitutions have mutations in the well conserved proline-rich domain: proline 357, 358, or 360 (Fig. 3A).


Fig. 3. GM-CSFRalpha cytoplasmic domain mutants. A, deleted amino acid residues are indicated as dashes. Amino acid substitutions are indicated by underlines and boldface type. B, comparison of the amino acid sequences conserved among the cytokine receptor family. The proline-rich regions of various cytokine receptor cytoplasmic domains are shown. Conserved prolines are boxed.
[View Larger Version of this Image (49K GIF file)]

These GM-CSFRalpha expression plasmids were transfected into WT19 beta  clone 1, and the G418-resistant clones were isolated. The levels of expression of these mutants were analyzed by staining with a specific anti-GM-CSFRalpha monoclonal antibody followed by flow cytometric analysis with a FACScan (Fig. 4). All these mutants were confirmed to express beta c equally well by immunoblotting using specific anti-GM-CSFRbeta antibody (data not shown). Each transfectant was examined for hGM-CSF binding using 125I-labeled hGM-CSF, and the results of high affinity binding profiles were shown in Table II. All mutant transfectants including ter1 clones bind hGM-CSF with high affinity and Kd values suggesting that there are equivalent numbers of receptors with similar affinity. These results suggested that the mutations introduced in the cytoplasmic domain of GM-CSFRalpha did not affect the interactions of GM-CSFRalpha with the ligand or GM-CSFRbeta .


Fig. 4. Flow cytometric analysis of GM-CSFRalpha expression on WT19 transfectants. Cells were stained with either anti-GM-CSFRalpha monoclonal antibody followed by FITC-conjugated goat anti-mouse IgG or with FITC-conjugated anti-mouse IgG alone.
[View Larger Version of this Image (29K GIF file)]

Table II. Binding profiles of GM-CSF on WT19 transfectants

Two to four clones were analyzed for each mutant. Mean Kd value is shown.
High affinity receptor
Kd No. of binding sites/cell

pM
Wild type 120 930-1,600
ter1 56 600-1,100
del1 110 500-1,850
del2 102 500-1,600
del3 67 970-1,500
ter3 50 1,000-2,000
P357G 105 1,200-1,600
P358G 87 800-1,600
P360G 73 400-900

Multiple Domains of GM-CSFRalpha Are Necessary for GM-CSF-induced Protein-tyrosine Phosphorylation of p52Shc, ERKs, JAK2, and STAT5

It is well established that tyrosine phosphorylation of an array of cytoplasmic proteins is critical for cytokine signal transduction. Accordingly, we analyzed the spectrum of substrates tyrosine-phosphorylated by addition of hGM-CSF to WT19 cells expressing various GM-CSFRalpha mutants.

Several hematopoietic cytokines including GM-CSF induce p52 Shc tyrosine phosphorylation, which correlates with their ability to activate Ras (26-30). GM-CSFRalpha transfectants were assayed for hGM-CSF-induced Shc tyrosine phosphorylation by anti-Shc immunoprecipitation followed by anti-phosphotyrosine immunoblotting. As shown in Fig. 5A, increased p52 Shc tyrosine phosphorylation was detected only in wild type and P357G GM-CSFR alpha  transfectants but not in the other mutants. Activated Ras through a cascade of protein kinases stimulates phosphorylation of ERKs (31). hGM-CSF induced phosphorylation of both p44ERK1 and p42ERK2 in wild type and P357G cells, but not in any other transfectants (data not shown).


Fig. 5. hGM-CSF-induced tyrosine phosphorylation of signaling molecules in WT19 transfectants. WT19 cells expressing the wild-type GM-CSFRbeta subunit and the indicated GM-CSFRalpha construct were incubated with or without 10 ng/ml hGM-CSF for 5 min. The cell lysates were immunoprecipitated with the appropriate antibody, and the immunoprecipitates were run on 8% SDS-PAGE. The Western blot was then carried out. A, tyrosine phosphorylation of Shc in response to hGM-CSF in WT19 transfectants. Cell extracts were immunoprecipitated with anti-Shc antibody, and the Western blot was probed with anti-phosphotyrosine antibody (upper panel) or anti-Shc antibody (lower panel). B, tyrosine phosphorylation of JAK2 in response to hGM-CSF in WT19 transfectants. Lysates were immunoprecipitated with anti-Jak2 antibody, and the immunoblot was probed with anti-phosphotyrosine antibody (upper panel) or anti-JAK2 antibody (lower panel). C, hGM-CSF-dependent phosphorylation of STAT5. Cell extracts were immunoprecipitated with anti-STAT5 antibody and immunoblotted with an anti-phosphotyrosine antibody (upper panel) or anti-STAT5 antibody (lower panel).
[View Larger Version of this Image (62K GIF file)]

GM-CSF addition to cells activates JAK2, which leads to the tyrosine phosphorylation and activation of STAT5 (32-34). Tyrosine phosphorylation of JAK2 and STAT5 was induced by GM-CSF in wild type and P357G mutants (Fig. 5, B and C). On shorter exposure, tyrosine phosphorylation of two STAT5 isoforms (STAT5 a and b) was observed. A slight decrease in JAK2 and STAT5 phosphorylation seen in Fig. 5 in the P357G transfectants was not constantly reproducible. In the other GM-CSFRalpha mutant cell lines, GM-CSF did not induce detectable JAK2 or STAT5 tyrosine phosphorylation. Activation of STAT5 in wild-type and P357G GM-CSFRalpha transfectants was also detected by gel shift assay using gamma -interferon-activated site of the IRF-1 promoter and anti-STAT5 antibody (data not shown). These data indicated that the same regions of GM-CSFRalpha that are essential for GM-CSF-induced Shc-ERK phosphorylation are also essential for the induction of JAK2 and STAT5 tyrosine phosphorylation.

