INTRODUCTION

Granulocyte-macrophage colony-stimulating factor (GM-CSF)¹ is a 22-kDa glycoprotein, which is secreted by activated T cells, endothelial cells, fibroblasts, mast cells, B cells, and macrophages (1-4). GM-CSF plays an important role in promoting differentiation, survival, and proliferation of colony-forming unit-granulocyte-macrophage progenitor cells as well as enhancing the function of mature neutrophils, monocytes, and eosinophils (5, 6) and stimulating burst promoting activity for burst-forming units, erythroid (7, 8). GM-CSF causes a major cytoskeletal reorganization in plasma cells and hairy cells, resulting in the inhibition of motility and loss of adhesion to cellular and matrix ligands (9).

The biologic actions of GM-CSF are mediated by binding to a specific receptor consisting of  and  subunits, both of which are members of the type-I cytokine receptor family (10, 11). The  subunit binds GM-CSF with low affinity (10). A soluble form of human GM-CSF receptor  subunit (GM-CSFR) has also been identified, whose function in vivo is unclear (12, 13). While the  subunit does not bind GM-CSF by itself, it forms a high affinity receptor in combination with the  subunit (11). The  chain is called the common  chain (c) because it is shared by interleukin 3 (IL3) and interleukin 5 (IL5) receptors (14, 15). Although the cytoplasmic domain of GM-CSFR is only 54 amino acids, we and others have demonstrated that the GM-CSFR cytoplasmic domain is necessary for GM-CSF-induced cell proliferation (16-18). Several studies showed that the cytoplasmic domain of the human GM-CSF receptor  chain (GM-CSFR) is also essential for the mitogenic signal (18, 19). However, because of the lack of adequate biologic model cell systems, the role of GM-CSFR  and  subunits in GM-CSF-induced cell differentiation has not been clearly demonstrated.

The present study defines the role of GM-CSFR in GM-CSF-mediated differentiation by studying WT19 cells, an FDC-P1-derived cell line that uniformly differentiates toward the monocytic lineage in response to murine GM-CSF (mGM-CSF), but grows and does not differentiate in the presence of murine IL3 (mIL3) (20, 21). We find that when the wild type human GM-CSFR  and  subunits are both transfected into WT19 cells, these cells respond to the addition of human GM-CSF (hGM-CSF) by undergoing differentiation. To identify the residues of GM-CSFR cytoplasmic domain necessary for the induction of cell differentiation, WT19 cell lines were established which express mutated cytoplasmic domains of the subunit along with the wild type  subunit. The ability of GM-CSF to support cell survival of WT19 correlated with the tyrosine phosphorylation of Jak2, STAT5, Shc, and extracellular signal-regulated kinases (ERKs). However, the induction of differentiation in the cells containing the 18-amino acid deletion of the C-terminal region occurred without the detectable tyrosine phosphorylation of these four signaling molecules. Our results suggest that cell survival and differentiation are controlled by different signal transduction pathways regulated by varying portions of the GM-CSFR.

EXPERIMENTAL PROCEDURES

WT19 is a cell line established from a mouse factor-dependent myeloid cell line, FDC-P1 (a generous gift from Dr. Larry Rohrschneider, Fred Hutchinson Cancer Research Center, Seattle, WA). The cell line was cultured in RPMI 1640 medium (Life Technologies, Inc.) supplemented with 10% fetal bovine serum (FBS), and 10% WEHI-3B conditioned medium containing mIL3.

Recombinant hGM-CSF was purchased from Immunex Corp. (Seattle, WA). Recombinant mGM-CSF and mIL3 were obtained from Genzyme (Cambridge, MA).

The human GM-CSFR cDNA was removed from the plasmid pKH97 (a gift from Dr. A. Miyajima, DNAX Research Institute, Palo Alto, CA), and the 2.9-kilobase pair fragment was ligated into pCEP4 (Invitrogen), which contains a hygromycin selection marker giving the plasmid pCEP4-GM-CSFR.

The 1.3-kilobase pair human GM-CSF receptor  chain cDNA was removed from pCDM8 vector (12) and ligated into the pcDNA3 vector (Invitrogen) giving the plasmid pCMV-GM-CSFR.

To construct GM-CSFR mutants, GM-CSFR cDNA was cloned into M13 mp19. Site-directed mutagenesis was carried out using a kit from Amersham, using oligonucleotides: GGGAACAGCCGTCATCACCTAAGGAAC (ter1), CTTTCCCTTCTCATCAGGTGAATTCCTC (ter3), CCTCATGGTTATCCCTAAGGAACCTT (del1), TCCCTTCCTCTGGATTCAGTTTGTCT (del2), GTCTTTGATCTGTATCCTAAGGAACC (del3), TGGAACTGGACCGAACAGC (P357G), TCTGTTCGTCAGTGTGAAGATCAGAGC (P358G), CTTTGATCTGACCAACTGGCGG (P360G). The mutated cDNAs were isolated and ligated into pcDNA3 vector. The structure of the constructs was confirmed by restriction enzyme mapping and DNA sequence analysis.

pCEP4-GM-CSFR was introduced into WT19 cells by electroporation at 260 V, 975 microfarads using a Bio-Rad Gene Pulser, and transfectants isolated using hygromycin (0.4 mg/ml). A clone termed WT19 1 expressing GM-CSFR was used for the transfection of pCMV-GM-CSFR wild-type or mutant subunits. Resistant clones containing the  subunit were then isolated using G418 selection (0.4 mg/ml). Resulting clones were screened by flow cytometry using anti-human GM-CSFR monoclonal antibody, and three to five positive clones from each construct were expanded for further studies.

5,000 cells were incubated in 100 µl of RPMI 1640 containing 10% FBS and various concentrations of hGM-CSF for 14 h at 37 °C in a humidified 5% CO₂ atmosphere. 20 µl of freshly prepared combined 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt/phenazine methosulfate (MTS/PMS) solution (Promega, Madison, WI) was added to each sample. After an additional 4 h of incubation at 37 °C, the conversion of MTS into the aqueous soluble formazan was measured at an absorbance of 490 nm.

Polyclonal anti-human GM-CSFR anti-sera were prepared using a glutathione S-transferase fusion protein containing amino acids 47-93 of GM-CSFR (16). The anti-phosphotyrosine monoclonal antibody (4G10) was purchased from Upstate Biotechnology Inc. (Lake Placid, NY). The anti-Shc polyclonal antibody and the anti-STAT1 polyclonal antibody were obtained from Signal Transduction Laboratories (Lexington, KY). The anti-STAT3 and STAT5 polyclonal antibodies were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). The STAT5 antibody (sc-835) is specific for both STAT5a and STAT5b. The anti-human GM-CSFR monoclonal antibody was a generous gift from Dr. A. F. Lopez (Instiute of Medical and Veterinary Science, Adelaide, Australia). The anti-Mac1 and Mac3 rat monoclonal antibodies were purchased from PharMingen (San Diego, CA). The anti-F4/80 rat monoclonal antibody was purified from the culture supernatant of HB198 rat hybridoma cell line obtained from ATCC.

Cells were lysed in PLC buffer (50 mM HEPES, pH 7.0, 150 mM NaCl, 10% glycerol, 1% Triton X-100, 1.5 mM MgCl₂, 1 mM EGTA, 100 mM NaF, 10 mM NaPP_i, 1 mM Na₃VO₄, 1 mM phenylmethanesulfonyl fluoride, 10 mg/ml aprotinin, 10 mg/ml leupeptin) at 10⁸ cells/ml. The lysates were separated on SDS-polyacrylamide gels, electrotransferred to Immobilon polyvinylidene difluoride membranes (Millipore). The membranes were blocked for 2 h in 2% bovine serum albumin-TBST (20 mM Tris-HCl, pH 7.6, 0.15 M sodium chloride, 0.1% Tween 20), incubated with primary antibodies in TBST for 1 h, washed three times with TBST, and incubated for 1 h with horseradish peroxidase-conjugated anti-mouse or rabbit immunoglobulin (Amersham) diluted 1:10,000 in TBST. After three washes in TBST, the blot was developed with the enhanced chemiluminescence system (Amersham) according to the manufacturer's instructions.