Protooncogene Expression in GM-CSFRalpha Transfectants

GM-CSF has been shown to induce rapid expression of a number of protooncogenes, including c-fos, c-jun, and c-myc (29, 35). In wild-type GM-CSFRalpha and the P357G transfectants, expression of c-fos, c-jun, and c-myc mRNAs was rapidly induced upon hGM-CSF stimulation (Fig. 6). In contrast, the expression of c-fos and c-jun mRNA was not induced in the other alpha  subunit mutants except ter3. In ter3 mutant receptor cell lines, hGM-CSF was capable of inducing c-jun but not c-fos mRNA. In contrast, induction of c-myc mRNA expression was repeatedly observed in both the wild type and all of the mutant clones, indicating that hGM-CSF is able to induce c-myc mRNA in the absence of GM-CSFRalpha cytoplasmic domain and that all of the mutant receptors are capable of signaling.


Fig. 6. Induction of nuclear proto-oncogenes in WT19 transfectants. Growth factor-starved cells were stimulated with 10 ng/ml of hGM-CSF for the indicated time (0, 0.5, 1, or 2 h). Total mRNAs (15 µg) were electrophoresed on 1% agarose gel and transferred onto nylon membranes. The membranes were prehybridized, hybridized with radiolabeled DNA probes, washed, and exposed to x-ray films.
[View Larger Version of this Image (86K GIF file)]

The Cytoplasmic Domain of GM-CSFRalpha Is Critical for GM-CSF-mediated Cell Proliferation

We next examined hGM-CSF-induced cell proliferation of WT19 transfectants expressing alpha  chain mutants. As shown in Fig. 7, both the wild type GM-CSFRalpha transfectant and the P357G mutant proliferated upon addition of hGM-CSF to the medium. ter1, del1, del2, del3, P358G, and P360G did not show any proliferative response to hGM-CSF, suggesting that some residues of the alpha  chain cytoplasmic domain is indispensable for hGM-CSF-mediated growth signal transduction. These studies confirm our earlier findings about the role of GM-CSFRalpha cytoplasmic domain in promoting growth of BaF/3 cells (16).


Fig. 7. Growth response of transfectants and parental WT19 cells. Cells were incubated in 10 ng/ml of either mIL3 or hGM-CSF. At the times indicated, the number of viable cells in each culture was determined by trypan blue staining. The results were expressed relative to the cell number on day 0 of this experiment. Three independent clones of each cell type were assayed yielding similar results. The average value of the three clones was shown for mIL3 responses.
[View Larger Version of this Image (31K GIF file)]

Treatment of ter3 clones that lack the C-terminal 18 amino acid residues of alpha  chain with hGM-CSF did not lead to an increase in the cell numbers. Instead, the cells died, but more slowly than ter1 clones (Fig. 7). In MTS cell proliferation assays, ter3 clones clearly showed hGM-CSF-mediated cell proliferation signal, although it was weaker than wild type or P357G clones (Fig. 8). Cell death in factor-dependent cells is known to occur through apoptotic mechanisms. To examine if apoptosis occurred in ter3 cell number in the presence of hGM-CSF, genomic DNA was isolated from alpha  chain transfectants incubated with hGM-CSF and DNA fragmentation was analyzed by agarose gel electrophoresis (Fig. 9). ter3 showed detectable DNA fragmentation characteristic of apoptosis by 9 h and showed pronounced apoptosis by 24 h after withdrawal of mIL3 and the addition of hGM-CSF. These results suggest that ter3 mutants that are able to transduce a cell proliferation signal by GM-CSF have severely impaired anti-apoptotic signaling.


Fig. 8. MTS proliferation assay of three WT19 transfectants and parental WT19 cells. Cells (5,000 cells/each) were incubated in RPMI 1640 containing 10% FBS and various concentrations of GM-CSF for 14 h at 37 °C. After MTS/PMS solution was added, cells were incubated for 4 h at 37 °C. The conversion of MTS was measured by the amount of 490 nm absorbance. Error bars from triplicate experiments are also shown.
[View Larger Version of this Image (15K GIF file)]


Fig. 9. The effects of C-terminal deletion on the anti-apoptotic function of hGM-CSF. Three WT19 transfectants were washed with factor-free medium and incubated in medium containing 10 ng/ml hGM-CSF for indicated time. Total cellular DNA was isolated and analyzed by 1.8% agarose gel electrophoresis. Sizes of DNA markers are indicated.
[View Larger Version of this Image (74K GIF file)]

hGM-CSF-induced Monocytic Differentiation of WT19 Cells Expressing hGM-CSF Receptors