The cell lysates were incubated with the indicated antibody for 2 h at 4 °C, followed by protein A-Sepharose beads (Pharmacia Biotech Inc.) for an additional 1 h. The beads were washed three times in PLC lysis buffer, and then suspended in SDS-sample buffer, heated at 95 °C for 5 min. The eluted proteins were applied to an SDS-polyacrylamide gel and proteins detected by Western blotting.

Total cellular RNAs were extracted using Trizol reagent (Life Technologies, Inc.) according to the manufacturer's instructions. 15-µg aliquots of the total RNAs were fractioned on 1% agarose gel containing 20 mM MOPS, 5 mM sodium acetate, 1 mM EDTA, pH 7.0, and 6% (v/v) formaldehyde, and transferred to a nylon membrane. After UV-cross-linking, membranes were soaked in prehybridization solution (6 × SSC, 5 × Denhardt's reagent, 0.5% SDS, 100 mg/ml denatured salmon sperm DNA, and 50% formamide) for 3 h at 42 °C followed by incubation with ³²P-labeled probe in hybridization solution (6 × SSC, 0.5% SDS, 100 mg/ml denatured salmon sperm DNA, and 50% formamide) for 14 h at 42 °C. The membranes were washed in 2 × SSC, 0.1% SDS for 10 min twice at room temperature; in 0.1 × SSC, 0.1% SDS for 10 min twice at 50 °C; and then exposed to Kodak XAR films.

hGM-CSF binding assay was performed as described previously (22). Briefly, cells were incubated in RPMI 1640, 10% FCS, 20 mM Hepes for 4 h at 37 °C, and incubated in binding buffer (RPMI 1640 + 2% bovine serum albumin, 20 mM Hepes) containing varying concentrations of ¹²⁵I-hGM-CSF (NEN Life Science Products) for 30 min at 37 °C. To measure nonspecific binding, 100-fold excess of cold hGM-CSF was added. The cells were centrifuged through a phthalate oil layer (3:2, dioctyl phthalate/di-n-butyl phthalate). The radioactivity of the cell pellet was counted in a  counter. The binding data were subjected to Scatchard analysis.

Before lysis, cells were incubated for the indicated time periods in medium supplemented with hGM-CSF (10 ng/ml) followed by a wash in PBS. The cells were then incubated in cell lysis buffer (10 mM EDTA, 50 mM Tris-HCl, pH 8, 0.5% SDS, 0.5 mg/ml Proteinase K) for 14 h at 50 °C. After an additional 3-h incubation with the addition of 0.25 mg/ml RNase, the genomic DNA was extracted with phenol-chloroform and precipitated with ethanol. DNA fragments were visualized after 1.8% agarose gel electrophoresis by ethidium bromide staining.

RESULTS

WT19 cells (20) growing in mIL-3 demonstrated a myeloblastic morphology including rounded nuclei, fine chromatin, and thin and basophilic cytoplasm. In response to mGM-CSF, the cells demonstrated monocytic characteristics: an indented nucleus with fine-stranded appearance, increased cytoplasm containing a variable number of vacuoles, and larger total cell size. Cells treated with mGM-CSF also became positive for nonspecific esterase and acid phosphatase (Table I). To quantitate the number of cells undergoing differentiation after the addition of mGM-CSF or mIL3, surface marker changes were evaluated by FACS analysis. WT19 cells growing in mIL3 showed weak surface expression of F4/80 and Mac3 (Fig. 1A), both of which are monocytic specific markers (23-25). When the WT19 cells were incubated with mGM-CSF, the expression of both these markers was significantly increased, suggesting that the cells differentiated toward monocytic lineage (Fig. 1A). As demonstrated by FACS analysis, cell size and granularity also increased as evidenced by an increase in both forward scattergram (FSC) and side scattergram (SSC) (Fig. 1A). These characteristics were stable for at least 14 days (Fig. 1A). Differentiated cells continued to divide, and the cell number increased. Increases in both F4/80 expression and cell granularity were evident within 1-2 days after the addition of mGM-CSF (Fig. 1B). Washing out the mGM-CSF and replacing it with mIL3 caused the F4/80 expression to decrease to background levels within 3 days (Fig. 1C), suggesting that mGM-CSF-induced monocyte/macrophage differentiation of WT19 cells is a reversible phenomenon. In addition, mGM-CSF induced cell differentiation of WT19 in the presence of mIL3, suggesting mGM-CSF-mediated differentiation signal is dominant over mIL3 (data not shown).

Table I. Differentiation markers of WT19 cells after mIL3 and mGM-CSF stimulation Morphology Surface markers Staining Cell size Granularity F4/80 Mac1 Mac3 Nonspecific esterase Specific esterase Acid phosphatase IL3 + + +   +       GM-CSF ++ +++ +++   +++ +   +

To examine the ability of hGM-CSF to mediate the differentiation of WT19 cells, cells were transfected with an expression plasmid encoding human GM-CSFR  subunit containing a hygromycin resistance selectable marker. A clone expressing high levels of GM-CSFR , WT19  clone 1, was then transfected with the G418-selectable expression plasmid encoding GM-CSFR wild type subunit, and the cells were further selected in G418. Treatment of these doubly transfected cells with hGM-CSF induced differentiation of WT19 cells as measured by changes in F4/80 and Mac3 surface markers (Fig. 2). This hGM-CSF-induce differentiation was also found to be reversible upon removal of human hGM-CSF (data not shown).

Expression of Human GM-CSFR Mutants in WT19 Cells

We have demonstrated that the cytoplasmic domain of the  subunit regulates growth of factor-dependent hematopoietic cells (16, 17). Specific residues of the  subunit are highly conserved among growth factor receptors (Fig. 3B). As hGM-CSF is capable of inducing the differentiation of WT19 cells, it is possible to evaluate the role of the cytoplasmic domain in GM-CSF-mediated cell growth, survival, and differentiation. A series of expression plasmids encoding deletion and substitution mutants of GM-CSFR (Fig. 3A) were created; ter1 mutant lacks the entire cytoplasmic domain except for the membrane-proximal 5 amino acids; del1 has an internal deletion of 15 amino acid residues corresponding to the proline-rich box 1 region, which is well conserved among the type I cytokine receptor family; del2 has an internal 16-amino acid deletion adjacent to the box 1 region; del3 has an 8-amino acid deletion within the box 1 region removing the proline-rich domain (PPVP) (Fig. 3B); ter3 has a deletion of the C-terminal 18 amino acid residues; and three individual amino acid substitutions have mutations in the well conserved proline-rich domain: proline 357, 358, or 360 (Fig. 3A).

GM-CSFR cytoplasmic domain mutants.

These GM-CSFR expression plasmids were transfected into WT19  clone 1, and the G418-resistant clones were isolated. The levels of expression of these mutants were analyzed by staining with a specific anti-GM-CSFR monoclonal antibody followed by flow cytometric analysis with a FACScan (Fig. 4). All these mutants were confirmed to express c equally well by immunoblotting using specific anti-GM-CSFR antibody (data not shown). Each transfectant was examined for hGM-CSF binding using ¹²⁵I-labeled hGM-CSF, and the results of high affinity binding profiles were shown in Table II. All mutant transfectants including ter1 clones bind hGM-CSF with high affinity and K_d values suggesting that there are equivalent numbers of receptors with similar affinity. These results suggested that the mutations introduced in the cytoplasmic domain of GM-CSFR did not affect the interactions of GM-CSFR with the ligand or GM-CSFR.