Next we analyzed hGM-CSF-induced differentiation of WT19 cells expressing human GM-CSFRalpha . All the alpha  subunit transfectants examined retained the ability to differentiate when mGM-CSF was added to the medium (data not shown). Because several transfectants died within 24 h after the withdrawal of mIL3, cell lines were treated with hGM-CSF in the presence of mIL3. After incubation with hGM-CSF for 3 days, the cells were examined for monocytic differentiation by morphology, F4/80, and Mac3 surface expression. As shown in Fig. 10, after 3 days of incubation with GM-CSF, cells transfected with either the wild type GM-CSFRalpha or P357G showed characteristic morphology of monocytic lineage: larger cell sizes, fine-stranded nuclear appearance, and a variable number of cytoplasmic vacuoles. Both the morphologic and cell surfaces changes induced by hGM-CSF were identical to those induced by mGM-CSF treatment. They also showed increased surface expression of F4/80 and Mac3 (Fig. 2). None of the clones containing ter1, del1, del2, del3, P358G, or P360G was able to differentiate when incubated with hGM-CSF (Figs. 2 and 10). In contrast, all ter3 clones that were derived (five independent clones) differentiated as well as wild type clones in response to hGM-CSF (Figs. 2 and 10).


Fig. 10. Morphological changes of WT19 transfectants in response to hGM-CSF. WT19 GM-CSFRalpha transfectants were maintained in mIL3 alone or mIL3 + 10 ng/ml hGM-CSF. Wright staining was performed (original magnification, ×400) on day 3. As a control, parental WT19 cells were maintained in mIL3 or mIL3 + 10 ng/ml mGM-CSF.
[View Larger Version of this Image (113K GIF file)]


DISCUSSION

The GM-CSF receptor signals by ligand-mediated heterodimerization of GM-CSFRalpha and GM-CSFRbeta . Although the cytoplasmic domain of the GM-CSFRalpha is only 54 amino acids, this short region of the receptor is necessary for GM-CSF-induced cell proliferation (16-18). In the present study, we have compared the role of GM-CSFRalpha cytoplasmic domain in GM-CSF-mediated cell proliferation, survival, and differentiation. This analysis was made possible by our use of the WT19 cell line, which grows but does not differentiate in mIL-3. In comparison, mGM-CSF induces differentiation, but does not stop the growth of these cells. Our studies suggest that the mGM-CSF-mediated differentiation process is reversible upon removal of mGM-CSF. The WT19 cells are equally capable of responding to both murine and human GM-CSF when transfected with the wild type human GM-CSF receptor subunits.

By using a mutant GM-CSFRalpha lacking most of the cytoplasmic domain, we have shown that the cytoplasmic domain of GM-CSFRalpha is essential for both hGM-CSF-dependent cell differentiation and proliferation. This mutant was still able to interact with the beta -chain to form a high affinity receptor complex (Table II), suggesting that the cytoplasmic domain of GM-CSFRalpha is not necessary for receptor dimerization. The GM-CSFRalpha cytoplasmic domain was necessary for the phosphorylation of signaling molecules, JAK2, STAT5, Shc, and ERKs and the induction of c-fos and c-jun mRNA expression. Weak activation of STAT1 and STAT3 by GM-CSF have recently been reported in polymorphonuclear leukocytes (36). However, we could not detect the activation of these STATs in any of the transfectants in response to GM-CSF (data not shown). Deletion of the intracytoplasmic domain did not abolish c-myc mRNA induction after GM-CSF stimulation. Similar results were observed by us using BaF/3 cells (16).

Using other cell systems and varying approaches other laboratories have suggested that the internal portion of the GM-CSFRalpha may not have a major role in regulating receptor function. For example, using a chimera of the extracellular domain of the erythropoietin receptor and the intracellular domain of the murine IL-3 receptor beta  chain (AIC2A), the addition of erythropoietin to the receptor was able to stimulate cell growth (37). Another study demonstrated that a chimera comprising the extracellular region of GM-CSFRalpha and the intracellular domain of the hbeta c can also transduce signals (38). These data suggest that dimerization of the beta -chain is important. However, they do not necessarily exclude the possibility that the GM-CSFRalpha is an important dimerization partner, and there are no physiologic data demonstrating that two beta  chains dimerize to initiate signaling in normal cells. Both the alpha  and beta  subunits have proline-rich regions close to the plasma membrane, and both of these regions are important for receptor function. In addition, we have shown that deletion of the alpha  internal segment blocks both growth and differentiation.

By using deletion mutants of GM-CSFalpha , we demonstrate that the membrane proximal proline-rich region and the adjacent 15 amino acids of the alpha  subunit are indispensable for both cell proliferation and differentiation (Figs. 2, 7, and 10). The proline-rich region of GM-CSFRalpha contains a Pro-X-Pro sequence that exists in the membrane-proximal box1 region of many other members of cytokine receptors (Fig. 3B). Mutation of this domain in the IL6 receptor gp130 protein (39) and in the granulocyte colony-stimulating factor receptor (40) eliminated receptor activity. We have here shown that similar mutations (P358G, P360G) also result in a receptor that is unable to mediate proliferation, differentiation, or other signaling events. Proline 357 could be part of a Pro-X-X-Pro motif, such as has also been found in cytokine receptors and SH3-binding proteins (41). This proline appears to be dispensable, however, since the P357G mutant was able to fully support proliferation and differentiation.