Flow cytometric analysis of GM-CSFR expression on WT19 transfectants.

Table II. Binding profiles of GM-CSF on WT19 transfectants Two to four clones were analyzed for each mutant. Mean Kd value is shown. High affinity receptor Kd No. of binding sites/cell pM Wild type 120 930-1,600 ter1 56 600-1,100 del1 110 500-1,850 del2 102 500-1,600 del3 67 970-1,500 ter3 50 1,000-2,000 P357G 105 1,200-1,600 P358G 87 800-1,600 P360G 73 400-900

Multiple Domains of GM-CSFR Are Necessary for GM-CSF-induced Protein-tyrosine Phosphorylation of p52Shc, ERKs, JAK2, and STAT5

It is well established that tyrosine phosphorylation of an array of cytoplasmic proteins is critical for cytokine signal transduction. Accordingly, we analyzed the spectrum of substrates tyrosine-phosphorylated by addition of hGM-CSF to WT19 cells expressing various GM-CSFR mutants.

Several hematopoietic cytokines including GM-CSF induce p52 Shc tyrosine phosphorylation, which correlates with their ability to activate Ras (26-30). GM-CSFR transfectants were assayed for hGM-CSF-induced Shc tyrosine phosphorylation by anti-Shc immunoprecipitation followed by anti-phosphotyrosine immunoblotting. As shown in Fig. 5A, increased p52 Shc tyrosine phosphorylation was detected only in wild type and P357G GM-CSFR  transfectants but not in the other mutants. Activated Ras through a cascade of protein kinases stimulates phosphorylation of ERKs (31). hGM-CSF induced phosphorylation of both p44ERK1 and p42ERK2 in wild type and P357G cells, but not in any other transfectants (data not shown).

GM-CSF addition to cells activates JAK2, which leads to the tyrosine phosphorylation and activation of STAT5 (32-34). Tyrosine phosphorylation of JAK2 and STAT5 was induced by GM-CSF in wild type and P357G mutants (Fig. 5, B and C). On shorter exposure, tyrosine phosphorylation of two STAT5 isoforms (STAT5 a and b) was observed. A slight decrease in JAK2 and STAT5 phosphorylation seen in Fig. 5 in the P357G transfectants was not constantly reproducible. In the other GM-CSFR mutant cell lines, GM-CSF did not induce detectable JAK2 or STAT5 tyrosine phosphorylation. Activation of STAT5 in wild-type and P357G GM-CSFR transfectants was also detected by gel shift assay using -interferon-activated site of the IRF-1 promoter and anti-STAT5 antibody (data not shown). These data indicated that the same regions of GM-CSFR that are essential for GM-CSF-induced Shc-ERK phosphorylation are also essential for the induction of JAK2 and STAT5 tyrosine phosphorylation.

Protooncogene Expression in GM-CSFR Transfectants

GM-CSF has been shown to induce rapid expression of a number of protooncogenes, including c-fos, c-jun, and c-myc (29, 35). In wild-type GM-CSFR and the P357G transfectants, expression of c-fos, c-jun, and c-myc mRNAs was rapidly induced upon hGM-CSF stimulation (Fig. 6). In contrast, the expression of c-fos and c-jun mRNA was not induced in the other  subunit mutants except ter3. In ter3 mutant receptor cell lines, hGM-CSF was capable of inducing c-jun but not c-fos mRNA. In contrast, induction of c-myc mRNA expression was repeatedly observed in both the wild type and all of the mutant clones, indicating that hGM-CSF is able to induce c-myc mRNA in the absence of GM-CSFR cytoplasmic domain and that all of the mutant receptors are capable of signaling.

The Cytoplasmic Domain of GM-CSFR Is Critical for GM-CSF-mediated Cell Proliferation

We next examined hGM-CSF-induced cell proliferation of WT19 transfectants expressing  chain mutants. As shown in Fig. 7, both the wild type GM-CSFR transfectant and the P357G mutant proliferated upon addition of hGM-CSF to the medium. ter1, del1, del2, del3, P358G, and P360G did not show any proliferative response to hGM-CSF, suggesting that some residues of the  chain cytoplasmic domain is indispensable for hGM-CSF-mediated growth signal transduction. These studies confirm our earlier findings about the role of GM-CSFR cytoplasmic domain in promoting growth of BaF/3 cells (16).

Treatment of ter3 clones that lack the C-terminal 18 amino acid residues of  chain with hGM-CSF did not lead to an increase in the cell numbers. Instead, the cells died, but more slowly than ter1 clones (Fig. 7). In MTS cell proliferation assays, ter3 clones clearly showed hGM-CSF-mediated cell proliferation signal, although it was weaker than wild type or P357G clones (Fig. 8). Cell death in factor-dependent cells is known to occur through apoptotic mechanisms. To examine if apoptosis occurred in ter3 cell number in the presence of hGM-CSF, genomic DNA was isolated from  chain transfectants incubated with hGM-CSF and DNA fragmentation was analyzed by agarose gel electrophoresis (Fig. 9). ter3 showed detectable DNA fragmentation characteristic of apoptosis by 9 h and showed pronounced apoptosis by 24 h after withdrawal of mIL3 and the addition of hGM-CSF. These results suggest that ter3 mutants that are able to transduce a cell proliferation signal by GM-CSF have severely impaired anti-apoptotic signaling.

Next we analyzed hGM-CSF-induced differentiation of WT19 cells expressing human GM-CSFR. All the  subunit transfectants examined retained the ability to differentiate when mGM-CSF was added to the medium (data not shown). Because several transfectants died within 24 h after the withdrawal of mIL3, cell lines were treated with hGM-CSF in the presence of mIL3. After incubation with hGM-CSF for 3 days, the cells were examined for monocytic differentiation by morphology, F4/80, and Mac3 surface expression. As shown in Fig. 10, after 3 days of incubation with GM-CSF, cells transfected with either the wild type GM-CSFR or P357G showed characteristic morphology of monocytic lineage: larger cell sizes, fine-stranded nuclear appearance, and a variable number of cytoplasmic vacuoles. Both the morphologic and cell surfaces changes induced by hGM-CSF were identical to those induced by mGM-CSF treatment. They also showed increased surface expression of F4/80 and Mac3 (Fig. 2). None of the clones containing ter1, del1, del2, del3, P358G, or P360G was able to differentiate when incubated with hGM-CSF (Figs. 2 and 10). In contrast, all ter3 clones that were derived (five independent clones) differentiated as well as wild type clones in response to hGM-CSF (Figs. 2 and 10).

DISCUSSION

The GM-CSF receptor signals by ligand-mediated heterodimerization of GM-CSFR and GM-CSFR. Although the cytoplasmic domain of the GM-CSFR is only 54 amino acids, this short region of the receptor is necessary for GM-CSF-induced cell proliferation (16-18). In the present study, we have compared the role of GM-CSFR cytoplasmic domain in GM-CSF-mediated cell proliferation, survival, and differentiation. This analysis was made possible by our use of the WT19 cell line, which grows but does not differentiate in mIL-3. In comparison, mGM-CSF induces differentiation, but does not stop the growth of these cells. Our studies suggest that the mGM-CSF-mediated differentiation process is reversible upon removal of mGM-CSF. The WT19 cells are equally capable of responding to both murine and human GM-CSF when transfected with the wild type human GM-CSF receptor subunits.