The region downstream from the proline-rich domain was also indispensable for hGM-CSF-dependent transduction of cell growth, survival, and differentiation signals. These 15 amino acid residues, which include aspartic acid 368, are conserved in IL5 receptor alpha , prolactin receptor, growth hormone receptor, and IL2 receptor gamma -chain. Our studies show that tyrosine phosphorylation of JAK2 and STAT5 is inhibited by the deletion of this region, demonstrating that the proline-rich domain alone is not sufficient for the GM-CSF-induced activation of the JAK2 signal transduction pathway. Similar results have been obtained in other systems. Deletion of 6 amino acids of the region downstream of proline-rich domain of IL5 receptor alpha , including the conserved aspartic acid, abolished IL5-induced JAK2 activation (42), while mutation of the region immediately downstream of box1 region in the erythropoietin (43) and IL6 receptors (39) blocked the activation of JAK2.

Interestingly, our data about proline mutations in the box1 region were different from the recently published study on the IL-5 receptor alpha -chain. In the previous report, the existence of any one of the three proline residues was adequate for IL-5-mediated cell proliferation signal (42). The difference between these findings could be secondary to differences in sequence in the alpha -chains (PPVPQI, GM-CSF receptor; PPIPAP, IL-5 receptor), or, possibly the difference in results could be due to the divergence in amino acid residues adjacent to the proline-rich domain.

The C-terminal deletion of GM-CSFRalpha only partially inhibited the hGM-CSF-induced cell proliferation (Figs. 7 and 8), but the cells died within several days due to the extensive apoptosis in the presence of hGM-CSF (Fig. 9). In the transfectants of this C-terminal deletion mutant (ter3), hGM-CSF-induced protein-tyrosine phosphorylation was severely impaired (Fig. 5).

Increased tyrosine phosphorylation of a 52-kDa protein, Shc, in response to GM-CSF stimulation has been reported (27-30, 44). Shc, when tyrosine-phosphorylated, binds to SH2 domains of Grb2, which leads to the recruitment of Sos, a guanine nucleotide exchange factor for Ras, to the plasma membrane (45). Tyrosine phosphorylation of Shc is thought to play an important role in GM-CSF-mediated activation of Ras through this mechanism (27). In ter3 transfectants, tyrosine phosphorylation of Shc was not detectable in response to hGM-CSF stimulation (Fig. 5A). hGM-CSF-induced activation of Ras-ERK pathway appeared to be impaired in these transfectants, since hGM-CSF-mediated ERK phosphorylation and c-fos induction, which are downstream events regulated by Ras activation (46, 47), could not be detected (Fig. 6). Our findings are compatible with a previous report that Ras activation is necessary for anti-apoptotic effect by GM-CSF, but not essential for GM-CSF-mediated DNA synthesis (27).

Our results demonstrate that ter3 transfectants differentiated as well as wild type transfectants in response to hGM-CSF. The ter3 clones are capable of stimulating increases in c-myc and to a lesser extent c-jun, but do not cause the phosphorylation of Jak2, STAT, and Shc, suggesting that activation of these proteins is not necessary for differentiation. The findings that ter3 cells die of apoptosis while they were capable of differentiation in hGM-CSF suggests that the pathways controlling cell survival and differentiation can be separated and are controlled by different portions of the GM-CSFRalpha . hGM-CSF-mediated tyrosine phosphorylation of JAK2 and STAT5 could not be detected in ter3 clones (Fig. 5, B and C), suggesting that these pathways may be important for the inhibition of apoptosis. We have recently demonstrated that the expression of a chimeric protein of CD16 and Jak2 is capable of preventing cell death, implying that part of the function of the Jak/STAT pathway could be to inhibit apoptosis (51).

In contrast to other signal transduction pathways, both c-myc and c-jun were induced in ter3 transfectants by hGM-CSF to similar levels to that seen in wild type transfectants, suggesting that c-myc and c-jun can be induced without the activation of either ERKs or JAK2. In a recent report, it was shown that the transient expression of the dominant negative form of JAK2 inhibited hGM-CSF-induced transcription of a reporter plasmid containing the c-myc promoter, suggesting that JAK2 is essential for c-myc mRNA induction by hGM-CSF (48). It is possible that inhibition of c-myc promoter was caused by a nonspecific effect of the overexpression of dominant-negative JAK2, although further experiments will be needed to clarify this possibility. c-jun overexpression induces monocytic differentiation of the WEHI-3B (49) and U937 cells (50), while c-fos overexpression did not have similar biologic effects (49). However, it is unlikely that c-jun alone is responsible for hGM-CSF-mediated cell differentiation, as c-jun mRNA expression was equivalently induced by mIL3, which has no effect on the differentiated phenotype of WT19 cells (data not shown).

In summary, specific regions of the intracytoplasmic domain of the alpha  subunit play an essential role in hGM-CSF-mediated cell proliferation, survival, and differentiation, while the signal transduction pathway which controls c-myc activation is independent of this subunit. Our results demonstrate that differentiation may occur in the absence of Shc, ERK, or JAK2 activation, suggesting that there are specific novel signal transduction pathways, yet to be determined, which control this process.