By using a mutant GM-CSFR lacking most of the cytoplasmic domain, we have shown that the cytoplasmic domain of GM-CSFR is essential for both hGM-CSF-dependent cell differentiation and proliferation. This mutant was still able to interact with the -chain to form a high affinity receptor complex (Table II), suggesting that the cytoplasmic domain of GM-CSFR is not necessary for receptor dimerization. The GM-CSFR cytoplasmic domain was necessary for the phosphorylation of signaling molecules, JAK2, STAT5, Shc, and ERKs and the induction of c-fos and c-jun mRNA expression. Weak activation of STAT1 and STAT3 by GM-CSF have recently been reported in polymorphonuclear leukocytes (36). However, we could not detect the activation of these STATs in any of the transfectants in response to GM-CSF (data not shown). Deletion of the intracytoplasmic domain did not abolish c-myc mRNA induction after GM-CSF stimulation. Similar results were observed by us using BaF/3 cells (16).

Using other cell systems and varying approaches other laboratories have suggested that the internal portion of the GM-CSFR may not have a major role in regulating receptor function. For example, using a chimera of the extracellular domain of the erythropoietin receptor and the intracellular domain of the murine IL-3 receptor  chain (AIC2A), the addition of erythropoietin to the receptor was able to stimulate cell growth (37). Another study demonstrated that a chimera comprising the extracellular region of GM-CSFR and the intracellular domain of the hc can also transduce signals (38). These data suggest that dimerization of the -chain is important. However, they do not necessarily exclude the possibility that the GM-CSFR is an important dimerization partner, and there are no physiologic data demonstrating that two  chains dimerize to initiate signaling in normal cells. Both the  and  subunits have proline-rich regions close to the plasma membrane, and both of these regions are important for receptor function. In addition, we have shown that deletion of the  internal segment blocks both growth and differentiation.

By using deletion mutants of GM-CSF, we demonstrate that the membrane proximal proline-rich region and the adjacent 15 amino acids of the  subunit are indispensable for both cell proliferation and differentiation (Figs. 2, 7, and 10). The proline-rich region of GM-CSFR contains a Pro-X-Pro sequence that exists in the membrane-proximal box1 region of many other members of cytokine receptors (Fig. 3B). Mutation of this domain in the IL6 receptor gp130 protein (39) and in the granulocyte colony-stimulating factor receptor (40) eliminated receptor activity. We have here shown that similar mutations (P358G, P360G) also result in a receptor that is unable to mediate proliferation, differentiation, or other signaling events. Proline 357 could be part of a Pro-X-X-Pro motif, such as has also been found in cytokine receptors and SH3-binding proteins (41). This proline appears to be dispensable, however, since the P357G mutant was able to fully support proliferation and differentiation.

The region downstream from the proline-rich domain was also indispensable for hGM-CSF-dependent transduction of cell growth, survival, and differentiation signals. These 15 amino acid residues, which include aspartic acid 368, are conserved in IL5 receptor , prolactin receptor, growth hormone receptor, and IL2 receptor -chain. Our studies show that tyrosine phosphorylation of JAK2 and STAT5 is inhibited by the deletion of this region, demonstrating that the proline-rich domain alone is not sufficient for the GM-CSF-induced activation of the JAK2 signal transduction pathway. Similar results have been obtained in other systems. Deletion of 6 amino acids of the region downstream of proline-rich domain of IL5 receptor , including the conserved aspartic acid, abolished IL5-induced JAK2 activation (42), while mutation of the region immediately downstream of box1 region in the erythropoietin (43) and IL6 receptors (39) blocked the activation of JAK2.

Interestingly, our data about proline mutations in the box1 region were different from the recently published study on the IL-5 receptor -chain. In the previous report, the existence of any one of the three proline residues was adequate for IL-5-mediated cell proliferation signal (42). The difference between these findings could be secondary to differences in sequence in the -chains (PPVPQI, GM-CSF receptor; PPIPAP, IL-5 receptor), or, possibly the difference in results could be due to the divergence in amino acid residues adjacent to the proline-rich domain.