FOOTNOTES

*   This work was supported in part by National Institutes of Health Grants DK44741 (to A. S. K.) and CA45672 (to M. B. L.) and a Veterans Administration Merit Award (to M. B. L.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§   Supported by direct grants from the University of Alabama and the University of Colorado.
**   To whom correspondence should be addressed: Division of Medical Oncology, University of Colorado Health Science Center, 4200 E. Ninth Ave., Denver, CO 80262. Tel.: 303-315-8802; Fax: 303-315-8825.
1   The abbreviations used are: GM-CSF, granulocyte-macrophage colony-stimulating factor; GM-CSFR, GM-CSF receptor; IL, interleukin; ERK, extracellular signal-regulated kinase; FBS, fetal bovine serum; MTS, 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt; PMS, phenazine methosulfate; FITC, fluorescein isothiocyanate; FACS, fluorescence-activated cell sorting; MOPS, 4-morpholinepropanesulfonic acid; TBST, Tris-buffered saline-Tween.

REFERENCES

  1. Baldwin, G. C. (1992) Dev. Biol. 151, 352-367 [CrossRef][Medline] [Order article via Infotrieve]
  2. Crosier, K. E., Wong, G. G., Mathey-Prevot, B., Nathan, D. G., and Sieff, C. A. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 7744-7748 [Abstract/Free Full Text]
  3. Gough, N. M., Gough, J., Metcalf, D., Kelso, A., Grail, D., Nicola, N. A., and Burgess, A. W. (1984) Nature 309, 763-767 [CrossRef][Medline] [Order article via Infotrieve]
  4. Wong, G. G., Witek, J. S., Temple, P. A., Wilkens, K. M., Leary, A. C., Luxenburg, D. P., Jones, S. S., Brown, E. L., Kay, R. M., Orr, E. C., Shoemaker, C., Golde, D. W., Kaufman, R. J., Hewick, R. M., Wang, E. A., and Clark, S. C. (1985) Science 228, 810-815 [Abstract/Free Full Text]
  5. Gasson, J. C. (1991) Blood 77, 1131-1145 [Free Full Text]
  6. Tomonaga, M., Golde, D. W., and Gasson, J. C. (1986) Blood 67, 31-36 [Abstract/Free Full Text]
  7. Emerson, S. G., Thomas, S., Ferrara, J. L., and Greenstein, J. L. (1989) Blood 74, 49-55 [Abstract/Free Full Text] .
  8. Sieff, C. A., Emerson, S. G., Donahue, R. E., Nathan, D. G., Wang, E. A., Wong, G. G., and Clark, S. C. (1985) Science 230, 1171-1173 [Abstract/Free Full Text]
  9. Till, K. J., Burthem, J., Lopez, A., and Cowley, J. C. (1996) Blood 88, 479-486 [Abstract/Free Full Text]
  10. Gearing, D. P., King, J. A., Gough, N. M., and Nicola, N. A. (1989) EMBO J. 8, 3667-3676 [Medline] [Order article via Infotrieve]
  11. Hayashida, K., Kitamura, T., Gorman, D. M., Arai, T., Yokota, T., and Miyajima, A. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 9655-9659 [Abstract/Free Full Text]
  12. Ashworth, A., and Kraft, A. S. (1990) Nucleic Acids Res. 18, 7178 [Free Full Text]
  13. Raines, M. A., Liu, L., Quan, S. G., Joe, Y., DiPersio, J. F., and Golde, D. W. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 8203-8207 [Abstract/Free Full Text]
  14. Kitamura, T., Sato, N., Arai, K., and Miyajima, A. (1991) Cell 66, 1165-1174 [CrossRef][Medline] [Order article via Infotrieve]
  15. Tavernier, J., Devos, R., Cornelis, S., Tuypens, T., Heyden, J. V. D., Fiers, W., and Plaetinck, G. (1991) Cell 66, 1175-1184 [CrossRef][Medline] [Order article via Infotrieve]
  16. Polotskaya, A., Zhao, Y., Lilly, M. L., and Kraft, A. S. (1993) Cell Growth Diff. 4, 523-531 [Abstract]
  17. Polotskaya, A., Zhao, Y., Lilly, M. B., and Kraft, A. S. (1994) J. Biol. Chem. 269, 14607-14613 [Abstract/Free Full Text]
  18. Weiss, M., Yokoyama, C., Shikama, Y., Naugle, C., Druker, B., and Sieff, C. A. (1993) Blood 82, 3298-3306 [Abstract/Free Full Text]
  19. Sakamaki, K., Miyajima, I., Kitamura, T., and Miyajima, A. (1992) EMBO J. 11, 3541-3549 [Medline] [Order article via Infotrieve]
  20. Bourette, R. P., Myles, G. M., Carlberg, K., Chen, A. R., and Rohrschneider, L. R. (1995) Cell Growth Diff. 6, 631-645 [Abstract]
  21. Dexter, T. M., Garland, I., Scott, D., Scolnick, E., and Metcalf, D. (1980) J. Exp. Med. 152, 1026-1047
  22. Park, L. S., Friend, D., Gillis, S., and Urdal, D. L. (1986) J. Biol. Chem. 261, 4177-4183 [Abstract/Free Full Text]
  23. Austyn, J. M., and Gordon, S. (1981) Eur. J. Immunol. 11, 805-815 [Medline] [Order article via Infotrieve]
  24. Ho, M.-K., and Springer, T. A. (1983) J. Biol. Chem. 258, 636-642 [Abstract/Free Full Text]