The C-terminal deletion of GM-CSFR only partially inhibited the hGM-CSF-induced cell proliferation (Figs. 7 and 8), but the cells died within several days due to the extensive apoptosis in the presence of hGM-CSF (Fig. 9). In the transfectants of this C-terminal deletion mutant (ter3), hGM-CSF-induced protein-tyrosine phosphorylation was severely impaired (Fig. 5).

Increased tyrosine phosphorylation of a 52-kDa protein, Shc, in response to GM-CSF stimulation has been reported (27-30, 44). Shc, when tyrosine-phosphorylated, binds to SH2 domains of Grb2, which leads to the recruitment of Sos, a guanine nucleotide exchange factor for Ras, to the plasma membrane (45). Tyrosine phosphorylation of Shc is thought to play an important role in GM-CSF-mediated activation of Ras through this mechanism (27). In ter3 transfectants, tyrosine phosphorylation of Shc was not detectable in response to hGM-CSF stimulation (Fig. 5A). hGM-CSF-induced activation of Ras-ERK pathway appeared to be impaired in these transfectants, since hGM-CSF-mediated ERK phosphorylation and c-fos induction, which are downstream events regulated by Ras activation (46, 47), could not be detected (Fig. 6). Our findings are compatible with a previous report that Ras activation is necessary for anti-apoptotic effect by GM-CSF, but not essential for GM-CSF-mediated DNA synthesis (27).

Our results demonstrate that ter3 transfectants differentiated as well as wild type transfectants in response to hGM-CSF. The ter3 clones are capable of stimulating increases in c-myc and to a lesser extent c-jun, but do not cause the phosphorylation of Jak2, STAT, and Shc, suggesting that activation of these proteins is not necessary for differentiation. The findings that ter3 cells die of apoptosis while they were capable of differentiation in hGM-CSF suggests that the pathways controlling cell survival and differentiation can be separated and are controlled by different portions of the GM-CSFR. hGM-CSF-mediated tyrosine phosphorylation of JAK2 and STAT5 could not be detected in ter3 clones (Fig. 5, B and C), suggesting that these pathways may be important for the inhibition of apoptosis. We have recently demonstrated that the expression of a chimeric protein of CD16 and Jak2 is capable of preventing cell death, implying that part of the function of the Jak/STAT pathway could be to inhibit apoptosis (51).

In contrast to other signal transduction pathways, both c-myc and c-jun were induced in ter3 transfectants by hGM-CSF to similar levels to that seen in wild type transfectants, suggesting that c-myc and c-jun can be induced without the activation of either ERKs or JAK2. In a recent report, it was shown that the transient expression of the dominant negative form of JAK2 inhibited hGM-CSF-induced transcription of a reporter plasmid containing the c-myc promoter, suggesting that JAK2 is essential for c-myc mRNA induction by hGM-CSF (48). It is possible that inhibition of c-myc promoter was caused by a nonspecific effect of the overexpression of dominant-negative JAK2, although further experiments will be needed to clarify this possibility. c-jun overexpression induces monocytic differentiation of the WEHI-3B (49) and U937 cells (50), while c-fos overexpression did not have similar biologic effects (49). However, it is unlikely that c-jun alone is responsible for hGM-CSF-mediated cell differentiation, as c-jun mRNA expression was equivalently induced by mIL3, which has no effect on the differentiated phenotype of WT19 cells (data not shown).

In summary, specific regions of the intracytoplasmic domain of the  subunit play an essential role in hGM-CSF-mediated cell proliferation, survival, and differentiation, while the signal transduction pathway which controls c-myc activation is independent of this subunit. Our results demonstrate that differentiation may occur in the absence of Shc, ERK, or JAK2 activation, suggesting that there are specific novel signal transduction pathways, yet to be determined, which control this process.