  25. McKnight, A. J., Macfarlane, A. J., Dri, P., Turley, L., Willis, A. C., and Gordon, S. (1996) J. Biol. Chem. 271, 486-489 [Abstract/Free Full Text]
  26. Itoh, T., Muto, A., Watanabe, S., Miyajima, A., Yokota, T., and Arai, K. (1996) J. Biol. Chem. 271, 7587-7592 [Abstract/Free Full Text]
  27. Kinoshita, T., Yokota, T., Arai, K., and Miyajima, A. (1995) EMBO J. 14, 266-275 [Medline] [Order article via Infotrieve]
  28. Matsuguchi, T., Salgia, R., Hallek, M., Eder, M., Druker, B., Ernst, T. J., and Griffin, J. D. (1994) J. Biol. Chem. 269, 5016-5021 [Abstract/Free Full Text]
  29. Sato, N., Sakamaki, K., Terada, N., Arai, K., and Miyajima, A. (1993) EMBO J. 12, 4181-4189 [Medline] [Order article via Infotrieve]
  30. Welham, M. J., Duronio, V., Leslie, K. B., Bowtell, D., and Schrader, J. W. (1994) J. Biol. Chem. 269, 21165-21176 [Abstract/Free Full Text]
  31. Egan, S. E., and Weinberg, R. A. (1993) Nature 365, 781-783 [CrossRef][Medline] [Order article via Infotrieve]
  32. Darnell, J. E., Jr., Kerr, I. M., and Stark, G. R. (1994) Science 264, 1415-1421 [Abstract/Free Full Text]
  33. Mui, A. L.-F., Wakao, H., O'Farrell, A.-M., Harada, N., and Miyajima, A. (1995) EMBO J. 14, 1166-1175 [Medline] [Order article via Infotrieve]
  34. Quelle, F. W., Sato, N., Witthuhn, B. A., Inhorn, R. C., Eder, M., Miyajima, A., Griffin, J. D., and Ihle, J. N. (1994) Mol. Cell. Biol. 14, 4335-4341 [Abstract/Free Full Text]
  35. Yokota, T., Watanabe, S., Mui, A. L., Muto, A., Mitajima, A., and Arai, K. (1993) Leukemia 7, Suppl. 2, S102-S107
  36. Brizzi, M. F., Aronica, M. G., Rosso, A., Bagnara, G. P., Yarden, Y., and Pegoraro, L. (1996) J. Biol. Chem. 271, 3562-3567 [Abstract/Free Full Text]
  37. Sakamaki, K., Wang, H.-M., Miyajima, I., Kitamura, T., Todokoro, K., Harada, N., and Miyajima, A. (1993) J. Biol. Chem. 268, 15833-15839 [Abstract/Free Full Text]
  38. Muto, A., Watanabe, S., Miyajima, A., Yokota, T., and Arai, K. (1995) Biochem. Biophys. Res. Commun. 208, 368-375 [CrossRef][Medline] [Order article via Infotrieve]
  39. Murakami, M., Narazaki, M., Hibi, M., Yawata, H., Yasukawa, K., Hamaguchi, M., Taga, T., and Kishimoto, T. (1991) Pro. Natl. Acad. Sci. U. S. A. 88, 11349-11353 [Abstract/Free Full Text]
  40. Fukunaga, R., Ishizaka-Ikeda, E., Pan, C.-X., Seto, Y., and Nagata, S. (1991) EMBO J. 10, 2855-2865 [Medline] [Order article via Infotrieve]
  41. Yu, H., Chan, J. K., Feng, S., Dalgarno, D. C., Brauer, A. W., and Schreiber, S. L. (1994) Cell 76, 933-945 [CrossRef][Medline] [Order article via Infotrieve]
  42. Takaki, S., Kanazawa, H., Shiba, M., and Takatsu, K. (1994) Mol. Cell. Biol. 14, 7404-7413 [Abstract/Free Full Text]
  43. Witthuhn, B. A., Quelle, F. W., Silvennoinen, O., Yi, T., Tang, B., Miura, O., and Ihle, J. N. (1993) Cell 74, 227-246 [CrossRef][Medline] [Order article via Infotrieve]
  44. Lanfrancone, L., Pelicci, G., Brizzi, M. F., Aronica, M. G., Casciari, C., Giuli, S., Pegoraro, L., Pawson, T., and Pelicci, P. G. (1995) Oncogene 10, 907-917 [Medline] [Order article via Infotrieve]
  45. Boguski, M. S., and McCormick, F. (1993) Nature 366, 643-653 [CrossRef][Medline] [Order article via Infotrieve]
  46. De Vries-Smith, A. M., Burgering, B. M., Leevers, S. J., Marshall, C. J., and Bos, J. L. (1992) Nature 357, 602-604 [CrossRef][Medline] [Order article via Infotrieve]
  47. Marais, R., Wynne, J., and Treisman, R. (1993) Cell 73, 381-393 [CrossRef][Medline] [Order article via Infotrieve]
  48. Watanabe, S., Itoh, T., and Arai, K. (1996) J. Biol. Chem. 271, 12681-12686 [Abstract/Free Full Text]
  49. Li, J., King, I., and Sartorelli, A. C. (1994) Cell Growth Diff. 5, 743-751 [Abstract]
  50. Szabo, E., Preis, L. H., and Birrer, M. J. (1994) Cell Growth Diff. 5, 439-446 [Abstract]
  51. Sakai, I., and Kraft, A. S. (1997) J. Biol. Chem. 272, 12350-12358 [Abstract/Free Full Text]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
N. J. Stevenson, M. R. Addley, E. J. Ryan, C. R. Boyd, H. P. Carroll, V. Paunovic, C. A. Bursill, H. C. Miller, K. M. Channon, A. E. McClurg, et al.
CCL11 blocks IL-4 and GM-CSF signaling in hematopoietic cells and hinders dendritic cell differentiation via suppressor of cytokine signaling expression
J. Leukoc. Biol., February 1, 2009; 85(2): 289 - 297.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Chen, J. M. Carcamo, and D. W. Golde
The {alpha} Subunit of the Granulocyte-Macrophage Colony-stimulating Factor Receptor Interacts with c-Kit and Inhibits c-Kit Signaling
J. Biol. Chem., August 4, 2006; 281(31): 22421 - 22426.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. B. Gaynor
A role for extracellular matrix binding receptors in regulating hematopoietic growth factor signaling
PNAS, November 25, 2003; 100(24): 13737 - 13738.
[Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. Chen, J. M. Carcamo, O. Borquez-Ojeda, H. Erdjument-Bromage, P. Tempst, and D. W. Golde
From the Cover: The laminin receptor modulates granulocyte-macrophage colony-stimulating factor receptor complex formation and modulates its signaling
PNAS, November 25, 2003; 100(24): 14000 - 14005.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Ebner, A. Bandion, B. R. Binder, R. de Martin, and J. A. Schmid
GMCSF activates NF-{kappa}B via direct interaction of the GMCSF receptor with I{kappa}B kinase {beta}
Blood, July 1, 2003; 102(1): 192 - 199.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Dhar-Mascareno, J. Chen, R. H. Zhang, J. M. Carcamo, and D. W. Golde
Granulocyte-Macrophage Colony-stimulating Factor Signals for Increased Glucose Transport via Phosphatidylinositol 3-Kinase- and Hydrogen Peroxide-dependent Mechanisms
J. Biol. Chem., March 21, 2003; 278(13): 11107 - 11114.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. A. Evans, S. Ariffin, A. Pierce, and A. D. Whetton
Identification of primary structural features that define the differential actions of IL-3 and GM-CSF receptors
Blood, October 16, 2002; 100(9): 3164 - 3174.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Masuda, Y. Yoshikai, K. Aiba, and T. Matsuguchi
Th2 Cytokine Production from Mast Cells Is Directly Induced by Lipopolysaccharide and Distinctly Regulated by c-Jun N-Terminal Kinase and p38 Pathways
J. Immunol., October 1, 2002; 169(7): 3801 - 3810.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. McClure, F. Stomski, A. Lopez, and J. Woodcock
Perverted responses of the human granulocyte-macrophage colony-stimulating factor receptor in mouse cell lines due to cross-species beta -subunit association
Blood, November 15, 2001; 98(10): 3165 - 3168.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Wagner, S. Kafert-Kasting, G. Heil, A. Ganser, and M. Eder
Inhibition of granulocyte-macrophage colony-stimulating factor receptor function by a splice variant of the common beta -receptor subunit
Blood, November 1, 2001; 98(9): 2689 - 2696.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. B. Lilly, M. Zemskova, A. E. Frankel, J. Salo, and A. S. Kraft
Distinct domains of the human granulocyte-macrophage colony-stimulating factor receptor {alpha} subunit mediate activation of Jak/Stat signaling and differentiation
Blood, March 15, 2001; 97(6): 1662 - 1670.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Piazza, J. Valens, E. Lagasse, and C. Schindler
Myeloid differentiation of FdCP1 cells is dependent on Stat5 processing
Blood, August 15, 2000; 96(4): 1358 - 1365.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Baghdoyan, P. Dubreuil, F. Eberle, and S. Gomez
Capture of cytokine-responsive genes (NACA and RBM3) using a gene trap approach
Blood, June 15, 2000; 95(12): 3750 - 3757.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Watanabe, Y. Aoki, I. Nishijima, M.-j. Xu, and K.-i. Arai
Analysis of Signals and Functions of the Chimeric Human Granuloctye-Macrophage Colony-Stimulating Factor Receptor in BA/F3 Cells and Transgenic Mice
J. Immunol., April 1, 2000; 164(7): 3635 - 3644.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. P. McCormack and T. J. Gonda
Novel murine myeloid cell lines that exhibit a differentiation switch in response to IL-3 or GM-CSF, or to different constitutively active mutants of the GM-CSF receptor beta subunit
Blood, January 1, 2000; 95(1): 120 - 127.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. E. Borg, M. Zhang, D. Hegge, R. L. Stephen, D. J. Buckley, N. S. Magnuson, and A. R. Buckley
Prolactin Regulation of pim-1 Expression: Positive and Negative Promoter Elements
Endocrinology, December 1, 1999; 140(12): 5659 - 5668.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
A. Haman, C. Cadieux, B. Wilkes, T. Hercus, A. Lopez, S. Clark, and T. Hoang
Molecular Determinants of the Granulocyte-Macrophage Colony-stimulating Factor Receptor Complex Assembly
J. Biol. Chem., November 26, 1999; 274(48): 34155 - 34163.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Kafert, S. Luther, I. Boll, K. Wagner, A. Ganser, and M. Eder
Functional Analysis of a Single Chain Chimeric alpha /beta -Granulocyte-Macrophage Colony-stimulating Factor Receptor. IMPORTANCE OF A GLUTAMATE RESIDUE IN THE TRANSMEMBRANE REGION
J. Biol. Chem., November 12, 1999; 274(46): 33064 - 33071.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Lee, F. Piazza, S. Brutsaert, J. Valens, I. Strehlow, M. Jarosinski, C. Saris, and C. Schindler
Characterization of the Stat5 Protease
J. Biol. Chem., September 17, 1999; 274(38): 26767 - 26775.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. A. Evans, A. Pierce, S. A. Winter, E. Spooncer, C. M. Heyworth, and A. D. Whetton
Activation of Granulocyte-Macrophage Colony-Stimulating Factor and Interleukin-3 Receptor Subunits in a Multipotential Hematopoietic Progenitor Cell Line Leads to Differential Effects on Development
Blood, September 1, 1999; 94(5): 1504 - 1514.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. L. Orchansky, R. Kwan, F. Lee, and J. W. Schrader
Characterization of the Cytoplasmic Domain of Interleukin-13 Receptor-alpha
J. Biol. Chem., July 23, 1999; 274(30): 20818 - 20825.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Al-Shami and P. H. Naccache
Granulocyte-Macrophage Colony-stimulating Factor-activated Signaling Pathways in Human Neutrophils. INVOLVEMENT OF Jak2 IN THE STIMULATION OF PHOSPHATIDYLINOSITOL 3-KINASE
J. Biol. Chem., February 26, 1999; 274(9): 5333 - 5338.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
G. S. Burgess, E. A. Williamson, L. D. Cripe, S. Litz-Jackson, J. A. Bhatt, K. Stanley, M. J. Stewart, A. S. Kraft, H. Nakshatri, and H. S. Boswell
Regulation of the c-jun Gene in p210 BCR-ABL Transformed Cells Corresponds With Activity of JNK, the c-jun N-Terminal Kinase
Blood, October 1, 1998; 92(7): 2450 - 2460.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. E. Doyle and J. C. Gasson
Characterization of the Role of the Human Granulocyte-Macrophage Colony-Stimulating Factor Receptor alpha  Subunit in the Activation of JAK2 and STAT5
Blood, August 1, 1998; 92(3): 867 - 876.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Matsuguchi, M. B. Lilly, and A. S. Kraft
Cytoplasmic Domains of the Human Granulocyte-Macrophage Colony-stimulating Factor (GM-CSF) Receptor beta  Chain (hbeta c) Responsible for Human GM-CSF-induced Myeloid Cell Differentiation
J. Biol. Chem., July 31, 1998; 273(31): 19411 - 19418.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. William, G. Watson, O. D. Rotstein, J. Parodo, R. Bitar, and J. C. Marshall
The IL-1{beta}-Converting Enzyme (Caspase-1) Inhibits Apoptosis of Inflammatory Neutrophils Through Activation of IL-1{beta}
J. Immunol., July 15, 1998; 161(2): 957 - 962.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
O. Wessely, E.-M. Deiner, K. C. Lim, G. Mellitzer, P. Steinlein, and H. Beug
Mammalian Granulocyte-Macrophage Colony-stimulating Factor Receptor Expressed in Primary Avian Hematopoietic Progenitors: Lineage-specific Regulation of Proliferation and Differentiation
J. Cell Biol., May 18, 1998; 141(4): 1041 - 1051.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
T. E. Smithgall
Signal Transduction Pathways Regulating Hematopoietic Differentiation
Pharmacol. Rev., March 1, 1998; 50(1): 1 - 20.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Masuda, T. Matsuguchi, K. Yamaki, T. Hayakawa, and Y. Yoshikai
Interleukin-15 Prevents Mouse Mast Cell Apoptosis through STAT6-mediated Bcl-xL Expression
J. Biol. Chem., July 6, 2001; 276(28): 26107 - 26113.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Masuda, T. Matsuguchi, K. Yamaki, T. Hayakawa, M. Kubo, W. J. LaRochelle, and Y. Yoshikai
Interleukin-15 Induces Rapid Tyrosine Phosphorylation of STAT6 and the Expression of Interleukin-4 in Mouse Mast Cells
J. Biol. Chem., September 15, 2000; 275(38): 29331 - 29337.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsuguchi, T.
Right arrow Articles by Kraft, A. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsuguchi, T.
Right arrow Articles by Kraft, A. S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement